ID: 1184474778

View in Genome Browser
Species Human (GRCh38)
Location 22:44714523-44714545
Sequence GGGCCTGATGGGCAACCAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 253
Summary {0: 1, 1: 0, 2: 1, 3: 20, 4: 231}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184474768_1184474778 5 Left 1184474768 22:44714495-44714517 CCTTCTAGGAGAGAGGGAAAGAG 0: 1
1: 0
2: 6
3: 50
4: 471
Right 1184474778 22:44714523-44714545 GGGCCTGATGGGCAACCAGGGGG 0: 1
1: 0
2: 1
3: 20
4: 231
1184474767_1184474778 6 Left 1184474767 22:44714494-44714516 CCCTTCTAGGAGAGAGGGAAAGA 0: 1
1: 1
2: 3
3: 43
4: 464
Right 1184474778 22:44714523-44714545 GGGCCTGATGGGCAACCAGGGGG 0: 1
1: 0
2: 1
3: 20
4: 231
1184474766_1184474778 10 Left 1184474766 22:44714490-44714512 CCTGCCCTTCTAGGAGAGAGGGA 0: 1
1: 0
2: 0
3: 25
4: 214
Right 1184474778 22:44714523-44714545 GGGCCTGATGGGCAACCAGGGGG 0: 1
1: 0
2: 1
3: 20
4: 231
1184474762_1184474778 27 Left 1184474762 22:44714473-44714495 CCTGCAGGGATGGCTATCCTGCC 0: 1
1: 0
2: 1
3: 10
4: 139
Right 1184474778 22:44714523-44714545 GGGCCTGATGGGCAACCAGGGGG 0: 1
1: 0
2: 1
3: 20
4: 231

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184474778 Original CRISPR GGGCCTGATGGGCAACCAGG GGG Intronic
901040524 1:6360403-6360425 GGCCGAGATGGGCAGCCAGGGGG - Intronic
901180145 1:7336194-7336216 GGGCTTCATGGGGGACCAGGTGG - Intronic
901198242 1:7452228-7452250 GGGCCTGGAGAGGAACCAGGGGG - Intronic
901527911 1:9835681-9835703 GGGCCTGAAGGGGCAGCAGGAGG + Intergenic
903312931 1:22474357-22474379 GGGCCTGAAAGGCAACAATGTGG - Intronic
903486314 1:23691763-23691785 GGGCCTTATGGGCCAGGAGGCGG - Exonic
903757788 1:25674774-25674796 GGGCCTGATGGGCCTCAAGAAGG + Intronic
904392410 1:30194778-30194800 GTGCCTGTTAGGCAGCCAGGAGG + Intergenic
904594584 1:31635368-31635390 GGGCCTTATGGACCACCAGCTGG - Exonic
906645583 1:47472170-47472192 GGGCCTGCTGGGTCACCAGGAGG + Intergenic
907551711 1:55310400-55310422 GGGCCTGGTGGGTTCCCAGGAGG + Intergenic
907592782 1:55691515-55691537 GGTTCTGATGGGGAGCCAGGTGG + Intergenic
907732632 1:57082679-57082701 GGGCCTGTTGGGGGATCAGGGGG - Intronic
909360921 1:74757747-74757769 GGGCCAGTGGGGCAACCTGGTGG + Intronic
912550308 1:110481039-110481061 GAGCCAGATGGGCAACTGGGAGG + Intergenic
913097601 1:115534374-115534396 GAGCTTGATGGGCAACCCTGGGG - Intergenic
913367347 1:118054760-118054782 GGTCCTGATGGGGACCCAGAAGG - Intronic
914328162 1:146641166-146641188 GGGCCTGAGTGGCAATCAAGGGG + Intergenic
915724560 1:158008279-158008301 GGGCCTGCTGGGCAGCCCAGGGG - Intronic
916718926 1:167468551-167468573 GTTCCTGCTGGGCTACCAGGAGG - Intronic
920171810 1:204076601-204076623 GGGCGAGCTGAGCAACCAGGAGG + Intronic
920238934 1:204529515-204529537 GGGCCTTATGGACCACCAGCTGG - Intronic
920967351 1:210711999-210712021 GGGCCACATCGGCCACCAGGTGG + Intronic
922472002 1:225882518-225882540 GGGGCTGAGCGGCGACCAGGAGG - Intergenic
923751602 1:236751665-236751687 GGGCCTGGTGTGGGACCAGGGGG + Intronic
1065274915 10:24076077-24076099 GGGCCTGATGAACAACCTGTGGG + Intronic
1066199159 10:33128802-33128824 TGGCCTGACTGGCCACCAGGTGG - Intergenic
1066220983 10:33335951-33335973 GGGCCTGGGGGGCATCCAGCGGG - Intronic
1067235777 10:44448001-44448023 GGGCCTGTTGGGGAAGCTGGGGG - Intergenic
1069654716 10:70079309-70079331 GATTCTGATGGGCAGCCAGGTGG + Intronic
1069744844 10:70708619-70708641 GGGCCTGGTGGGGGACCAGCTGG + Exonic
1070329781 10:75408831-75408853 GACCCTGCTGGGAAACCAGGGGG + Intergenic
1070794211 10:79207538-79207560 GGGCCTGAAGCGGAACCAGGAGG + Intronic
1073182919 10:101596606-101596628 TGGACTGATGGGCAGACAGGAGG + Intronic
1076355625 10:129850814-129850836 GGGCCAGAGGGGCCACCAGTTGG - Intronic
1077378439 11:2216331-2216353 GGGCCAGATGGGCAGCCCCGAGG + Intergenic
1077502784 11:2916828-2916850 GGGCCTGAGGGGAAATCTGGGGG + Intronic
1079004266 11:16781201-16781223 GGGCCTGGTGGGGAACCGGATGG + Intronic
1079159513 11:17978873-17978895 GGGCCTGCAGGGCCACCAGATGG - Intronic
1080239078 11:30105702-30105724 GTGCCTGATGGGCATCACGGTGG + Intergenic
1081789711 11:45774314-45774336 CGGCCTGATGGGGCACCTGGAGG - Intergenic
1084273999 11:68042722-68042744 GGACCTGCTGCGCATCCAGGAGG + Exonic
1084377964 11:68791382-68791404 GGGGCAGTTGGGCAACGAGGTGG - Intronic
1084667154 11:70582620-70582642 GGTCCTGGTGGGCACCCAGTCGG + Intronic
1086108127 11:83169129-83169151 GGACCTCATGGTCAGCCAGGAGG + Exonic
1089060866 11:115625003-115625025 GGGACTGAGAGGCAACCAAGAGG + Intergenic
1090047476 11:123348899-123348921 GGGCCTGAAGGGAACCCAGGAGG - Intergenic
1090996916 11:131874994-131875016 GGGCCTGATGGGGCAGCAGCCGG + Intronic
1092280180 12:7092358-7092380 AAGGGTGATGGGCAACCAGGTGG - Intronic
1093027737 12:14260085-14260107 GGGCCTGGCGGGGTACCAGGAGG + Intergenic
1095962848 12:47846242-47846264 GGGCCAGCTGGGCAACCTGAAGG - Intronic
1096233268 12:49909423-49909445 GGGCCTGTAGGACATCCAGGTGG + Intergenic
1097184345 12:57188646-57188668 GAGCTTGGTGGGCAGCCAGGGGG - Intronic
1102207425 12:111099826-111099848 GGGGCCGATGGGCAGCTAGGAGG + Intronic
1102375744 12:112419361-112419383 GGGCCTGACGGGCATCCCCGGGG - Intronic
1102884082 12:116508561-116508583 GGGCCTAATTGGCATGCAGGAGG - Intergenic
1103014265 12:117481795-117481817 GGCCCTGATCAGCAACCTGGGGG - Intronic
1103795412 12:123499747-123499769 GGGACTGATGGGCAAGGAAGAGG - Intronic
1105543971 13:21338665-21338687 GGGGCTGATGGGAAGACAGGAGG - Intergenic
1105805561 13:23950002-23950024 GGGGGTGCTGGGCAGCCAGGGGG + Intergenic
1106006436 13:25774399-25774421 GGGCCTGTTGGGGAGGCAGGGGG + Intronic
1106315625 13:28590854-28590876 GGGCCTGATGGGCCAGCTCGAGG - Intergenic
1106553602 13:30791683-30791705 GGGCCTGCTGGGGAGCCAGCAGG + Intergenic
1107747247 13:43523700-43523722 GGGCCTCAGAGGCTACCAGGAGG - Intronic
1113835501 13:113326047-113326069 GGGCCTGAAGACCGACCAGGAGG - Exonic
1117447526 14:55818924-55818946 GGGTCTCATGGGCCACCTGGTGG + Intergenic
1117842439 14:59873788-59873810 GGGCCTGAGGGGCATGGAGGTGG - Intergenic
1118250871 14:64159769-64159791 GGGCCAGATGGGCATCCTGCAGG + Intronic
1118918947 14:70132523-70132545 GGGCATGGTGGGCAAGCAGGTGG + Intronic
1121613201 14:95294971-95294993 AGGCCTGATGGGCAAGAAGAGGG - Intronic
1121626004 14:95385860-95385882 GGGGCAGATGAGCATCCAGGTGG - Intergenic
1121819708 14:96956538-96956560 GGGCCATGTGGGGAACCAGGAGG + Intergenic
1122454775 14:101841807-101841829 GGGCCAGGTGGACAGCCAGGAGG + Intronic
1124479759 15:30068221-30068243 GGGCCTGATGGGAAGCAGGGTGG - Intergenic
1129264421 15:74386295-74386317 GGGGCTCAAGGGCAACAAGGAGG + Intergenic
1130576994 15:85101891-85101913 GGTCCTGGTGGGCAGTCAGGTGG + Intronic
1131405856 15:92163844-92163866 GGGCCTGAGGGGGAGCCAGGTGG + Exonic
1131508267 15:93034666-93034688 GGGCCTGAGTGGCAAGCAGAAGG + Intergenic
1133777672 16:8910245-8910267 GAGCATGGTGGGCGACCAGGTGG - Intronic
1136682204 16:31974418-31974440 GGGCGCGCGGGGCAACCAGGGGG + Intergenic
1136782457 16:32915585-32915607 GGGCGCGCGGGGCAACCAGGGGG + Intergenic
1136887335 16:33938266-33938288 GGGCGCGCGGGGCAACCAGGGGG - Intergenic
1138201246 16:55090340-55090362 GGCCCTTCTGGGCTACCAGGAGG - Intergenic
1139505248 16:67395277-67395299 GGGACTGAGGGGGAAGCAGGAGG + Intronic
1140005400 16:71069781-71069803 GGGCCTGAGTGGCAATCAAGGGG - Intronic
1140650775 16:77085636-77085658 GTGCTAGATGGGCAAACAGGCGG + Intergenic
1140802265 16:78499359-78499381 GGGGCTGGTGGACAGCCAGGGGG - Intronic
1140940832 16:79720383-79720405 GGGCCACAGAGGCAACCAGGGGG + Intergenic
1140967507 16:79981205-79981227 GGCCGAGATGGGCAACAAGGAGG - Intergenic
1141385451 16:83619148-83619170 ATGTCTGATGGGCAAGCAGGTGG - Intronic
1142007072 16:87694411-87694433 GGGCCAGACGGTCAAGCAGGAGG + Intronic
1142023890 16:87801974-87801996 GGACCTGCAGGGCACCCAGGTGG - Intergenic
1144426588 17:15148511-15148533 GGGACTCATGGAGAACCAGGAGG + Intergenic
1144428995 17:15173555-15173577 AGGCCAGGTGGGCAGCCAGGGGG + Intergenic
1144829182 17:18122066-18122088 GGCCCTGATGGGCGCCAAGGGGG - Exonic
1145006862 17:19343230-19343252 CGGCCTGAGGGGCAGCCTGGTGG - Exonic
1146783060 17:35693422-35693444 GGGCCTGAAAGTCAATCAGGTGG + Intronic
1148789957 17:50167493-50167515 CGGCCTGACAGGCACCCAGGCGG + Intronic
1150741735 17:67784553-67784575 GGAAGTGATGGGAAACCAGGGGG - Intergenic
1151483554 17:74384539-74384561 GGGCTTGCTGGGTAACAAGGGGG + Intergenic
1151984234 17:77531719-77531741 AGGCCTGCTGGCCATCCAGGAGG + Intergenic
1152002615 17:77655931-77655953 GGGGGTGAGGGGCAAGCAGGGGG - Intergenic
1152643189 17:81457672-81457694 GGGGTTGCTGGGTAACCAGGAGG + Intronic
1152643199 17:81457702-81457724 GGGTTTGCTGGGTAACCAGGAGG + Intronic
1152643210 17:81457732-81457754 GGGGTTGCTGGGTAACCAGGAGG + Intronic
1152643245 17:81457823-81457845 GGGGTTGCTGGGTAACCAGGAGG + Intronic
1152643281 17:81457914-81457936 GGGGTTGCTGGGTAACCAGGAGG + Intronic
1152643305 17:81457973-81457995 GGGGTTGCTGGGTAACCAGGAGG + Intronic
1152643316 17:81458003-81458025 GGGGTTGCTGGGTAACCAGGAGG + Intronic
1153845568 18:9046506-9046528 GGGCTGGATGGGCCATCAGGAGG + Intergenic
1154212803 18:12394562-12394584 GGGCGTGAGAGGCACCCAGGCGG + Intergenic
1154503058 18:15005943-15005965 GGGGCTGAGGGGCACGCAGGTGG + Intergenic
1155032409 18:21996150-21996172 GGTCATGATGGGCAAACAGTAGG + Intergenic
1160038179 18:75320507-75320529 GGGCTGGAGGGGCAGCCAGGTGG + Intergenic
1160584347 18:79904278-79904300 GGGGCTCAGGGGCACCCAGGGGG + Intronic
1160855368 19:1214885-1214907 GAGCCTGATGCTCCACCAGGAGG - Intronic
1160927891 19:1555815-1555837 GGGGCTGCTGGGCAGCGAGGTGG + Exonic
1161002728 19:1919047-1919069 GGGCCTGCTGGGAAGCCAGGCGG + Intronic
1161238833 19:3210764-3210786 GGGCCTGGTGGGCCACGGGGAGG + Intergenic
1161332907 19:3696779-3696801 GGGCCTGATGGGCTTCAAAGAGG + Intronic
1161404413 19:4083645-4083667 GGTCCTGATGTTCAAACAGGAGG + Intergenic
1161515451 19:4693768-4693790 GGGCCTGCTGGGGCTCCAGGAGG - Intronic
1161621410 19:5299214-5299236 GGGCCTTGTGGGCCACCAGGAGG - Intronic
1163032986 19:14556515-14556537 GTGCGTGCTGGGCAAGCAGGGGG - Intronic
1163123836 19:15233460-15233482 GGGCCTGTTGGGCCAGCAGGAGG - Intergenic
1163144732 19:15372922-15372944 CGGCGTGATGGGCATGCAGGGGG - Exonic
1164619711 19:29687352-29687374 GGGCCAGAGGCGCAGCCAGGAGG + Intergenic
1165728004 19:38125566-38125588 GAGCCTGCTGGGGAACCAGTGGG + Intronic
1166074016 19:40403585-40403607 GGGCGTGACCGGCGACCAGGAGG - Intronic
1167000883 19:46745558-46745580 GGTCCAGATGGGGAACCGGGAGG - Intronic
924972223 2:139069-139091 GGGCCAGAAGGGCAAAAAGGTGG - Intergenic
926107298 2:10160416-10160438 GGGCCCGATGGGCAAGCCCGAGG - Intronic
926523050 2:13941851-13941873 AGGCCTGATGGTCCACCAGATGG - Intergenic
926976990 2:18525329-18525351 GGGCCGGAAGGGCACCCAGAGGG + Intergenic
929557804 2:42936537-42936559 GGGGCTGATGGGCAACCCACAGG - Intergenic
935145212 2:100390830-100390852 CGGCCTGCAGGGCACCCAGGTGG - Intergenic
936269809 2:111041051-111041073 GGGCCTGGAGGGCCTCCAGGTGG + Intronic
937856343 2:126674436-126674458 GGACCTGATGGGAAACAAGTGGG + Intronic
938080453 2:128367319-128367341 GGGCCTCATGGACACCGAGGGGG - Intergenic
938502223 2:131836113-131836135 GGGGCTGAGGGGCACGCAGGTGG + Intergenic
939499811 2:142969690-142969712 GATCCTGATTGACAACCAGGAGG - Intronic
940905752 2:159167898-159167920 GAGCCTGTTGGGCAGCCAGAGGG + Intronic
948122289 2:235539952-235539974 GGGCCTGAACGGAGACCAGGAGG - Intronic
948747393 2:240106601-240106623 GAGCCTCATAGGCAAGCAGGAGG + Intergenic
1172173966 20:32961240-32961262 GGACATGGTGGGCCACCAGGCGG - Intergenic
1172474323 20:35226300-35226322 GGGCCTGAGAGGCAGCCTGGGGG - Intergenic
1173479670 20:43389179-43389201 GGGCCTGCTGTCCAAGCAGGTGG - Intergenic
1173865503 20:46309809-46309831 GGGCCAGAGGGGCAGCCAGCAGG - Intergenic
1174101184 20:48127344-48127366 GGGACTGAGGGGCAGCCAGCAGG - Intergenic
1175421567 20:58837994-58838016 GGGCCTGGTGGGCCACCCAGTGG + Intergenic
1178133054 21:29595117-29595139 GAACATGATGGGCTACCAGGAGG + Intronic
1178216646 21:30606128-30606150 GGGCCTGAGGGGAATACAGGAGG + Intergenic
1178700010 21:34825309-34825331 GTGCCAGATGGGGAAACAGGAGG - Intronic
1180312827 22:11253347-11253369 GGGCCTGGTGGGCACCCGGAAGG - Intergenic
1180762607 22:18221384-18221406 GGGCCTGATGGGCGTCCAGAAGG + Intergenic
1180773060 22:18403224-18403246 GGGCCTGATGGGCGTCCAGAAGG - Intergenic
1180804417 22:18652773-18652795 GGGCCTGATGGGCGTCCAGAAGG - Intergenic
1180806335 22:18716637-18716659 GGGCCTGATGGGCGTCCAGAAGG + Intergenic
1181217281 22:21342418-21342440 GGGCCTGATGGGCGTCCAGAAGG + Intergenic
1181474741 22:23161224-23161246 GGACCTCATGGGCATCCATGAGG + Intronic
1183063040 22:35347132-35347154 GGGCCAGATGGGGGACCCGGGGG - Exonic
1183111912 22:35656419-35656441 GAGGCTGATGGACAACCAGGCGG + Exonic
1183948013 22:41337802-41337824 GGGCTGGATGGGCCAGCAGGTGG - Intronic
1183976623 22:41515959-41515981 GGGCCTGATGGGTCTCCAGTTGG + Intronic
1184474778 22:44714523-44714545 GGGCCTGATGGGCAACCAGGGGG + Intronic
1184823629 22:46932259-46932281 GGCCTTGACGGGCAACCTGGGGG - Intronic
1185367250 22:50442321-50442343 GGGCCTGCTGGTCAACAGGGCGG - Intronic
1203234893 22_KI270731v1_random:144206-144228 GGGCCTGATGGGCGTCCAGAAGG - Intergenic
950764496 3:15263261-15263283 GGGCCTGATGGGCAGGCAAATGG + Intronic
951607203 3:24449058-24449080 GGGAGTGATGGGCAGCCATGTGG + Intronic
956667791 3:71658423-71658445 GGCCCTGCTGGGTAACGAGGAGG + Intergenic
956768101 3:72501672-72501694 AGGCCAGATGGGGAGCCAGGAGG + Intergenic
958145673 3:89621556-89621578 GTGACTGATGGGCAACATGGAGG - Intergenic
961035802 3:123640677-123640699 TTCCCTGATGGGAAACCAGGAGG - Intronic
961325935 3:126109392-126109414 GGGCCTGGGGGACATCCAGGTGG + Intronic
961442816 3:126962831-126962853 GGGCTGGGTGGGCACCCAGGAGG - Intergenic
961755856 3:129127019-129127041 AGGCCTGATGTCCATCCAGGCGG + Intronic
962811467 3:138962285-138962307 GTGCCTGAGGGACATCCAGGGGG + Intergenic
964119035 3:153163026-153163048 GATCCTGGTGGGCAACAAGGTGG + Exonic
964620664 3:158717493-158717515 GGGCCTGAGGAGCAGCCATGGGG + Intronic
968661114 4:1799227-1799249 GGGGAAGATGGGCAACCATGAGG - Intronic
968945610 4:3661999-3662021 GTGCCTGAGGGGTAACCAGGAGG - Intergenic
969520597 4:7675750-7675772 CGGCCTGATGTGGGACCAGGAGG + Intronic
985775995 5:1842533-1842555 TGCCCTGATAGGCAACAAGGGGG + Intergenic
993567989 5:89499062-89499084 GGGCCTTAAAGGCAACTAGGAGG - Intergenic
997615725 5:135244942-135244964 GACCCTGATGGGCAAACAGGTGG + Intronic
998374168 5:141680468-141680490 GGTCCTGAGGGGCAGCCATGGGG + Exonic
999251409 5:150184358-150184380 GGCCCTGATGGGCAGCCTGGCGG - Exonic
1001442064 5:171750750-171750772 GCGCCTGAAGGGGAACCAGAGGG - Intergenic
1002424499 5:179167263-179167285 GGGCCCGAGCGGCCACCAGGTGG + Intronic
1003649133 6:7942505-7942527 GTGCCTGTGGAGCAACCAGGAGG - Intronic
1004266679 6:14154119-14154141 GGGCCTGATGGACAATAAGCAGG - Intergenic
1006197556 6:32255150-32255172 GCGCTTGAGGGGGAACCAGGAGG + Intergenic
1006430440 6:33992705-33992727 GGGGCTGATGGGCAGCTGGGAGG - Intergenic
1011075123 6:83430840-83430862 GGGGCCGATGGGCGGCCAGGTGG + Intronic
1011663061 6:89610735-89610757 GGGTCTAATGTGCAGCCAGGTGG - Intronic
1018792286 6:167157729-167157751 GGGTCTGCTGGGCAACGCGGTGG - Exonic
1019515836 7:1439878-1439900 GGGCCAGCTAGGCAACCCGGGGG + Intronic
1021435288 7:20606624-20606646 GGGCCACATGGGCAACCACTGGG - Intergenic
1021900782 7:25283093-25283115 TGGCATGATGGACAACAAGGCGG - Intergenic
1022516994 7:30981248-30981270 GGGCGTCATGGGCAACAATGTGG - Intronic
1023049631 7:36239777-36239799 GCCCCTGATGGGCAAGTAGGGGG - Intronic
1024540460 7:50471547-50471569 GGGCCTGGTGTGCAACTGGGGGG - Intronic
1025021163 7:55481257-55481279 GAGCCCGCTGGGCAGCCAGGAGG + Intronic
1026955850 7:74376108-74376130 GGCCCTGAAGGCCTACCAGGCGG + Exonic
1027256318 7:76432959-76432981 GGTCCTGAAGGGCAACCAGGTGG - Exonic
1028459720 7:91077481-91077503 GGGCCTGTTGGGGAGTCAGGGGG + Intronic
1029170651 7:98627292-98627314 GGGCTTGATGGGGTGCCAGGGGG - Exonic
1029361213 7:100089622-100089644 GGCTCTGATTGGCAAGCAGGAGG + Exonic
1029375687 7:100175805-100175827 GGGCGTGCTGGGCATACAGGCGG + Exonic
1029514110 7:101015401-101015423 GGGAGTGAGGGGCAGCCAGGAGG + Intronic
1029692380 7:102190879-102190901 GGGGCTGATGGGACAGCAGGAGG - Intronic
1030379397 7:108795151-108795173 AGGCCTGATGGGGAAAGAGGAGG + Intergenic
1034352728 7:150427912-150427934 GCACCTGATAGGCAGCCAGGTGG - Intergenic
1041436957 8:57852571-57852593 GGGCCAGAGAGGGAACCAGGGGG + Intergenic
1042206449 8:66334345-66334367 TTTCCTGATGGCCAACCAGGAGG - Intergenic
1045583092 8:103500349-103500371 CGGCCCGAGGGGCACCCAGGCGG - Intergenic
1047615129 8:126557374-126557396 CAGCGTGATGGGCAACCAGGTGG - Exonic
1047683729 8:127282164-127282186 AGCCCTGATGGGCAGCAAGGAGG + Intergenic
1047767302 8:128000344-128000366 GGGCCTCCTGGGCAGTCAGGAGG + Intergenic
1048683962 8:136880850-136880872 GGATCTGAGGGGCAACCTGGTGG + Intergenic
1049088275 8:140494466-140494488 GGGCCTGAGGAGCAGCCTGGAGG - Intergenic
1049569131 8:143360141-143360163 GGTGCTGACGGGCACCCAGGAGG + Intergenic
1049836389 8:144738249-144738271 GAACCCCATGGGCAACCAGGTGG - Intronic
1050906498 9:11012357-11012379 AGGCTTGATGGGCATGCAGGAGG + Intergenic
1053414860 9:37940938-37940960 GCTCCTGATGAGCAACTAGGAGG + Intronic
1053492891 9:38523904-38523926 GGGCATGATGGGGAAGCAGAGGG - Intergenic
1054196241 9:62034856-62034878 GGCTTTGATGGGCAATCAGGAGG + Intergenic
1054642164 9:67553833-67553855 GGCTTTGATGGGCAATCAGGAGG - Intergenic
1055574152 9:77646165-77646187 GGGCCTCTTGGGCACCCACGGGG + Intronic
1056459633 9:86797291-86797313 GAGCCTGGTGGGGAAACAGGAGG - Intergenic
1056606404 9:88089417-88089439 GGCCCTGATGGGAAAACATGAGG - Intergenic
1057673123 9:97112822-97112844 GGGCATGATGGGGAAGCAGAGGG - Intergenic
1058635427 9:107033772-107033794 GGGCATGATGGGGGACCATGGGG - Intergenic
1059427777 9:114231821-114231843 GGGACTGATGGGCAGCGTGGGGG + Exonic
1062231666 9:135485344-135485366 GGGCCTGCTGGGCGTCCAGAAGG + Exonic
1062357155 9:136170439-136170461 GGGCCAGAGTGGCAGCCAGGGGG + Intergenic
1062395310 9:136350400-136350422 GGGCCTGAGGGGCACCCAAGGGG + Intronic
1062497218 9:136837566-136837588 GGGGCTGAGGGGCACGCAGGTGG - Exonic
1186932188 X:14405934-14405956 GGGCCGTATGGGCAACCACAGGG - Intergenic
1189325837 X:40109945-40109967 GGGCCTCATGGGAAAGCTGGAGG + Intronic
1190702820 X:53000816-53000838 GGGCCTGGGTGGAAACCAGGAGG + Intergenic
1192511249 X:71721608-71721630 GCGCCTGTTGGCCAACCTGGTGG + Intergenic
1192515448 X:71759945-71759967 GCGCCTGTTGGCCAACCTGGTGG - Intergenic
1196732156 X:118951899-118951921 GGGCCCAAGGGGCAAGCAGGAGG + Intergenic
1196828596 X:119759240-119759262 GGCCCTGAAGGGCCGCCAGGTGG - Exonic
1196972474 X:121124560-121124582 GGGCCCGAGGAGCAACTAGGTGG - Intergenic
1198210298 X:134509928-134509950 GGGCCTGCTGGGGAGCCAGCAGG - Intronic
1198486145 X:137089489-137089511 GTGCCTGTTGGTCACCCAGGTGG - Intergenic
1200115410 X:153767742-153767764 GGGCCCAAGGGGCACCCAGGCGG + Exonic
1200215975 X:154368468-154368490 GGGGCCTATGGGGAACCAGGAGG + Intronic
1200252835 X:154562857-154562879 GGCCCTGGTGGCCAAACAGGAGG + Exonic
1200264932 X:154641559-154641581 GGCCCTGGTGGCCAAACAGGAGG - Intergenic