ID: 1184475717

View in Genome Browser
Species Human (GRCh38)
Location 22:44720173-44720195
Sequence TCAGCTCAGCTCAGGCCAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 400
Summary {0: 1, 1: 1, 2: 2, 3: 37, 4: 359}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184475712_1184475717 -2 Left 1184475712 22:44720152-44720174 CCACTGTCAGGGAGCCCGTGCTC 0: 1
1: 1
2: 0
3: 13
4: 146
Right 1184475717 22:44720173-44720195 TCAGCTCAGCTCAGGCCAGGTGG 0: 1
1: 1
2: 2
3: 37
4: 359
1184475703_1184475717 20 Left 1184475703 22:44720130-44720152 CCCCTTAGGGAGTGGTCCCCTCC 0: 1
1: 0
2: 0
3: 8
4: 92
Right 1184475717 22:44720173-44720195 TCAGCTCAGCTCAGGCCAGGTGG 0: 1
1: 1
2: 2
3: 37
4: 359
1184475704_1184475717 19 Left 1184475704 22:44720131-44720153 CCCTTAGGGAGTGGTCCCCTCCC 0: 1
1: 0
2: 2
3: 3
4: 97
Right 1184475717 22:44720173-44720195 TCAGCTCAGCTCAGGCCAGGTGG 0: 1
1: 1
2: 2
3: 37
4: 359
1184475711_1184475717 -1 Left 1184475711 22:44720151-44720173 CCCACTGTCAGGGAGCCCGTGCT 0: 1
1: 1
2: 0
3: 7
4: 96
Right 1184475717 22:44720173-44720195 TCAGCTCAGCTCAGGCCAGGTGG 0: 1
1: 1
2: 2
3: 37
4: 359
1184475708_1184475717 4 Left 1184475708 22:44720146-44720168 CCCCTCCCACTGTCAGGGAGCCC 0: 1
1: 0
2: 3
3: 44
4: 357
Right 1184475717 22:44720173-44720195 TCAGCTCAGCTCAGGCCAGGTGG 0: 1
1: 1
2: 2
3: 37
4: 359
1184475705_1184475717 18 Left 1184475705 22:44720132-44720154 CCTTAGGGAGTGGTCCCCTCCCA 0: 1
1: 0
2: 1
3: 10
4: 100
Right 1184475717 22:44720173-44720195 TCAGCTCAGCTCAGGCCAGGTGG 0: 1
1: 1
2: 2
3: 37
4: 359
1184475709_1184475717 3 Left 1184475709 22:44720147-44720169 CCCTCCCACTGTCAGGGAGCCCG 0: 1
1: 0
2: 1
3: 19
4: 156
Right 1184475717 22:44720173-44720195 TCAGCTCAGCTCAGGCCAGGTGG 0: 1
1: 1
2: 2
3: 37
4: 359
1184475710_1184475717 2 Left 1184475710 22:44720148-44720170 CCTCCCACTGTCAGGGAGCCCGT 0: 1
1: 0
2: 1
3: 11
4: 103
Right 1184475717 22:44720173-44720195 TCAGCTCAGCTCAGGCCAGGTGG 0: 1
1: 1
2: 2
3: 37
4: 359

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184475717 Original CRISPR TCAGCTCAGCTCAGGCCAGG TGG Intronic
900813822 1:4828174-4828196 TGAGCTCAGTCCAGGCCATGAGG + Intergenic
901400859 1:9014395-9014417 TCAGCTCATCTCAGTCTAGCTGG + Intronic
901794894 1:11674475-11674497 TCAGCTCAGCCCAGCCCTTGGGG + Exonic
902376068 1:16030420-16030442 ACAGGTCGGCTCAGGCCAGGAGG - Intronic
902606780 1:17573468-17573490 TCAGTTCAGCTGATGGCAGGTGG + Intronic
903344101 1:22673455-22673477 TCTGCTCAGGCCAGGCCGGGGGG - Intergenic
903677289 1:25072439-25072461 TCAGCAAACCTCAGGCCTGGGGG - Intergenic
903835623 1:26201563-26201585 TCTGCTCAGCCCAGCCCAGCCGG + Intronic
903930209 1:26857511-26857533 TCAGCTGAGCCCAGGGCTGGGGG + Exonic
904197163 1:28794476-28794498 GCAGCTCAGCTCTGGGCAGGGGG - Intergenic
904490301 1:30854532-30854554 TCAGCTCAGGCCGGGCAAGGTGG + Intergenic
904581116 1:31544960-31544982 TCAGCTCAGCCAAGGCCAGAAGG + Intergenic
905951392 1:41954482-41954504 TCACCTTGGCACAGGCCAGGTGG + Intronic
906345779 1:45013518-45013540 TCTGTTCAGCTCATTCCAGGAGG - Intronic
906533167 1:46535242-46535264 TCAGCTCTGGACAGGCCTGGAGG - Intergenic
906626387 1:47329473-47329495 GCAGCTCAGCTGAGGGCTGGAGG - Intergenic
906674137 1:47681120-47681142 TCAGCCCAGGGCAGGGCAGGGGG - Intergenic
907443151 1:54490591-54490613 TCAGCTCTGCGCCTGCCAGGAGG - Intergenic
907517073 1:54999390-54999412 CCAGGTCAGCTGGGGCCAGGAGG + Intronic
907638552 1:56161121-56161143 TCACCTCATCTCAGCCCCGGGGG + Intergenic
907985295 1:59524285-59524307 GCAGCTCGGCTCAGGCCTGCAGG + Intronic
909805441 1:79868999-79869021 TGAACTCAGCTCAGACCAAGTGG + Intergenic
910768699 1:90809167-90809189 TCAGAGGAGCCCAGGCCAGGAGG - Intergenic
911552948 1:99306367-99306389 GCAGCTCTGCTCGGGCCAAGTGG + Exonic
913972478 1:143424855-143424877 TCTGCTCAGCACAGACCCGGGGG + Intergenic
913989419 1:143596721-143596743 TCAGCTCAGCAAAGGCCAATTGG + Intergenic
914066862 1:144250468-144250490 TCTGCTCAGCACAGACCCGGGGG + Intergenic
914112291 1:144715886-144715908 TCTGCTCAGCACAGACCCGGGGG - Intergenic
914406735 1:147382352-147382374 CAGGCTCATCTCAGGCCAGGAGG + Intergenic
915018789 1:152760682-152760704 TGGCCTCAGCTCAGGGCAGGAGG - Exonic
915044486 1:153000504-153000526 TCTTCTCAGCTCACACCAGGAGG + Intergenic
915226062 1:154412373-154412395 TAATCCCAGCTGAGGCCAGGAGG - Intronic
915292749 1:154897433-154897455 GCAGCTCAGCTCAGCTCACGAGG - Intergenic
915362871 1:155296139-155296161 TCAGCTCTCCTCAGTCCATGAGG - Intronic
915785992 1:158612746-158612768 TCTGGTCATCTCAGGCCCGGTGG - Intronic
917020484 1:170581267-170581289 TCAGCCCAACTGAGGCAAGGGGG - Intergenic
918188015 1:182144612-182144634 ACAGCTCAGCACAGGGAAGGGGG - Intergenic
918200789 1:182265146-182265168 TCAAGTCAGCTCAGAGCAGGAGG - Intergenic
918402100 1:184173768-184173790 TCACCTGAGGTCTGGCCAGGTGG + Intergenic
919977657 1:202623315-202623337 GCAGCTCAGGGCTGGCCAGGCGG - Intronic
920084036 1:203401432-203401454 TCAGGGCAGCTGAGGCCAGTGGG + Intergenic
920215575 1:204359756-204359778 TCCCCCCAGCTCAGGCCAGCTGG + Exonic
920418992 1:205817571-205817593 TCACCTCAGCTCTGGGCAGCAGG - Intergenic
920730244 1:208476679-208476701 TCCGCTCAGATCAGGCATGGAGG + Intergenic
920763519 1:208809048-208809070 TCAGCTCACCTGATGACAGGTGG - Intergenic
922899205 1:229123265-229123287 TCAGGGGAGCTCAGGGCAGGTGG - Intergenic
923087210 1:230710760-230710782 CCAGGCCAGCCCAGGCCAGGAGG + Exonic
1063061777 10:2563184-2563206 TGAGCCCAGCCCAGACCAGGAGG - Intergenic
1063069803 10:2649687-2649709 TCAGCTCGGCTATGGCCTGGTGG - Intergenic
1063526614 10:6792811-6792833 TCAGCTCAGGTGAGGCCACCAGG - Intergenic
1063565499 10:7170026-7170048 TCTGCTCTGGGCAGGCCAGGTGG + Intronic
1064852383 10:19723444-19723466 TGAGCTCAGGTCAGGCAAAGTGG + Intronic
1067077797 10:43197970-43197992 CCAGCACAGGGCAGGCCAGGCGG - Intronic
1067660788 10:48235018-48235040 TCCCCTCAGCTGAGGGCAGGTGG + Intronic
1069661446 10:70126216-70126238 AGGGCTCAGCACAGGCCAGGAGG - Intronic
1069909793 10:71752046-71752068 TGCCCTCAGCTCAGGACAGGTGG - Intronic
1070700570 10:78598794-78598816 GCAGCTCACCTCAGAACAGGTGG - Intergenic
1070804212 10:79261247-79261269 CGCGCTCAGCTCAGGCCAGCTGG + Intronic
1070825877 10:79390507-79390529 ACAGCTCAGATGAGCCCAGGAGG - Intronic
1071504357 10:86223643-86223665 GCAGCTCAGCTCAGGCTTTGAGG + Intronic
1071617973 10:87094217-87094239 TCAGCCCAGCCCAGCCCAGCTGG - Intronic
1072804597 10:98416689-98416711 TCTGCTCCTCTGAGGCCAGGAGG - Exonic
1074562205 10:114544486-114544508 TCAGCTCAGCCCCGGCCACAGGG + Intronic
1075331788 10:121579303-121579325 GCAACTCAGCCCTGGCCAGGAGG + Intronic
1075563521 10:123486221-123486243 TCAGCACAGCTCACACCAGATGG - Intergenic
1075630177 10:123995847-123995869 TCAGCTCGGCTCTGGCCTGCAGG + Intergenic
1075744274 10:124715705-124715727 TCAGCCCAGCTCAGTCCCAGAGG + Intronic
1075900296 10:126037842-126037864 GCAGCTCACCTAAAGCCAGGTGG + Intronic
1076535935 10:131177750-131177772 TCAGCTAAGGTCACGGCAGGAGG + Intronic
1076689200 10:132212492-132212514 TCACCTCAGCTGAGGCCACAGGG - Intronic
1077119101 11:898678-898700 TCAGTCCAGTCCAGGCCAGGTGG + Intronic
1077315340 11:1917210-1917232 TCAGGTCAGCTCAGGGCATGAGG + Intergenic
1077336659 11:2008155-2008177 TCACCTCTGTTCATGCCAGGAGG + Intergenic
1077826098 11:5809350-5809372 TCTGGTCAGCTCAGCCCATGGGG - Intronic
1078006894 11:7538872-7538894 TCAGTTAAGCTCAGGCCAGTGGG - Intronic
1078089138 11:8253138-8253160 TCTGCCCAGCTGAGGGCAGGGGG - Intronic
1079137878 11:17786551-17786573 TGAGTTCAGCTCAGGAGAGGAGG - Intergenic
1079975410 11:27084640-27084662 ACAGCTCAGTTCAGTGCAGGTGG + Intronic
1080442704 11:32310110-32310132 TCTGCTCTGCTCAGACCTGGGGG - Intergenic
1081705854 11:45181494-45181516 CTAGAGCAGCTCAGGCCAGGAGG - Intronic
1082660464 11:55903575-55903597 TGAGCTCAGCTGAGGGCAGACGG - Intergenic
1082964940 11:58957645-58957667 TCATCTTAGCTCAGCCCAGCTGG + Intronic
1083413275 11:62508408-62508430 TCAGCTCCGCCCAGGCAAGCAGG - Intronic
1083774986 11:64890231-64890253 TGAGCTGAGATCATGCCAGGAGG + Intergenic
1083812544 11:65113611-65113633 TGAGCTGGCCTCAGGCCAGGGGG + Intronic
1083894434 11:65613133-65613155 TCAGCCGAGCTCTGGCCGGGCGG - Exonic
1084148635 11:67277930-67277952 GGAGCTCAGCTCTGGACAGGGGG + Intronic
1084795953 11:71504219-71504241 TCAGCTCGACTCATGCCAGGAGG - Intronic
1085580922 11:77649700-77649722 TCAGCTCAGGTCAGGCCTGGTGG - Intergenic
1087827745 11:102785436-102785458 TCAGTGCAGCACAGGCCAAGAGG - Intergenic
1089115656 11:116093181-116093203 CCAGCACAGCAGAGGCCAGGTGG - Intergenic
1089348296 11:117805997-117806019 TTAGCTGAGCGCAGGCCAGGCGG - Intronic
1090429143 11:126631495-126631517 TTAGCTCTGCTCAGGACAGGTGG + Intronic
1090434291 11:126673902-126673924 GGAGCTCAGTACAGGCCAGGAGG + Intronic
1202819643 11_KI270721v1_random:63337-63359 TCACCTCTGTTCATGCCAGGAGG + Intergenic
1092942853 12:13426731-13426753 ACAGCTCAGTTCAGTACAGGTGG + Intergenic
1092957858 12:13566087-13566109 TCAGGTGAGCTCAGAACAGGAGG - Intronic
1094363092 12:29651095-29651117 TCACCTCTGCTCAGACCTGGAGG - Intronic
1096096272 12:48937778-48937800 TCAGCCCTGGTCAGGCCAGTAGG + Exonic
1096653111 12:53071848-53071870 TCACCCCAGCTTGGGCCAGGTGG - Intronic
1096722012 12:53530116-53530138 GCAGCACAACTCAGGCAAGGCGG + Intronic
1101750280 12:107577711-107577733 TCTGCTCATCTCAGGCCACGTGG + Intronic
1101874113 12:108587789-108587811 TCTGCTCTGATCAGCCCAGGAGG - Intergenic
1103563217 12:121803472-121803494 CCAGCTCAGCTCCGGGGAGGGGG + Intergenic
1103950064 12:124545607-124545629 TGAGCTCAGCTCAGCCCAGCAGG + Intronic
1104904369 12:132205504-132205526 GCTGCTCAGCTCAGCCCAGCCGG + Intronic
1104920581 12:132288572-132288594 TCAGCTACCCTCTGGCCAGGCGG - Intronic
1105202452 13:18191835-18191857 TCAGCTCAGGTCAGATAAGGTGG + Intergenic
1105411445 13:20174735-20174757 TCACTCCAGCTGAGGCCAGGGGG - Intergenic
1105541247 13:21319370-21319392 ACGGCTCAGCTCCGGCCTGGTGG - Intergenic
1108510434 13:51150995-51151017 TGCACACAGCTCAGGCCAGGGGG - Intergenic
1111243697 13:85508148-85508170 GCAGCTCAGCGCAGGCCTGCAGG + Intergenic
1112945248 13:104919989-104920011 TTACCTGAGCTCTGGCCAGGAGG - Intergenic
1114675287 14:24436234-24436256 CCAGCTCTGCTCTGGCCATGGGG + Intronic
1115217769 14:31029528-31029550 TCAGCTCAGATCAGGCACAGTGG + Intronic
1119851799 14:77871580-77871602 GCAGATCACCTGAGGCCAGGAGG - Intronic
1122099688 14:99397629-99397651 TTAGCACAGCCCAGGGCAGGAGG + Intergenic
1122199925 14:100116299-100116321 TCTGCCCAGCTCAGACCAGGTGG + Intronic
1122256750 14:100483746-100483768 CCATCTAAGCTCAGCCCAGGGGG + Intronic
1122288986 14:100669312-100669334 TCGGCACAGCTCCAGCCAGGGGG + Intergenic
1122406952 14:101506366-101506388 CCAGCTGAGCTCAGGTCAGAGGG + Intergenic
1202899842 14_GL000194v1_random:28622-28644 TCTGCTCAGCACAGACCCGGGGG + Intergenic
1202857494 14_GL000225v1_random:59937-59959 TGAGCTCAGGTCTAGCCAGGAGG - Intergenic
1123439946 15:20282880-20282902 TCTGCTCAGCACAGACCCGGGGG + Intergenic
1123930753 15:25170648-25170670 TCACCACAGCTCAGTGCAGGAGG - Intergenic
1123932511 15:25178663-25178685 TCACCACAGCTTAGGGCAGGAGG - Intergenic
1123940332 15:25213572-25213594 TCACCACAGCTCAGTGCAGGAGG - Intergenic
1124170118 15:27365522-27365544 ACAGCCCAGCTCTGACCAGGAGG - Intronic
1125502833 15:40250153-40250175 CCAGCTCAGCCCTGCCCAGGAGG - Intronic
1125504845 15:40261772-40261794 TCAGCTGAGCTCAGGCTTTGGGG - Intronic
1125887753 15:43241249-43241271 TGAGCTCTGCTTACGCCAGGAGG + Intronic
1127440693 15:59004046-59004068 TCAACTCAGCTACGGCAAGGAGG - Intronic
1128389073 15:67170715-67170737 TCAGCCCAGCTCAGCCCATCAGG + Intronic
1129235081 15:74218939-74218961 TCAGCTCAGCTCAGGACAGGGGG - Intergenic
1130254253 15:82318557-82318579 TCCACTCAGCTCAGACCTGGAGG - Intergenic
1132199901 15:99944182-99944204 CCACTTCAGCTCAGGCCTGGAGG + Intergenic
1132453333 15:101980424-101980446 TCTGCTCAGCACAGACCTGGGGG + Intergenic
1132453595 16:10376-10398 TCTGCTCAGCACAGACCTGGGGG - Intergenic
1132766362 16:1536328-1536350 CCTGCTCACCTCAGGCCAGCAGG + Intronic
1132783244 16:1640329-1640351 TCAGAGCAGCACAGGCCAAGAGG - Intronic
1132806851 16:1778905-1778927 CCATCTCAGCTCTGGGCAGGTGG - Intronic
1132810088 16:1793215-1793237 GGAGCTCAGCTCAGGCTTGGGGG + Intronic
1134211401 16:12280336-12280358 TCAGCTCAGGTCAGCACAGCAGG - Intronic
1134829651 16:17312975-17312997 CCTGCTCAGCCCCGGCCAGGGGG - Intronic
1135113681 16:19709076-19709098 TCAGCTCGGCTCAGCTCAGCAGG + Intronic
1136024321 16:27460318-27460340 TCAGCTCAGCTCAGCACAGCTGG - Intronic
1136735331 16:32461868-32461890 TCTGCTCAGCACAGACCCGGGGG + Intergenic
1138540172 16:57683005-57683027 CCAGTTCAGCTCAGGCTAAGGGG + Intronic
1138560911 16:57800597-57800619 TCAGCTCAGCTCAGTCTGAGGGG + Intronic
1138783850 16:59822212-59822234 GCAGATCACCTGAGGCCAGGAGG - Intergenic
1139309653 16:66017825-66017847 TCAGCCCAGCTCTGGGCAGCAGG + Intergenic
1139699326 16:68697988-68698010 TCAGTGCAACACAGGCCAGGGGG - Intronic
1141798416 16:86290187-86290209 TCAGCACAGCCCTGGCCATGAGG - Intergenic
1142178997 16:88658136-88658158 TCAGCCCTGCTGAGGGCAGGGGG + Intronic
1203017752 16_KI270728v1_random:367723-367745 TCTGCTCAGCACAGACCCGGGGG - Intergenic
1203036087 16_KI270728v1_random:640881-640903 TCTGCTCAGCACAGACCCGGGGG - Intergenic
1143355349 17:6323824-6323846 ACAGATCAGCTCTGGCTAGGCGG + Intergenic
1143503856 17:7353278-7353300 TGAGCTGAGCTCCGTCCAGGTGG + Exonic
1143767343 17:9146362-9146384 TGAGATGAGCTCAGGGCAGGAGG - Intronic
1144837091 17:18162218-18162240 GCAGCTCTGCTCATGCCAGCTGG - Intronic
1146572065 17:33961491-33961513 GCAGCTCAGCTTCAGCCAGGTGG - Intronic
1146683855 17:34827218-34827240 CCAGCTCAGCTGAGGCAAAGAGG + Intergenic
1146816358 17:35945055-35945077 TCAAGTCAGCTCAGGGCAAGAGG + Intergenic
1147690917 17:42313964-42313986 TCTGATCAGCTGAGGCAAGGTGG + Exonic
1147769773 17:42859514-42859536 TCAGTTCAGCTCGGGTCAGGAGG + Intergenic
1148686058 17:49501931-49501953 TGAGCTCATCCCAGCCCAGGTGG + Intronic
1152033364 17:77857176-77857198 GCACCTCAGCTCAGCCCAGCTGG - Intergenic
1152101648 17:78305020-78305042 TGAGCTCAGCTCATGGAAGGAGG + Intergenic
1152265345 17:79290945-79290967 TCAGCTCAGCTCAGCCTGCGTGG + Intronic
1152354605 17:79800788-79800810 GCAGCTCATCTCAGGAGAGGGGG - Intronic
1152679024 17:81656218-81656240 TCAGGTCAGCTGAGCCCACGTGG + Intronic
1154486875 18:14879055-14879077 TCTGCTCAGCACAGACCCGGGGG + Intergenic
1155187313 18:23398507-23398529 GCTGCTCAGCTCAGACCACGAGG - Intronic
1156831343 18:41495799-41495821 TCAACTCAGCCCACCCCAGGAGG + Intergenic
1157410717 18:47460692-47460714 TCTGCCCAGCTCAGGCCTCGGGG - Intergenic
1158837534 18:61346953-61346975 TAAGCCCAGCACTGGCCAGGTGG - Intronic
1160433695 18:78830125-78830147 TCAGCTGCACTCATGCCAGGAGG - Intergenic
1161194285 19:2977569-2977591 TCAGCCAAGTTCAGGCCAAGAGG - Exonic
1162805586 19:13136451-13136473 CCAGCCCAGCCCAGGCCAGCCGG - Intronic
1162913821 19:13864046-13864068 TCAGCTCAGCCCGGGCCAATGGG + Intronic
1163290965 19:16378628-16378650 TCTGCTCATCACAGGCCTGGAGG - Intronic
1163502577 19:17685847-17685869 TCAGCTGAGCTCAGGCAACACGG + Intronic
1164747620 19:30627846-30627868 TCAGCTCAGCTCTGACCCTGCGG + Intronic
1164799599 19:31065295-31065317 TCAGCCCTGCTTGGGCCAGGTGG + Intergenic
1166549342 19:43654847-43654869 TCAGCGTGGCTCAGCCCAGGTGG + Intronic
1166726777 19:45033240-45033262 ACAGCTGAGCTGAGGACAGGAGG + Intronic
1167277021 19:48545015-48545037 CCAGCCCAGCTCAGGGCAGGCGG + Intergenic
1167538246 19:50069061-50069083 TGAGCTCAGTGCAGGCCAAGAGG - Intergenic
1167883397 19:52481102-52481124 GCAACTCAGCCCAGGGCAGGTGG + Intronic
1202647645 1_KI270706v1_random:157052-157074 TCTGCTCAGCACAGACCCGGGGG - Intergenic
925717176 2:6795148-6795170 TGAGCTCTTCTCAGGCCATGAGG - Intergenic
925868978 2:8253064-8253086 TCACCTCTGGTCAGGCCAAGTGG - Intergenic
926108298 2:10166170-10166192 TCAGCTCTGCTCAGGAAATGGGG - Intronic
927208863 2:20626686-20626708 TCCACCCAGCTCAGGCCATGAGG + Intronic
927869796 2:26616242-26616264 TCGGCTGACCTCAGGCCAGCTGG - Intronic
927948305 2:27150458-27150480 TCAGTTCTGCACAGGGCAGGGGG - Intronic
927994247 2:27471803-27471825 GCAGATCACCTGAGGCCAGGAGG + Intronic
928480207 2:31675642-31675664 TTAGCTGACCTCTGGCCAGGAGG + Intergenic
933606545 2:84389935-84389957 GCAGCTCAGCACAGGCCTGCAGG - Intergenic
934177178 2:89585822-89585844 TCTGCTCAGCACAGACCAGGGGG + Intergenic
934287480 2:91660135-91660157 TCTGCTCAGCACAGACCAGGGGG + Intergenic
934740064 2:96713915-96713937 TCAGCTCAGCTCTGCCCTGTGGG + Intronic
934847672 2:97672647-97672669 CCAGCCCAGCTCACACCAGGTGG + Intergenic
934849436 2:97688063-97688085 CCAGCCCAGCTCACACCAGGTGG + Intergenic
935118730 2:100161045-100161067 ACAGCTCAGCTCAGGGGTGGAGG + Intergenic
935596261 2:104880388-104880410 TGAGCTCAGCTGGGGCCAGCTGG + Intergenic
936569452 2:113602421-113602443 TCTGCTCAGCACAGACCTGGGGG + Intergenic
936990222 2:118355868-118355890 TAAACTCAGCTCACACCAGGAGG + Intergenic
937252640 2:120534208-120534230 GCAGCTCTGGCCAGGCCAGGAGG + Intergenic
938163539 2:129007458-129007480 TCAGCTCAGCACCAGCTAGGAGG + Intergenic
945042256 2:205752161-205752183 TCAGCTCAGTGCTGGCCAGGAGG - Intronic
946354518 2:219176695-219176717 GCAGCGCCGCTCAGGCCGGGAGG + Intronic
946365808 2:219248355-219248377 TCAACTCAGCTAATACCAGGGGG - Intronic
947937592 2:234021419-234021441 GCCACTCAGCTCAGGACAGGAGG - Intergenic
948637941 2:239352144-239352166 CCAGATCATCTCAGGCCTGGAGG - Intronic
1168983445 20:2027041-2027063 GCAGCTCAGCACAGGCCTGAGGG - Intergenic
1170652699 20:18257182-18257204 ACAACTCAGATCTGGCCAGGGGG - Intergenic
1172549884 20:35790486-35790508 TTAGCACAGGTCAGGCCCGGTGG - Intronic
1172563928 20:35913423-35913445 TCTGCTCAGCGCAGGCCCAGAGG - Intronic
1172600605 20:36180081-36180103 CCAGCACAGCCCAGGCCTGGTGG + Intronic
1172778787 20:37423468-37423490 CCAGCTCAGTACAGGGCAGGAGG + Intergenic
1172844801 20:37923528-37923550 CCAGCCCAGCTCAGGCCCTGAGG + Intronic
1172845989 20:37930347-37930369 CCAGCTCAGCTTAGGGAAGGAGG - Intronic
1173615903 20:44402832-44402854 TCAGCTCAGCTAGGGTGAGGAGG + Intronic
1173736862 20:45367979-45368001 TCAGCACAGCCCAGGCCAGAAGG - Exonic
1173755905 20:45515779-45515801 CCAGATCAGATAAGGCCAGGAGG - Intergenic
1174572558 20:51512415-51512437 TCAGCACAGCTCATGCCCTGAGG - Intronic
1174586134 20:51609706-51609728 TGGGCTCAGTTCAGGCCAGGAGG + Intronic
1175900446 20:62357914-62357936 CCAGCCCAGGTCAGGCCAGATGG + Intronic
1176133464 20:63507540-63507562 TCGGCTCAGCTCGGCCCAGTGGG + Intergenic
1176133495 20:63507671-63507693 TCGGCCCAGCTCAGCCCAGTGGG + Intergenic
1176388906 21:6153657-6153679 TGAGCTCAGGTGAGGCCGGGGGG + Intergenic
1176604215 21:8815708-8815730 TCTGCTCAGCACAGACCCGGGGG + Intergenic
1176619216 21:9043396-9043418 TCTGCTCAGCACAGACCCGGGGG + Intergenic
1176715499 21:10346173-10346195 TCAGCTCAGGTCAGATGAGGTGG - Intergenic
1176794411 21:13360279-13360301 TCTGCTCAGCACAGACCCGGGGG - Intergenic
1177134635 21:17296293-17296315 TGTGCTCAGCTCAGGCCTGCTGG + Intergenic
1177218916 21:18165533-18165555 TCTGCTCTGCTCAGGGCAGCAGG + Intronic
1178373847 21:32050275-32050297 CCAGCTCAGCTCAGCCCCAGAGG - Intergenic
1178848228 21:36191444-36191466 TCTGGTCAGTTCAGTCCAGGAGG + Intronic
1179109900 21:38437507-38437529 TCCACTGAGCTCAGGCAAGGAGG + Intronic
1179734566 21:43384591-43384613 TGAGCTCAGGTGAGGCCGGGGGG - Intergenic
1179928319 21:44550591-44550613 TCAGCACAGCTCAGCACAGAAGG - Exonic
1180346506 22:11707315-11707337 TCTGCTCAGCACAGACCCGGGGG + Intergenic
1180354270 22:11825439-11825461 TCTGCTCAGCACAGACCCGGGGG + Intergenic
1180383985 22:12166916-12166938 TCTGCTCAGCACAGACCCGGGGG - Intergenic
1180537186 22:16403794-16403816 TCTGCTCAGCACAGACCTGGGGG - Intergenic
1180602850 22:17033780-17033802 TCAGCTCAGGTCAGATGAGGTGG + Intergenic
1180971412 22:19818038-19818060 ACAGCTGAGCACAGGCCGGGTGG + Intronic
1181955758 22:26586981-26587003 ACTGCTCATCTCAGGCCTGGGGG + Intronic
1182471820 22:30553612-30553634 TCAGAGCAGCTCAGGGCTGGGGG + Intergenic
1183197804 22:36365355-36365377 GCAGCTCAGCTCGGGCCTGGAGG + Intronic
1183213676 22:36466057-36466079 TCAGCTCAGCACAGCCCCGCGGG - Intergenic
1183366581 22:37410241-37410263 TGAGCTCAGCTCAGGCCCTAGGG + Intronic
1184067276 22:42127975-42127997 TCGGCCCTGCTCAGGCCAAGGGG - Exonic
1184070001 22:42141667-42141689 TCGGCCCTGCTCAGGCCAAGGGG - Intergenic
1184071750 22:42151277-42151299 TCAGCCCTGCTCAGGCCAAGGGG - Intergenic
1184125423 22:42483318-42483340 TGAGCTTAGCTCAGGCAAAGTGG - Intergenic
1184133907 22:42534816-42534838 TGAGCTTAGCTCAGGCAAAGTGG - Intergenic
1184475717 22:44720173-44720195 TCAGCTCAGCTCAGGCCAGGTGG + Intronic
1185270746 22:49928469-49928491 ACAGCTCAGCTTAGGCGAGGTGG + Intergenic
1185312140 22:50162070-50162092 GCAACGCACCTCAGGCCAGGAGG + Intergenic
1185420191 22:50730755-50730777 TCAGCGCAGCGCAGCCCCGGGGG + Intergenic
953817440 3:46170794-46170816 TCAGCTTGGCTCAGGCCGTGTGG + Intronic
953967457 3:47320628-47320650 TCAGGTCAGGCCAGGCAAGGTGG + Intronic
954415772 3:50392545-50392567 GCACCTCAGGTCAAGCCAGGGGG + Intronic
955036368 3:55272025-55272047 TCAGCTCAGCCTAGGGCAGCAGG - Intergenic
955083280 3:55677562-55677584 TCAGCTCATCACAGCCCTGGGGG + Intronic
955195928 3:56804751-56804773 TCAGCACAGCTCAGGCTAAAAGG - Intronic
958483681 3:94676620-94676642 TCAGGGCAGCCCAGACCAGGGGG + Intergenic
961008758 3:123422619-123422641 TGAGCTCAGCTCATGTCTGGTGG + Intronic
961457624 3:127032005-127032027 GCAGCTCAGCTCCGGCCCAGGGG - Intronic
961476307 3:127148338-127148360 ACAGCTCAGCTGAGGTCAAGAGG - Intergenic
961886891 3:130102552-130102574 GCAGCTCAGCACAGGGCGGGAGG - Intronic
962282286 3:134061067-134061089 AAAACTCAGCTCAGGACAGGAGG + Intergenic
962708568 3:138067527-138067549 TCACCTGAGCCCTGGCCAGGGGG + Exonic
962835185 3:139183562-139183584 TCATCTCAGCTGTGCCCAGGGGG - Intronic
963922651 3:150920855-150920877 TAATCTCAGCTCAGCCCAGTTGG + Intronic
964601322 3:158503872-158503894 TCCGCTGAGTTCTGGCCAGGAGG + Intronic
965034626 3:163422915-163422937 TCAGCTCAGCTTAGCCAAAGAGG + Intergenic
966850871 3:184164421-184164443 TCAGTTCAGCCCAGGGCTGGGGG + Intronic
967335213 3:188336894-188336916 CCACTTCAGCTCAGGCCTGGGGG + Intronic
967955459 3:194874343-194874365 TCAGCCCACCTGAGACCAGGAGG - Intergenic
968107228 3:196009609-196009631 ACAGCTCAGGGCAGCCCAGGAGG - Intergenic
968170137 3:196503544-196503566 TCCGCTCAGCTCGGGGCAGCCGG + Exonic
968793933 4:2689370-2689392 TGAGCTGAGCTCAGCCCAGGGGG - Intronic
969869586 4:10096275-10096297 CCATCTCAGCCCAGGGCAGGAGG - Intronic
970236711 4:13966361-13966383 TCAGCCCAGCTCAGGAGAGAGGG - Intergenic
970253416 4:14141336-14141358 TTAGCTCAGCTCTTTCCAGGAGG - Intergenic
972887546 4:43510542-43510564 CCCTCTCAACTCAGGCCAGGAGG - Intergenic
973373903 4:49275241-49275263 TCTGCTCAGCACAGACCCGGGGG - Intergenic
973383509 4:49334998-49335020 TCTGCTCAGCACAGACCCGGGGG + Intergenic
973387114 4:49520012-49520034 TCTGCTCAGCACAGACCCGGGGG + Intergenic
975630469 4:76396755-76396777 GCAGCTCACCTGAGGTCAGGAGG - Intronic
975725892 4:77291323-77291345 TCAGCTGAGCTTAGCCTAGGAGG + Intronic
977669404 4:99678525-99678547 TCAGCTCTGTTCAGACAAGGGGG - Intergenic
977694000 4:99947000-99947022 CCCTCGCAGCTCAGGCCAGGAGG + Intergenic
978119859 4:105065446-105065468 TCAACTCAGGTCAACCCAGGAGG + Intergenic
980091277 4:128445684-128445706 ACAGCTCAGCTCAGCACAGCTGG + Intergenic
981315041 4:143333805-143333827 GCAGGTCACCTGAGGCCAGGAGG - Intergenic
982935139 4:161464171-161464193 TCAGTTCAGGTAAGGCCAGGTGG - Intronic
984172716 4:176380501-176380523 TCAGCTCAGCTCTTGACAGGTGG - Intergenic
984566802 4:181340713-181340735 CCAGGTCAGGTCAGGACAGGAGG + Intergenic
985609923 5:881743-881765 CCGGCTCTTCTCAGGCCAGGTGG - Intronic
987527941 5:19078171-19078193 TGAACTCAGCTCAGACCAAGTGG - Intergenic
988707348 5:33739335-33739357 TCAGCTAAACTCAGCCCAGTGGG - Intronic
989053740 5:37346445-37346467 GCAGATCACCTCAGGTCAGGAGG + Intronic
990225260 5:53644292-53644314 TGAGCTCAGCTCAGAACAGAGGG + Intronic
997481467 5:134188265-134188287 TCAGCTCAGCTGGTGCCTGGTGG + Intronic
997787377 5:136725969-136725991 ACCTCCCAGCTCAGGCCAGGAGG - Intergenic
998245815 5:140503798-140503820 GCAGATCACCTCAGGTCAGGAGG - Intronic
998350172 5:141495205-141495227 CCAGCTCAACTCAGGGGAGGGGG - Intronic
1003869083 6:10387652-10387674 TTAGCTCAGGTAAAGCCAGGGGG - Intergenic
1004427262 6:15514742-15514764 TCAGCTCAAATGAGGCCATGAGG - Intronic
1006475160 6:34248529-34248551 GCCTGTCAGCTCAGGCCAGGAGG - Intronic
1007357449 6:41331964-41331986 TCAGCTCAGCACAGGCCGAGGGG - Intergenic
1007563426 6:42829623-42829645 TCAGCTCATTTCTGGCCAAGTGG + Exonic
1007830476 6:44634544-44634566 GCAGCTGAACTCAAGCCAGGTGG + Intergenic
1008677922 6:53841158-53841180 TAAGCACAGCTGAGGGCAGGGGG - Intronic
1010450205 6:75993991-75994013 ACACAGCAGCTCAGGCCAGGAGG - Intronic
1012405066 6:98886729-98886751 TTAGCTCAGTTCTGACCAGGAGG + Intronic
1012889895 6:104885837-104885859 GCAGCTCAGCACAGGCCTGCAGG + Intergenic
1013049018 6:106513327-106513349 TCAGCTCATGTCAGGCCATGAGG - Intronic
1013086771 6:106863970-106863992 GCAGCTCAGCGCAGGCCTGCAGG - Intergenic
1013479821 6:110543936-110543958 GCAGCTGAGGGCAGGCCAGGAGG + Intergenic
1014889361 6:126823777-126823799 GCAGATCACCTGAGGCCAGGAGG - Intergenic
1015193123 6:130493664-130493686 TAAGATCAGTACAGGCCAGGCGG - Intergenic
1015401133 6:132789245-132789267 TCAGCAAAGGTCAGGCCAGCGGG + Intronic
1016825900 6:148388250-148388272 GCAGCACAGCAGAGGCCAGGAGG + Intronic
1017006980 6:150035105-150035127 CCAGCCCAGGTCAGCCCAGGAGG - Intergenic
1017233338 6:152095392-152095414 TGAGCCCAGCTGAGGTCAGGAGG - Intronic
1017812515 6:157994276-157994298 TCAGCAAAGCTGAGGTCAGGTGG + Intronic
1018300053 6:162392241-162392263 TAAGGTCTGCTCAGGCCAGAGGG + Intronic
1019147243 6:169983290-169983312 TCAGGTCAGGTCAGGTCAGCCGG + Intergenic
1019215865 6:170443481-170443503 TCACCTCAGCACAGTCCAGCGGG + Intergenic
1019331205 7:461745-461767 TCCGGTCAGCACAGGGCAGGCGG - Intergenic
1019337562 7:492514-492536 CCAGCTCAGCTGAGGTCATGAGG + Intergenic
1019340929 7:508592-508614 TCAGCTGAGGCCAAGCCAGGAGG + Intronic
1020050820 7:5080471-5080493 TCAGCTGAGCTCAGGTGGGGTGG + Intergenic
1020097697 7:5377749-5377771 CCAGCCCTGCCCAGGCCAGGTGG - Intronic
1022113151 7:27243507-27243529 TCACTTCGGCGCAGGCCAGGAGG + Intronic
1022359801 7:29646967-29646989 TCAGCCCTGCTCAGTGCAGGAGG - Intergenic
1023887251 7:44368048-44368070 CTAGTTCAGCTCAGGCCTGGGGG - Intergenic
1024005437 7:45222079-45222101 CCAGTTCAGCTCAGGGAAGGTGG + Intergenic
1024273917 7:47662096-47662118 TCAGATCACCTGAGGTCAGGAGG + Intergenic
1024565239 7:50675010-50675032 TCAGCTGAGTCCAGGCCAGTGGG - Intronic
1024660327 7:51486972-51486994 GCAGCTCAGCTCAGAGCAGGCGG + Intergenic
1024818081 7:53294540-53294562 TGAGCTTATCTCAGGCAAGGGGG + Intergenic
1026413581 7:70154632-70154654 TCTGCTCAGTTCAGGACAGGAGG - Intronic
1032638773 7:133741282-133741304 TCAGGTCAGCTCAGGCCTGGTGG - Intronic
1034872546 7:154696783-154696805 ACAGCACAGCTCTGACCAGGAGG - Intronic
1035252436 7:157606021-157606043 GCAGCTCAGCTCTGGCCTGCAGG - Intronic
1035297065 7:157873303-157873325 TCAGACGAGGTCAGGCCAGGCGG - Intronic
1035582135 8:747066-747088 CCAGGACAGCTCAGGCCAGGAGG - Intergenic
1035781667 8:2232917-2232939 TCATGTCAGCTCAGGGAAGGTGG + Intergenic
1036465725 8:8995053-8995075 CCAGGTCATCTCAGGACAGGAGG + Intergenic
1036593984 8:10195655-10195677 TCAGTTTTGCTCAGGCCAGCTGG - Intronic
1036681104 8:10874976-10874998 TCAGCTCAGATCAGTACAGGCGG + Intergenic
1036692324 8:10951802-10951824 CCAGCTCAGGCCAGGTCAGGAGG - Intronic
1037799406 8:22024388-22024410 TCAGCTCAGCTTAGGAAGGGAGG - Exonic
1038213348 8:25540028-25540050 CCAGCTCAGCTAAGACCAGGTGG - Intergenic
1038436728 8:27541600-27541622 TCATATCAGCTCAGGCCAATGGG - Intronic
1041215458 8:55595957-55595979 TTAGCTCTGCCCTGGCCAGGAGG - Intergenic
1044666435 8:94639062-94639084 TCAGCTCTGCTGGGCCCAGGAGG - Intergenic
1045581467 8:103485450-103485472 GCAGATCACTTCAGGCCAGGAGG - Intergenic
1048970495 8:139642737-139642759 CCTGCTCAGGTCAGGGCAGGAGG + Intronic
1049365895 8:142236706-142236728 TCAGCTCTGCTCAGGGAGGGTGG - Intronic
1049406882 8:142455544-142455566 CCAGCACAGCTGAGGTCAGGAGG + Intronic
1049486325 8:142865586-142865608 TCAGCCCACCTCAGGCCCTGGGG + Intronic
1049554149 8:143273939-143273961 TCAGCTCTCCTCACGCCAGCAGG - Intronic
1053884853 9:42636419-42636441 TCTGCTCAGCACAGACCCGGGGG - Intergenic
1053887808 9:42657822-42657844 TCTGCTCAGCACAGACCCGGGGG + Intergenic
1054223874 9:62443870-62443892 TCTGCTCAGCACAGGCCCGGGGG - Intergenic
1054226828 9:62465272-62465294 TCTGCTCAGCACAGACCCGGGGG + Intergenic
1054324411 9:63705955-63705977 TCTGCTCAGCACAGACCCGGGGG + Intergenic
1056616089 9:88167195-88167217 GCAGATCACCTGAGGCCAGGAGG + Intergenic
1057179781 9:93023465-93023487 TCTGCTCTGCAGAGGCCAGGTGG - Intronic
1059446245 9:114339870-114339892 GCAGATCACCTGAGGCCAGGAGG + Intronic
1059681493 9:116590474-116590496 ACAGCTCTGCACAGGCCAGCAGG + Intronic
1060892420 9:127197276-127197298 CCAGGTCAGCTGAGGACAGGTGG + Intronic
1061834597 9:133320578-133320600 CAGGCTCAGCACAGGCCAGGCGG - Intergenic
1061852303 9:133423432-133423454 CCAGCTCAGCAGAGGCCATGGGG - Intronic
1061943137 9:133893650-133893672 CCAGCCCAGCCAAGGCCAGGAGG + Intronic
1062226974 9:135457743-135457765 GCAGCTCAGCTAAGGCCCGGAGG + Intergenic
1062527011 9:136981994-136982016 CCAGCTCAGCACCGGCCTGGTGG - Intronic
1062644556 9:137540789-137540811 TCAGCCCAGCCCAGGGCAGTGGG + Intronic
1203697603 Un_GL000214v1:113211-113233 TCAGCTCAGCACAGACCCGGGGG - Intergenic
1203551612 Un_KI270743v1:167805-167827 TCTGCTCAGCACAGACCCGGGGG + Intergenic
1187362556 X:18641973-18641995 TCAGCTCGGCGCCTGCCAGGGGG - Exonic
1188532955 X:31162940-31162962 TCAGCTCTACTCAGGCAGGGAGG - Intronic
1188649562 X:32615083-32615105 CCAGCTCAGCACAGCCCAAGGGG + Intronic
1189515287 X:41707382-41707404 TCAGCTCAGCTGAGGCTAGCTGG - Intronic
1190195480 X:48314358-48314380 TCAGCTCAGCTCAGCTCTAGAGG + Intergenic
1190661932 X:52662580-52662602 TCAGCTCAGCTCAGCTCTAGAGG + Intronic
1192178897 X:68903123-68903145 TCAGGGCAGCCCAGGGCAGGGGG - Intergenic
1194717566 X:97305109-97305131 TCAGCTCAGCTTAGGACAGATGG - Intronic
1194978605 X:100417196-100417218 TCAGCCAAGCTCAGCCCAGCTGG - Intergenic
1195019534 X:100812758-100812780 TCCGCTGAGTTCTGGCCAGGAGG + Intergenic
1195229149 X:102829005-102829027 TCAGCTCAGCACTGAGCAGGAGG - Intergenic
1200544088 Y:4497809-4497831 TCAGGGAAGCTCAGGCCACGGGG - Intergenic