ID: 1184478374

View in Genome Browser
Species Human (GRCh38)
Location 22:44733792-44733814
Sequence TGTAACACAGGCCAGGACAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 0, 2: 3, 3: 10, 4: 154}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184478367_1184478374 14 Left 1184478367 22:44733755-44733777 CCTTACTGTGGGCACCTGTGGAG 0: 1
1: 0
2: 2
3: 18
4: 155
Right 1184478374 22:44733792-44733814 TGTAACACAGGCCAGGACATAGG 0: 1
1: 0
2: 3
3: 10
4: 154
1184478368_1184478374 0 Left 1184478368 22:44733769-44733791 CCTGTGGAGTCCCACCTACTCAT 0: 1
1: 0
2: 1
3: 52
4: 888
Right 1184478374 22:44733792-44733814 TGTAACACAGGCCAGGACATAGG 0: 1
1: 0
2: 3
3: 10
4: 154
1184478369_1184478374 -10 Left 1184478369 22:44733779-44733801 CCCACCTACTCATTGTAACACAG 0: 1
1: 0
2: 0
3: 6
4: 103
Right 1184478374 22:44733792-44733814 TGTAACACAGGCCAGGACATAGG 0: 1
1: 0
2: 3
3: 10
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184478374 Original CRISPR TGTAACACAGGCCAGGACAT AGG Intronic
900154426 1:1198275-1198297 TGGATCACCGGCCAGGCCATGGG - Intergenic
901235920 1:7667574-7667596 TGTCTGACAGGCCAGGACCTCGG - Intronic
902238686 1:15074122-15074144 TCTAAAACAGACCAGGACAGTGG + Intronic
904892503 1:33789742-33789764 TGTCACACAGGCCAGGCTGTTGG - Intronic
908967011 1:69777602-69777624 GGTAATACAGGACAGGAGATAGG - Intronic
912648923 1:111421201-111421223 TGGAGCAAAGGCCAGGACAAGGG - Intronic
915084935 1:153379898-153379920 GGTAACATAAACCAGGACATCGG + Intergenic
917882544 1:179352280-179352302 AGTAACACAGTATAGGACATAGG + Intronic
919610968 1:199745155-199745177 TGTAACACAGGCCATCAGAAAGG - Intergenic
922083592 1:222323752-222323774 TGAAACACAGGCCCTGAAATTGG - Intergenic
923199418 1:231696984-231697006 AATAACACAGTCCAGGGCATAGG + Intronic
924785030 1:247187104-247187126 TGTGACAGAGGCTAGGAGATGGG + Intergenic
1063382983 10:5597688-5597710 TTCAACACAGGCCATGACAGCGG - Intergenic
1065125592 10:22570523-22570545 TTTAAGACAGGACAGGACAAGGG + Intronic
1065718663 10:28602558-28602580 TGTAATACTGAGCAGGACATGGG - Intronic
1068118632 10:52761711-52761733 TGTAACACTGGCCAGAAACTGGG + Intergenic
1070646151 10:78203788-78203810 TGAGACACAGGCCAGGTCAGGGG - Intergenic
1070966024 10:80530971-80530993 CATAACACAGGCCAGGAAATTGG - Exonic
1074372389 10:112910579-112910601 TGTAACCCAGACCTGGACAATGG - Intergenic
1074955500 10:118384628-118384650 TGCAAGACAGTCCAGGACAGGGG + Intergenic
1087774350 11:102243902-102243924 TGTATTACAGGCAAGGTCATGGG - Intergenic
1088712568 11:112521807-112521829 TATGACACAGACCAGGACCTGGG + Intergenic
1088721878 11:112599627-112599649 TGTGACAAATGCCAGGAGATAGG - Intergenic
1088749604 11:112832496-112832518 TGTATCCCAGGCCAGGCCAGTGG - Intergenic
1089153764 11:116385174-116385196 TGTGTCGCAGGCCGGGACATCGG - Intergenic
1093412891 12:18887578-18887600 TGTCACACATGCCAGGAACTCGG + Intergenic
1098887402 12:75974505-75974527 TGTGGCAGAGGCCAGGACCTTGG - Intergenic
1104038465 12:125114569-125114591 TATAGCACAGGCCAGCACCTGGG - Intronic
1104038495 12:125114680-125114702 TATAGCACAGGCCAGCACCTGGG - Intronic
1105334892 13:19458582-19458604 TGGAAGACAGGTCAGGCCATTGG - Intronic
1105816257 13:24038963-24038985 TGTGACACAGGCAGGGAAATAGG + Intronic
1106169442 13:27276082-27276104 TGAAACACTGGACAGAACATTGG + Intergenic
1107191454 13:37592153-37592175 TATAACACAGTCCTGTACATAGG + Exonic
1107404272 13:40098312-40098334 TGGAGCACAGGCCAGCACATGGG - Intergenic
1109522141 13:63527560-63527582 TGCAGCACAGCCCAGGAGATGGG + Intergenic
1116574139 14:46551670-46551692 TGGAACACAGGCAGGGACTTGGG + Intergenic
1117543672 14:56772661-56772683 TAGAACACAGGCCAGGTCCTAGG + Intergenic
1119020755 14:71110656-71110678 TGTACTTCATGCCAGGACATTGG + Exonic
1119961922 14:78868530-78868552 TGAAACATAGGCCAGGGCAGTGG + Intronic
1121235332 14:92387853-92387875 TCTAACACAGGCTACAACATGGG - Intronic
1123988148 15:25663136-25663158 TCTAACACGTGCCACGACATGGG - Intergenic
1125201939 15:37107706-37107728 TGAAACAGAGGAAAGGACATGGG + Intergenic
1125733077 15:41905091-41905113 TGTAACATAGGCCTTGACAGAGG - Intronic
1128081644 15:64860698-64860720 TGTAACACAGGACACGACATAGG - Intronic
1130864930 15:87924810-87924832 TGTCACACAGGACAGCACACAGG + Intronic
1131174055 15:90199165-90199187 TAAAACACAAGCCAGGACAGGGG - Intronic
1133067732 16:3221278-3221300 TGTCCCAGAGGGCAGGACATGGG - Intergenic
1135796935 16:25454520-25454542 TGGAAGACAGGTCAGGCCATTGG - Intergenic
1135800766 16:25492969-25492991 TGTAAGAGAGGTGAGGACATGGG - Intergenic
1138841282 16:60510240-60510262 TGTAATACAGCTCAGGAGATTGG + Intergenic
1140793817 16:78416687-78416709 TTTAAGACAGGCCTGGACATTGG - Intronic
1140893584 16:79305918-79305940 TCTAATACAAGCCAGGACTTGGG - Intergenic
1141715749 16:85725862-85725884 GGTAATACAGGCCAGCACTTCGG - Intronic
1141771542 16:86092711-86092733 TGGAACACGGGCCGGGACCTGGG + Intergenic
1143106074 17:4531188-4531210 TGTAATCCAGGCTAGGACCTAGG + Intronic
1146471647 17:33129761-33129783 TGTCCCACAGGACAGGACAGGGG - Intronic
1149184468 17:53980757-53980779 GGTAACACATGCCTGAACATGGG + Intergenic
1149525947 17:57355882-57355904 TGTTTCCCAGGCTAGGACATGGG + Intronic
1152854959 17:82659459-82659481 TGGATCACAGGCCAGGGCACCGG - Intronic
1154077003 18:11213179-11213201 TGTAACCTAAGCCAGGACAATGG - Intergenic
1159124137 18:64203279-64203301 TGTAAATCAGCCCAGGACTTTGG + Intergenic
1162036590 19:7943449-7943471 GGTAGCAGAGGCCAGGACAGGGG - Intronic
1163244074 19:16081827-16081849 GTTAACAGAGGGCAGGACATGGG + Intronic
1163799945 19:19358442-19358464 AGAAACACAGGCAAGGAAATTGG + Exonic
1164084865 19:21891899-21891921 TGTCACAGAGCCCAGGACACAGG + Intergenic
925118068 2:1397327-1397349 TGAAACATAGGGCATGACATGGG + Intronic
925444519 2:3916152-3916174 AGAATCACAGGCCAGGACAAAGG - Intergenic
929453085 2:42049068-42049090 TTAAAGACAGGCCAGGACAGAGG + Intronic
930292847 2:49517622-49517644 TGAAACTGAGGCCTGGACATAGG + Intergenic
930864506 2:56109170-56109192 TGTAGCAGAGGCCAGCAGATAGG + Intergenic
931816075 2:65902017-65902039 TGTAACACAGTCCAGAAGCTGGG - Intergenic
934049697 2:88199882-88199904 TGCAGCAGAGGCCAGGACTTGGG + Intergenic
935403994 2:102689219-102689241 TGCAATACAGCCCATGACATGGG - Intronic
937341989 2:121097007-121097029 AGTAACATATGCCAGGACCTAGG - Intergenic
939941603 2:148358321-148358343 TATAACACAGCCCAAGATATAGG + Intronic
943048130 2:182882758-182882780 TGTAACTCAGGCCAGAAAAATGG + Intergenic
943942173 2:194012362-194012384 TGTAAGACCGTTCAGGACATAGG + Intergenic
945701625 2:213177759-213177781 TGGAACAAAGGACAGGACCTGGG + Intergenic
945720794 2:213416212-213416234 TGTACCACAGGCTAGGACTTTGG - Intronic
948458261 2:238117241-238117263 TGTGACAGGGGCCAGGACAGGGG + Intronic
948458280 2:238117306-238117328 TGTAACAGGGGTCAGGACAGAGG + Intronic
1169198226 20:3694595-3694617 TGTGACACAGCCCAGGACTGGGG + Intronic
1170084364 20:12512662-12512684 TGCAAAACAGGCTAGGACAGAGG - Intergenic
1173869827 20:46334373-46334395 CCTGACCCAGGCCAGGACATAGG - Intergenic
1175710642 20:61217787-61217809 TGCAATACAGGCAAAGACATAGG + Intergenic
1176201620 20:63863348-63863370 TGTAACCCAGGCCAGGTGAAGGG - Intergenic
1176738681 21:10576404-10576426 TGGAAGACAGGTCAGGCCATTGG + Intronic
1179430468 21:41317543-41317565 TGTGACAGAGGCCAGGGCAGTGG - Intronic
1179478668 21:41664150-41664172 TGTAAAACCAGCCAGGACACTGG + Intergenic
1179495683 21:41769899-41769921 TGTGGCACATGCCAGGCCATGGG + Intergenic
1179930795 21:44569716-44569738 TATAAAACATGCCACGACATAGG + Intronic
1183166312 22:36149584-36149606 TCACACACAGGCCAGGAGATGGG + Intronic
1183180490 22:36256849-36256871 TCACACACAGGCCAGGAGATGGG - Intronic
1183459350 22:37940618-37940640 AGTGACACAGGCCTGGGCATGGG - Intronic
1184478374 22:44733792-44733814 TGTAACACAGGCCAGGACATAGG + Intronic
1185356771 22:50377570-50377592 GGAAACATAGGCCAGAACATGGG + Intronic
949690215 3:6627907-6627929 TGTATCACAGGAGAGGACACTGG - Intergenic
952178354 3:30891525-30891547 TGTAACATAGGCCAGGGCCAGGG + Intronic
952838554 3:37625237-37625259 TGCAACACATACCAGGACAGGGG - Intronic
953687381 3:45088568-45088590 TGTAACAGAGGCCAGGCCTGTGG - Intronic
954628317 3:52034927-52034949 TGTAACACAGGCCTGGGCAGTGG + Intergenic
955699610 3:61671034-61671056 TGTCACAGAGTCCAGGAGATGGG + Intronic
961150779 3:124636224-124636246 TGTTCCCAAGGCCAGGACATAGG - Intronic
961846440 3:129768246-129768268 TATAATAGATGCCAGGACATAGG + Intronic
965685188 3:171295143-171295165 TGTGAAGCAGGCCAGGAAATGGG + Intronic
968957216 4:3725542-3725564 TGCAACGGGGGCCAGGACATGGG + Intergenic
969267706 4:6075791-6075813 TGTACAACAGGCAAGGACAGGGG - Intronic
969638449 4:8382670-8382692 TGTCACACAGCCCAGGTCACTGG + Intronic
971727114 4:30328061-30328083 GGTAACAGAGGCAAGGACACAGG + Intergenic
972333769 4:38087378-38087400 TGTAACTCAGGCCAGGAGGATGG - Intronic
974195904 4:58575611-58575633 TGGAACACAAGCTAAGACATTGG - Intergenic
974777201 4:66500288-66500310 TGAAACAAAGCCCAGCACATAGG + Intergenic
974810757 4:66942938-66942960 GGTAATACAGGCAAGGGCATAGG + Intergenic
978218875 4:106244977-106244999 TGTAAGAGAGGTGAGGACATAGG + Intronic
986861673 5:11933415-11933437 TGTACCACAGGCTGGAACATTGG - Intergenic
988436859 5:31186086-31186108 TATAACACAGGCTATTACATTGG + Intergenic
988705949 5:33726085-33726107 TGTGACCCAGAACAGGACATGGG - Intronic
993281511 5:85931039-85931061 TGTAAGAAAGGCCAGGATATTGG + Intergenic
993985550 5:94592834-94592856 TGAAACACAGTCCAGGAGAATGG - Intronic
994955494 5:106525990-106526012 TATAACAAAGGCAAGGCCATTGG + Intergenic
1001260928 5:170227759-170227781 TGTAACACAGGGCAGGACCAGGG + Intergenic
1007112265 6:39319712-39319734 TCTAACAGAGGCCAAGACAAAGG + Intronic
1010500200 6:76590152-76590174 TGTACCACGAGCCAAGACATTGG + Intergenic
1014417548 6:121201404-121201426 TTTAACACAGGTGAGGACAGGGG + Intronic
1015806443 6:137114367-137114389 GGTTACACATGCCAGCACATTGG + Intergenic
1017182758 6:151569602-151569624 AGTACCACTGGCCAGGACCTGGG - Intronic
1017958914 6:159204878-159204900 AGGAACCCAGGCCAGGAAATGGG - Intronic
1018836935 6:167492261-167492283 AGTAACTGAGGCCAGGTCATGGG + Intergenic
1019606022 7:1910668-1910690 TGGAAGAGAGGCCAGGACACGGG - Intronic
1021846656 7:24769570-24769592 AGTTTCACAGCCCAGGACATAGG + Intergenic
1023505733 7:40898423-40898445 TGTAACACTCGGCAGGGCATTGG + Intergenic
1024283732 7:47739463-47739485 TGTGGCCCAGGTCAGGACATCGG - Intronic
1025077409 7:55954804-55954826 TGGAAAACAAGCCAGGACTTAGG - Intronic
1027959993 7:84933151-84933173 TGTAACCCAGGGCAGGATATAGG - Intergenic
1028613496 7:92738350-92738372 GGTATCACAGGCCAGCACAGTGG + Intronic
1028847955 7:95503974-95503996 GGCAACAAAGGCCAGGAGATGGG - Intronic
1029181496 7:98705152-98705174 TGAAAAACAGGCCAGCACAGTGG - Intergenic
1029433373 7:100547062-100547084 TTTAACAAAGGACAGGACACTGG - Intronic
1030364049 7:108626160-108626182 GGTATCACAGGCTAGAACATGGG - Intergenic
1030894732 7:115043747-115043769 TTTAACACAAAGCAGGACATTGG + Intergenic
1032878609 7:136065046-136065068 TGTAAAACAAGACAGGAAATAGG + Intergenic
1034031913 7:147776408-147776430 TGAAAAACAGGCCAAGACTTAGG - Intronic
1035165723 7:156988625-156988647 AGTAACACTGGCCAGGGAATGGG + Intergenic
1036011211 8:4726765-4726787 TTTAATACAAGCCAGAACATAGG - Intronic
1036068536 8:5412869-5412891 TGTATCACATGCCAGGAAATGGG + Intergenic
1037565900 8:20118293-20118315 TGTCACTCAGCCAAGGACATTGG - Intergenic
1037943845 8:22974229-22974251 TGTAACCCAGGCTTGGAAATCGG - Intronic
1039826200 8:41175916-41175938 AGAAACACCGGGCAGGACATGGG + Intergenic
1041425989 8:57721242-57721264 TGTAAAACAGTCTGGGACATGGG + Intergenic
1044211872 8:89560205-89560227 TGTAGCAATGGCCAGGACTTTGG - Intergenic
1044390043 8:91639312-91639334 TGTAACAGAGGTAAGGACAAAGG + Intergenic
1046130130 8:109956300-109956322 TGTAAGACAGGCAAGGACATAGG - Intergenic
1048441632 8:134463402-134463424 TGTACAGCAAGCCAGGACATGGG + Intergenic
1048881458 8:138875932-138875954 TGTAACACAGGCCAAGTCATCGG + Intronic
1055560953 9:77521228-77521250 TTTAACACCCACCAGGACATGGG + Intronic
1056492494 9:87121339-87121361 TATAAAAGAGGCCAGGAAATGGG + Intergenic
1057218360 9:93242135-93242157 GCTATCACAGCCCAGGACATGGG - Intronic
1059824068 9:118007507-118007529 CGAAACACATGCCAGGTCATGGG - Intergenic
1060247728 9:121960433-121960455 TGCAAGGCAGGACAGGACATGGG - Intronic
1062685948 9:137813552-137813574 GCTGACTCAGGCCAGGACATGGG + Intronic
1189632040 X:42964983-42965005 TTTGACACAGGCCAAGACACTGG + Intergenic
1194878133 X:99215152-99215174 TGTACCACAGGTCAGGGCACTGG + Intergenic
1195331538 X:103807030-103807052 TCTTCCACATGCCAGGACATAGG + Intergenic
1195615507 X:106908995-106909017 TGTAACAGAGGTCAGGAGACTGG + Intronic
1195969434 X:110457663-110457685 TGTAACACAGGTGGGGACAGGGG - Intergenic
1196469735 X:116011801-116011823 TGTAAAACATGCCTGGACATAGG - Intergenic
1200854336 Y:7921000-7921022 GGTAACTCTGCCCAGGACATGGG - Intergenic
1201674661 Y:16566095-16566117 TGTAAGCCATGCCAGGTCATAGG + Intergenic