ID: 1184478369

View in Genome Browser
Species Human (GRCh38)
Location 22:44733779-44733801
Sequence CTGTGTTACAATGAGTAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 103}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184478369_1184478374 -10 Left 1184478369 22:44733779-44733801 CCCACCTACTCATTGTAACACAG 0: 1
1: 0
2: 0
3: 6
4: 103
Right 1184478374 22:44733792-44733814 TGTAACACAGGCCAGGACATAGG 0: 1
1: 0
2: 3
3: 10
4: 154
1184478369_1184478379 25 Left 1184478369 22:44733779-44733801 CCCACCTACTCATTGTAACACAG 0: 1
1: 0
2: 0
3: 6
4: 103
Right 1184478379 22:44733827-44733849 CCCCGAAACCCCAAGAGTTCAGG 0: 1
1: 0
2: 0
3: 12
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184478369 Original CRISPR CTGTGTTACAATGAGTAGGT GGG (reversed) Intronic
907820041 1:57958310-57958332 CTGTGATACACTGGGTAAGTTGG + Intronic
912595372 1:110870807-110870829 CTGTGTTACTCTGTGTATGTTGG - Intergenic
912711477 1:111953085-111953107 CTTTGTGACATTTAGTAGGTCGG - Intronic
917839900 1:178969383-178969405 CTGTGTTACGCTCAGGAGGTTGG + Intergenic
918134854 1:181662691-181662713 CTGGTTTACACTCAGTAGGTGGG + Intronic
920020943 1:202956259-202956281 CTGTGTGATAATAAGTAGATGGG + Intronic
920661596 1:207920239-207920261 CTGTGAAACATTGAGTAGGAAGG + Intergenic
921713342 1:218394669-218394691 CTGTGTTACATGTAATAGGTGGG + Intronic
922002225 1:221491092-221491114 CTGTGTTCCAATGAGGAAGCAGG + Intergenic
924244951 1:242074889-242074911 CTGTGGTCAAATGAGTATGTTGG + Intergenic
1063690409 10:8281850-8281872 CTGTATTGGAAGGAGTAGGTAGG + Intergenic
1067259548 10:44676495-44676517 CTCTTTTTCAATGAGTAGTTTGG + Intergenic
1070902401 10:80041982-80042004 CTTTGTTTCAATGAGTAAGAGGG + Intergenic
1074430953 10:113394164-113394186 CTGTGTTACATTCTGTGGGTTGG + Intergenic
1077836230 11:5930120-5930142 CTGTGTTCCAACGGGTACGTTGG - Intronic
1079489547 11:20972346-20972368 GTGTGTGTCAATGAGTAGTTAGG + Intronic
1082707444 11:56509705-56509727 CTCTGATACAAAGAGTAGGCAGG - Intergenic
1085723838 11:78936806-78936828 GTGTGTTAGAATGAGAAGGTGGG + Intronic
1085751105 11:79161971-79161993 CTGAGTGACAATGATTGGGTTGG + Intronic
1087083716 11:94196466-94196488 CTATGTAATAATGAGTAGGTTGG + Intergenic
1088743164 11:112783487-112783509 CTGTGTTACAGTGAGTTGTCAGG + Intergenic
1091678539 12:2509638-2509660 CTGTGTCACTATGCGTAGGAGGG - Intronic
1092503946 12:9076065-9076087 CTGTGTGAATATGAGTAGATTGG + Intronic
1097987611 12:65800637-65800659 CTGTGTTACAATTATTAAGCTGG + Intergenic
1098549933 12:71751937-71751959 ATGGGTTACAATAAGTAGGTTGG - Intergenic
1103733811 12:123045844-123045866 CTTTGGTACCATGAGTAGGGTGG - Intronic
1107537273 13:41348078-41348100 CTGTGTTAAGATGATTATGTAGG + Intronic
1113304435 13:109061500-109061522 CTGTGTTTCAGTGAATAGGGAGG + Intronic
1113879508 13:113615905-113615927 CTGTCTCAAAATGAGTAGGCTGG + Intronic
1114887160 14:26867582-26867604 CTGTGTTACATTGGCTAGATAGG + Intergenic
1117586947 14:57217621-57217643 CTGTGTTTCAAGGAATAGGGAGG - Intronic
1121168343 14:91831535-91831557 CTGTTTTAGAAAGAGTAGCTTGG + Intronic
1130614789 15:85394722-85394744 CTGTGTGACCTTGAGCAGGTAGG + Intronic
1131460427 15:92613981-92614003 CCTTGTTACAATGACCAGGTGGG - Intergenic
1131542063 15:93282950-93282972 CTGGGGGACATTGAGTAGGTGGG - Intergenic
1131791925 15:95974266-95974288 CTGTCTTGCAAGGAGGAGGTAGG + Intergenic
1131911887 15:97214609-97214631 TTGTGTTAGAATAAGTATGTTGG + Intergenic
1133705565 16:8351559-8351581 CTGTGTTAGAATAATTAGATGGG + Intergenic
1133824017 16:9261076-9261098 CTGTGTTACAATGCAGAGGCTGG + Intergenic
1137496783 16:48975580-48975602 CTGTGTTAGACTGTGAAGGTGGG - Intergenic
1137660766 16:50204103-50204125 CAGTGTTACCATAAGGAGGTTGG + Intronic
1138969651 16:62129427-62129449 CTGTGTTATTCTGAGCAGGTTGG - Intergenic
1140655643 16:77136567-77136589 CTGAGTTTCAATGAGTAAGTGGG + Intergenic
1144031325 17:11325786-11325808 CAGTGGTACAATGAAGAGGTTGG + Intronic
1149301959 17:55313535-55313557 CTGTGTAAGAATGGGGAGGTGGG + Intronic
1151024293 17:70659162-70659184 CTGTGTAACTATGAGGATGTTGG + Intergenic
1153784532 18:8522932-8522954 CCGTGCCACAGTGAGTAGGTGGG - Intergenic
1166898768 19:46041716-46041738 CTGTGTCACAGTGAGAAGGGTGG + Intronic
1168451010 19:56466589-56466611 CTGTCTTAAAGTGAGTAGCTAGG + Intronic
925018931 2:553581-553603 CTGTGTTCCCAGGAGGAGGTCGG + Intergenic
926697935 2:15783809-15783831 CACTGTTATAATGAGGAGGTTGG - Intergenic
931139528 2:59441837-59441859 ATGAGTTTCAATGAGTATGTGGG + Intergenic
933034128 2:77370973-77370995 CTGTAATACAATTAGTTGGTTGG + Intronic
935632130 2:105220714-105220736 CTAGGTTTCAATGAGTAAGTTGG + Intergenic
937830331 2:126413601-126413623 CTGTGTTTCAGGGAGTAGGGAGG + Intergenic
940498074 2:154459010-154459032 CAGTATTACAAAGAGTAGATGGG - Intergenic
941206475 2:162579489-162579511 CTCAGTTTCAGTGAGTAGGTTGG + Intronic
944490856 2:200256436-200256458 CTGTGTCACATGGAGGAGGTGGG - Intergenic
1171063572 20:21990770-21990792 CGGTGTTGGAATAAGTAGGTTGG + Intergenic
1175511130 20:59526884-59526906 ATGTGTTTCAATGAGTAGGCTGG + Intergenic
1178897951 21:36576210-36576232 ATGTGTTGTAATGAGTAGATTGG - Intronic
1181829350 22:25546890-25546912 CTGTGAAACAAAGAGTAAGTAGG - Intergenic
1181913398 22:26258582-26258604 CTGTGTTTAAATGAGGAAGTTGG + Intronic
1184478369 22:44733779-44733801 CTGTGTTACAATGAGTAGGTGGG - Intronic
952268144 3:31806718-31806740 CTGCTTTACAAAGAGTAGTTTGG + Intronic
952742311 3:36746523-36746545 CTGTGATACAATGATGAGATGGG - Intergenic
959575633 3:107929949-107929971 CTGAGTTGCAATGAGTAAATGGG + Intergenic
961913389 3:130344946-130344968 ATGTGTTAGAAAGAGTGGGTTGG - Intergenic
966479391 3:180389073-180389095 CTGCCTTACAATTAGTAGGCCGG + Intergenic
970798009 4:19937928-19937950 CTGCTTTCCAATGAGAAGGTAGG - Intergenic
970910602 4:21270452-21270474 CTGTTTTACAATCAGTAGCATGG - Intronic
971730808 4:30377085-30377107 CTGATTGACAATGAGTAAGTGGG + Intergenic
972644792 4:40957062-40957084 CTGTCTTACAAAGAGCAGATGGG - Intronic
975654515 4:76628374-76628396 CTGTGGTTCAGTGAGCAGGTTGG + Intronic
978405062 4:108370569-108370591 CTGCTTTACAAAGAGCAGGTGGG + Intergenic
979736458 4:124091849-124091871 ATATATTACAATGAGGAGGTTGG + Intergenic
980275204 4:130642069-130642091 CTCAGTTTCTATGAGTAGGTAGG - Intergenic
981457377 4:144968905-144968927 CACTGTTACAATACGTAGGTAGG - Intronic
983946798 4:173595169-173595191 CTATGTCACAATGAGAAAGTTGG + Intergenic
986857571 5:11888681-11888703 CTGTGTTGCAAGTAGTAGGTAGG - Intronic
987257251 5:16168700-16168722 TTGTGTGGGAATGAGTAGGTGGG - Intronic
993648947 5:90494576-90494598 CTGTGTTACAACCACTAGGATGG - Intronic
993966150 5:94363460-94363482 ATGTGTTACCTTGAGTGGGTGGG + Intronic
995191344 5:109322037-109322059 CTGTGTTACAGTAGGTAGCTAGG + Intergenic
998150014 5:139751438-139751460 CTGTGTGAGTATGTGTAGGTGGG - Intergenic
1001274925 5:170343643-170343665 CTGTCCGACAATGAGGAGGTGGG + Intergenic
1005592800 6:27346643-27346665 ATGTGTTTCAGTGAGTAGGATGG + Intergenic
1007250449 6:40491462-40491484 CTGTGTGACTGTGGGTAGGTAGG + Intronic
1007250476 6:40491654-40491676 CTGTGTGACTGTGGGTAGGTAGG + Intronic
1007250529 6:40492048-40492070 CTGTGTGACTGTGGGTAGGTAGG + Intronic
1007547785 6:42707578-42707600 CTGTTTTTCAAAGATTAGGTTGG - Intronic
1010768196 6:79799884-79799906 CTGTATTTGAATGAGTAGGATGG + Intergenic
1018367756 6:163138768-163138790 CAGTGTTGCAATGAACAGGTAGG - Intronic
1018593946 6:165458304-165458326 CTGTGATGCAATCAGGAGGTGGG + Intronic
1020039027 7:4987362-4987384 CTGGGTGGCAATGAGAAGGTGGG - Intronic
1024706962 7:51971630-51971652 CTCCCTTACAATGGGTAGGTGGG + Intergenic
1037511875 8:19591512-19591534 CCGTGTAACAAAGATTAGGTAGG + Intronic
1039049061 8:33476416-33476438 TTGTGTTTCTATGAGTCGGTGGG - Intronic
1039235517 8:35498272-35498294 CTGTGTTGCTTGGAGTAGGTTGG + Intronic
1040344861 8:46482075-46482097 CTTTCTTACAATAAGCAGGTTGG - Intergenic
1044214454 8:89592269-89592291 ATGTTATATAATGAGTAGGTAGG - Intergenic
1044543944 8:93438124-93438146 CTGTGGAACAATCAGGAGGTTGG - Intergenic
1046899433 8:119508151-119508173 CTGTGTAACAAGGGGTAGGAAGG + Intergenic
1047868184 8:129052411-129052433 CTGCTTCACAATGAATAGGTAGG - Intergenic
1051613576 9:18985093-18985115 CTGTGTCTCAATGAATAGGGAGG + Intronic
1058135026 9:101297556-101297578 CTTTCTTATAATGAGAAGGTTGG - Intronic
1059936320 9:119314650-119314672 CTCTGTTAGAATAAGTAGGGTGG - Intronic
1189385133 X:40531085-40531107 CTGAGCTACAATGAGCAGCTGGG - Intergenic
1192214187 X:69146828-69146850 CTATATTACAATGAGAAGATTGG + Intergenic
1195212145 X:102660399-102660421 CTGTGTTTCTATGTGTGGGTGGG + Intergenic