ID: 1184478940

View in Genome Browser
Species Human (GRCh38)
Location 22:44736188-44736210
Sequence GGGCCTCGCTGGCCGCTGCG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 202
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 186}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184478940_1184478942 -7 Left 1184478940 22:44736188-44736210 CCACGCAGCGGCCAGCGAGGCCC 0: 1
1: 0
2: 0
3: 15
4: 186
Right 1184478942 22:44736204-44736226 GAGGCCCATTTACAACTGCCTGG 0: 1
1: 0
2: 0
3: 4
4: 92
1184478940_1184478945 0 Left 1184478940 22:44736188-44736210 CCACGCAGCGGCCAGCGAGGCCC 0: 1
1: 0
2: 0
3: 15
4: 186
Right 1184478945 22:44736211-44736233 ATTTACAACTGCCTGGCTACAGG 0: 1
1: 0
2: 1
3: 3
4: 118
1184478940_1184478947 17 Left 1184478940 22:44736188-44736210 CCACGCAGCGGCCAGCGAGGCCC 0: 1
1: 0
2: 0
3: 15
4: 186
Right 1184478947 22:44736228-44736250 TACAGGCTCCCCGCATCCCCAGG No data
1184478940_1184478948 21 Left 1184478940 22:44736188-44736210 CCACGCAGCGGCCAGCGAGGCCC 0: 1
1: 0
2: 0
3: 15
4: 186
Right 1184478948 22:44736232-44736254 GGCTCCCCGCATCCCCAGGATGG 0: 1
1: 1
2: 0
3: 17
4: 274

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184478940 Original CRISPR GGGCCTCGCTGGCCGCTGCG TGG (reversed) Intronic
900284059 1:1890892-1890914 GGGCCGCGCTGCGCGCTCCGCGG + Exonic
900522199 1:3111167-3111189 GGGCCCTGCTGGCCACTGCTGGG + Intronic
901019699 1:6249525-6249547 GGGCTCCGCTGGGCGCTGCTTGG + Exonic
901029284 1:6297497-6297519 GGCCCTGGCTGGCCTCTGCTCGG - Intronic
901629733 1:10642231-10642253 TGGAGTCGCTGGCGGCTGCGGGG + Intronic
901791304 1:11654850-11654872 GGGCCTGGCGGGCCGGGGCGGGG + Exonic
902264570 1:15252720-15252742 TGGCCTCCCTGGCCTCTGAGGGG - Intronic
902413262 1:16224655-16224677 GGGCCTTGCAGGCCACTGTGAGG + Intergenic
902541941 1:17162147-17162169 GGGCCTCGGTTGCCGCTGCTGGG + Intergenic
903066011 1:20699939-20699961 GGCTCTCCCTGGCTGCTGCGTGG + Intronic
904181371 1:28668907-28668929 CGCCCTCGCCGGCCGCCGCGCGG - Intronic
904479807 1:30786782-30786804 GGGCCTCTCTGGCCGGTGTGAGG - Intergenic
905262742 1:36730926-36730948 GGGCCTCTGTGGCCCCTGCCAGG - Intergenic
905726695 1:40258282-40258304 GGGCATCGCTGGACGCTTTGTGG + Exonic
905866011 1:41377207-41377229 GGGTCACTCTGGCTGCTGCGTGG + Intronic
906151614 1:43591084-43591106 GGCCCTCCGTGCCCGCTGCGCGG - Exonic
906204409 1:43979377-43979399 GGGCCGCGGTGGCCGCTGACCGG + Intronic
906293026 1:44632110-44632132 GGGACCCCGTGGCCGCTGCGCGG - Intronic
906948625 1:50316666-50316688 GGGCCACGCTGGCTGCTATGTGG + Intergenic
910981109 1:92961143-92961165 GAGCCCGGCTGGCCGCGGCGCGG + Intronic
918103261 1:181394924-181394946 GGGCCTTGCTGACCACTGGGAGG + Intergenic
919650758 1:200147211-200147233 CGGCCTCGCTGGCTTCAGCGAGG - Intronic
920795538 1:209132952-209132974 GGGGCTCGGAGGCTGCTGCGGGG - Intergenic
921355451 1:214281073-214281095 GGGCCTCGCGCGCCCCCGCGGGG - Intergenic
922496514 1:226062266-226062288 GGGCGTCTCGGGCCGCGGCGGGG - Intronic
922798808 1:228354564-228354586 GGCCCTGGCAGGCCTCTGCGGGG + Intronic
924385444 1:243495224-243495246 GGGCCTCCCTGGCCTGTGCGGGG + Intronic
924706911 1:246509497-246509519 GGATCTCGCCGGCCCCTGCGAGG + Intergenic
1062854591 10:773655-773677 GGGCAAGGCTGGCCGCTGCCGGG - Intergenic
1069615366 10:69803085-69803107 TGGGCGCGCTTGCCGCTGCGCGG - Intronic
1073292904 10:102422056-102422078 CGGCCTCGCTGATCGCTGCCCGG + Exonic
1075619426 10:123914910-123914932 TGGCCCCTCTGGCTGCTGCGTGG - Intronic
1076183208 10:128426769-128426791 GGATCCCTCTGGCCGCTGCGTGG - Intergenic
1076647545 10:131963578-131963600 GAGCCTCACTGGCTGCTGCACGG + Intergenic
1077049727 11:561216-561238 GGGCTTCGGTGCCCGCGGCGGGG + Exonic
1077143366 11:1034551-1034573 GGCCCTCGCTGGCCTCTGGTGGG + Intronic
1083811373 11:65108619-65108641 GGGCCCTGCTGGCCGCTGCCGGG + Exonic
1084512617 11:69615700-69615722 AGGCCTCTCTGGCCCCTGCATGG - Intergenic
1085732846 11:79013847-79013869 GGGCCTTGAGGGCCACTGCGGGG - Intronic
1087172795 11:95067518-95067540 GGCTCTCCCTGGCGGCTGCGGGG - Exonic
1088641653 11:111878911-111878933 GGGACGCGCCGGCCGCTGGGCGG + Intronic
1089467510 11:118694948-118694970 CGGCCTCGCTGCCCGCCACGGGG - Intergenic
1089618014 11:119706089-119706111 GGGCCTGGCTGGCGGCCGAGGGG - Intronic
1089625007 11:119745691-119745713 GGGCCTCGCTGGCCCTTCAGAGG + Intergenic
1091616094 12:2052607-2052629 TGGCCGCGGTGGCCGCGGCGCGG - Intronic
1095133605 12:38571759-38571781 GGGCCTCACTGGCCTCTGTCTGG - Intergenic
1101302369 12:103495523-103495545 GGGCCGCGCTCGCCTCCGCGGGG + Intronic
1104761292 12:131298872-131298894 GAGGCTCGGTGGCTGCTGCGGGG + Intergenic
1104818483 12:131661920-131661942 GAGGCTCGGTGGCTGCTGCGGGG - Intergenic
1110318176 13:74134254-74134276 GGGGCTCGCCGGCAGCGGCGGGG - Intergenic
1118785580 14:69043069-69043091 GCGCCTGGCTGGCAGCTGGGAGG + Intergenic
1119780025 14:77271183-77271205 GGGCGGCTCTGGCGGCTGCGGGG - Exonic
1122470903 14:101965132-101965154 GCGCCGCGCCGGCCTCTGCGGGG - Intronic
1122602783 14:102929744-102929766 GGGCCGCGCGGGCAGCTGAGGGG + Intronic
1122637799 14:103138500-103138522 GGCCCGCCCTGGCCGCCGCGAGG - Intergenic
1124407224 15:29403925-29403947 GCCCCTGGCTGGCCGCTGCAGGG + Intronic
1124495009 15:30181030-30181052 GCGCCTCGCTGGGTGCTGCCAGG + Intergenic
1125051173 15:35299485-35299507 GGGCCGCGGTGGCGGCAGCGCGG + Intronic
1125505718 15:40266457-40266479 GGGCCTGGCTTGCTGCTGCTTGG - Exonic
1128635379 15:69299164-69299186 GAGCCTGGGTGGCCGCTCCGAGG + Intronic
1132414420 15:101610376-101610398 GGGCAACGCTGGGCGCTGCGCGG + Intergenic
1132525224 16:410922-410944 GGGCCGCTCTGCCCTCTGCGAGG - Intronic
1132642904 16:985744-985766 GGGCCTTGCAGGGCGCTGTGAGG + Exonic
1134134082 16:11668418-11668440 GGGCCCCGCCCGCCGCAGCGCGG + Exonic
1137655120 16:50153122-50153144 AGGCCTCCCGGGCTGCTGCGCGG + Intronic
1139390780 16:66605299-66605321 GGGACTCCCGGGCCGCAGCGGGG + Intronic
1141903500 16:87007728-87007750 GGGCCTAGCTGGTCTCTGCTGGG + Intergenic
1142071117 16:88091695-88091717 GGTCCTCGCCGGCAGCGGCGGGG - Intronic
1142495728 17:305378-305400 GTGCCTGCCTGGCAGCTGCGGGG + Intronic
1144128073 17:12220992-12221014 GGGGCTAGCCGGCCGCTCCGAGG - Intergenic
1144773127 17:17770604-17770626 GGACCTCCCTGGCCGCTGGCAGG - Intronic
1146438918 17:32876906-32876928 GGGCCTCCGGGGCCGCTCCGTGG + Exonic
1148911289 17:50944454-50944476 GGGCTTCCCTGCCCTCTGCGGGG - Intergenic
1151259943 17:72908413-72908435 GGGCCAGGCTGGCCACTTCGGGG + Intronic
1151380087 17:73719795-73719817 AGGCCTCGCAAGCCGCTGAGTGG - Intergenic
1152077438 17:78168365-78168387 GGGCCACGCCGGCCGCAGCACGG - Intergenic
1152362927 17:79840678-79840700 GGGCCGCGCTGTCCGCTCCCGGG - Intergenic
1152590826 17:81211179-81211201 GGGCCTCTGTGGCCCCAGCGTGG - Intronic
1152677287 17:81648177-81648199 GGCCCTCGCTGCCCGCAGGGGGG + Exonic
1153947809 18:10032523-10032545 GGGCCTCGCTGGCGGCCACTTGG + Intergenic
1154389725 18:13925983-13926005 GGGCCTCGCTGGCTGATCCAAGG - Intergenic
1154416548 18:14178601-14178623 GGGCGTCACTGCCCGCGGCGGGG + Intergenic
1156448231 18:37252493-37252515 GGGCCTTGAAGGCCACTGCGTGG - Intronic
1156462720 18:37330630-37330652 GGGCCATGCTGGGCCCTGCGTGG - Intronic
1158434871 18:57428486-57428508 GGGCCCTCCTGGCCGGTGCGTGG + Intergenic
1160053147 18:75455599-75455621 GGGCCCCGCAGGGCGCAGCGGGG - Intergenic
1160386656 18:78500985-78501007 GGGCCTCGGTGGGTGCTGGGGGG + Intergenic
1160771209 19:831963-831985 GGGCCCCTCTGGCCGGAGCGGGG - Exonic
1160807933 19:1000791-1000813 GGGTCTCGGTGGCCGCCGCCAGG - Exonic
1160855178 19:1214070-1214092 GGGCATCGCCAGCCGCTCCGAGG - Intronic
1160904303 19:1445330-1445352 GGCGCCCGCTGGCGGCTGCGGGG - Intergenic
1161104084 19:2434660-2434682 GGGCATCGCTGGGCGCCCCGAGG + Intronic
1161162013 19:2767051-2767073 GGGACCAGCTGGCCTCTGCGAGG + Intronic
1162376048 19:10305849-10305871 GGGCCTCGCTGCCTGCTGAGTGG + Exonic
1162378243 19:10317486-10317508 GGGCCTCGGCGGCCACTACGCGG - Exonic
1162926569 19:13933231-13933253 GGGGCTCTGCGGCCGCTGCGGGG - Exonic
1163573551 19:18097735-18097757 GGGCCTGGCAGGCCGGGGCGGGG + Intronic
1165317394 19:35065269-35065291 GGGCCTGGCCGGCAGCTGGGAGG - Exonic
1167072306 19:47228169-47228191 GGGCCTCGGGGCCGGCTGCGGGG + Exonic
1167290182 19:48620290-48620312 GGGCCTCCCTGGCGGGTGGGGGG - Intronic
925918216 2:8622495-8622517 GGGCCTCCCTGGGGGCTGCAAGG - Intergenic
929604187 2:43224565-43224587 GGGCGGCGCCGGCGGCTGCGCGG + Exonic
930021995 2:47007248-47007270 GGGCCTGGCGGGACGCTGCCCGG + Intronic
936452769 2:112645884-112645906 GGGTCACGCGGGTCGCTGCGCGG + Exonic
938369932 2:130762593-130762615 TGGCCTCGCTGGCGGCCGAGGGG + Exonic
938795951 2:134718642-134718664 GGGCCGCGCTGGGCGAGGCGCGG - Intronic
941630892 2:167883191-167883213 AGGCCTCTCTGGCTGCTGTGTGG - Intergenic
946431001 2:219627471-219627493 GGGCCGCGCCGGCCGGGGCGGGG + Intronic
948061416 2:235045454-235045476 GGGCCTCCCTGTCCGCTCCAGGG + Intronic
948464001 2:238143550-238143572 GGGCCTCCAGAGCCGCTGCGGGG - Intronic
948739406 2:240033153-240033175 GGGCCAGGCTGGCCCCTGCCTGG + Intergenic
949004287 2:241636821-241636843 GGGCCTCGGCGGCCGGGGCGCGG - Intronic
1171406319 20:24914597-24914619 GGGCATCGCTGGGGGCTGCAGGG - Intergenic
1172122529 20:32607417-32607439 GGGCCCCTCTGGCCGCCGGGTGG - Intronic
1175878062 20:62239628-62239650 GGGCCTGGCTGGGTGCTGTGCGG + Intronic
1175957359 20:62618243-62618265 GGGCCTGGCAGGCCGATTCGGGG - Intergenic
1176867799 21:14063554-14063576 GGGCGTCGCTGCCCGCGGCAGGG + Intergenic
1178106357 21:29323549-29323571 CAGCCTCGCTGGCAGCTGAGTGG + Intronic
1178351088 21:31873495-31873517 GCGCCTCGCTGGGCGGCGCGGGG + Exonic
1179213653 21:39348831-39348853 GGGCCTCGCGGGGCCCGGCGGGG + Intronic
1179603537 21:42496771-42496793 AGGCCTCGCAGGCCCCTCCGGGG + Intronic
1180154952 21:45973212-45973234 GGGCCCCGGAGGCGGCTGCGAGG - Intergenic
1181795394 22:25305111-25305133 GGCCCTGGCTGGCAGCAGCGAGG + Intergenic
1181835932 22:25608628-25608650 GGCCCTGGCTGGCAGCAGCGAGG + Intronic
1182091286 22:27596653-27596675 GGGCCTGGGAGGCCGCTTCGTGG - Intergenic
1182697139 22:32205352-32205374 GGGCGTCACTGCCCGCTGAGGGG + Intergenic
1182711648 22:32326956-32326978 GGGCCCTGCTGGAGGCTGCGGGG - Intergenic
1183282084 22:36937504-36937526 GGGCCTGGCTGGGGGCTGGGGGG - Exonic
1183482565 22:38073162-38073184 TGGCCTCGCTGGCCGCAGCATGG - Intronic
1183829543 22:40410481-40410503 GGGCCACGCTGGCTGCAGTGAGG + Exonic
1184478940 22:44736188-44736210 GGGCCTCGCTGGCCGCTGCGTGG - Intronic
1184784070 22:46663336-46663358 GGGCCTCGCAAGCCCCTGCCAGG - Intronic
1184874875 22:47268019-47268041 GAGCCTCGCTGGCCTCTCAGGGG - Intergenic
1185219777 22:49623515-49623537 TGGCCTGGCTGGCAGCTGTGGGG - Intronic
1185382636 22:50517176-50517198 AGGCCACGCTCGCGGCTGCGTGG + Intronic
950202772 3:11056718-11056740 GGGCGTCGCTGGCAGCTGGAAGG + Intergenic
953903161 3:46854618-46854640 GTGCCACCCTGGCCGCTGTGTGG - Intergenic
954212643 3:49106847-49106869 GGGCCTTGCTGGCTGCTGCCTGG - Intergenic
956669292 3:71671347-71671369 GGGCTTGGCTGGCCGCGGCTTGG + Intergenic
958425415 3:93973722-93973744 GGTCCTGGGTGGGCGCTGCGGGG - Exonic
960590316 3:119359626-119359648 GCTCCTCCCTGGCCTCTGCGAGG - Intronic
962230528 3:133661806-133661828 GGGACGCGCTGGCCGCAGGGCGG + Exonic
962267356 3:133953453-133953475 GGCCCACGCTGGCCACTGTGAGG - Intronic
968759330 4:2433913-2433935 GGGCCTCACTGGCCACGGTGAGG + Intronic
968929742 4:3572552-3572574 GGGCCTCCCAGGCCCATGCGTGG + Intergenic
969507797 4:7598923-7598945 GGGCCTTGCTGGCCACAGCCTGG + Intronic
969640077 4:8392405-8392427 GGGGCTTGCTGGCCGATGCCAGG + Exonic
969703912 4:8781885-8781907 CGGGCTTGCTGGGCGCTGCGGGG + Intergenic
975870774 4:78776363-78776385 GGGCCCCGCCGCCCGCTCCGCGG - Exonic
977379674 4:96256155-96256177 GGACCTCACTGGCTGCTGTGTGG + Intergenic
981010288 4:139918350-139918372 TGGCCGCGCTGGCCTCTCCGAGG + Intronic
985573418 5:662678-662700 CGGCCTCCCTGGCCCCAGCGCGG - Exonic
985578753 5:685725-685747 TGGCCACGCTGGGCGCTGCAAGG - Intronic
987379913 5:17275552-17275574 GGGCCTCGCCGCCCGCAGCGGGG - Exonic
994092118 5:95818707-95818729 GGGCCACTCTGGCAGCTGTGGGG - Intronic
1001403643 5:171461134-171461156 GGGCCTGGCTGGCCGCTGAAGGG - Intergenic
1002291848 5:178205369-178205391 GGGCCGCGCCGGCGGCTGCGTGG + Intronic
1002522539 5:179799688-179799710 GGGACTCGGGGGCCGCTGCAGGG - Intronic
1003623857 6:7726103-7726125 AGCCCACGTTGGCCGCTGCGGGG + Intergenic
1006637003 6:35468272-35468294 GGCCTTCTCTGGCCGCTGGGGGG - Intergenic
1007713533 6:43839537-43839559 GGTCCTCACTGGCAGCTGGGTGG + Intergenic
1010245008 6:73654240-73654262 GGGCCACCCTGCCCGCAGCGAGG + Intergenic
1015994924 6:138987880-138987902 GGGCCTCGCAGGCAGCGGCGCGG - Exonic
1017103384 6:150866705-150866727 GGGACTCCGTGGGCGCTGCGCGG - Intronic
1020246893 7:6436427-6436449 GGGCCTCTCTGGGGGCTGCCTGG - Exonic
1023064844 7:36367026-36367048 GGGCCTCGGTGGCGGGGGCGCGG + Intronic
1026896591 7:74013218-74013240 GGGCCATGCTGGCCGCTGGCTGG - Intergenic
1029724914 7:102396431-102396453 GGGCCTCGGTGGTCGCACCGAGG - Exonic
1033306859 7:140231335-140231357 GGGCTTCCCGGGCCGCTTCGGGG + Intergenic
1034313626 7:150110877-150110899 GGGCGGGGCTGGCCACTGCGAGG + Intergenic
1034383946 7:150722413-150722435 GGGCCTTGGTGACCGCTGCAGGG + Exonic
1034793272 7:153989919-153989941 GGGCGGGGCTGGCCACTGCGAGG - Intronic
1034982276 7:155486828-155486850 GGGCCTCGCTGCCATCTGCCCGG + Intronic
1035015695 7:155763933-155763955 GGGCCCCGCTGGCAGATGTGGGG - Exonic
1035098680 7:156378595-156378617 GGGGCTGGGTGGCCTCTGCGAGG + Intergenic
1035205771 7:157292994-157293016 GGGCCTCACCGGGCGCTGGGAGG - Intergenic
1035266820 7:157693698-157693720 GGGCCCCTCTGGCCTCTGCCCGG - Intronic
1035319035 7:158016433-158016455 GGGCCTCCCTGTCCGAGGCGCGG + Intronic
1035587443 8:786668-786690 GGGCCTCGCTGCTGGCTGGGAGG + Intergenic
1035676964 8:1462749-1462771 AGGCATCCCTGGCCTCTGCGGGG - Intergenic
1035747780 8:1974162-1974184 GGGCAGCGCTGCCCGCGGCGGGG + Intronic
1036664458 8:10729957-10729979 GAGCCTCCCTGCCCGCCGCGCGG + Intronic
1037758589 8:21727330-21727352 GGGCCTCCCTTGCCTCTGCTAGG + Intronic
1038963485 8:32548038-32548060 AGGGGTCGCTGGACGCTGCGCGG - Intronic
1039463248 8:37763121-37763143 GGGCGTCTCTGGCCTCCGCGGGG - Intronic
1041261094 8:56021061-56021083 CGGCCTCACTGGCTGCTTCGTGG + Intergenic
1045327267 8:101126579-101126601 GAGCCGCGCTGGCTGTTGCGGGG + Intergenic
1047463547 8:125091533-125091555 GGGCCGCGCTGGCCACGGGGAGG - Intronic
1047779799 8:128101777-128101799 GGGCCTCGCAGGCCACAGTGAGG - Intergenic
1049334685 8:142077028-142077050 GGGCTTCGCTGGCCTCTGCCTGG - Intergenic
1053166315 9:35846374-35846396 GGGCCTCGGTGAGCGGTGCGGGG + Exonic
1053393750 9:37753874-37753896 GGGGCTGGCTGGGGGCTGCGGGG + Intronic
1054820452 9:69516211-69516233 GGGCCCCGCGGGCGGCGGCGAGG - Exonic
1057179636 9:93022831-93022853 AGGCCTCCCTGGCCGCTGCTTGG - Intronic
1059123361 9:111661803-111661825 GGGACTCGGTGGCGGCGGCGAGG + Intronic
1061499200 9:130992576-130992598 CGGCCTCGCTTGCTGCTGTGCGG - Intergenic
1061559591 9:131394107-131394129 CGGGCTCGCTCGTCGCTGCGCGG - Intronic
1062003448 9:134228127-134228149 GGACCTCGCAGGCTGCTGGGAGG - Intergenic
1187464467 X:19515204-19515226 GGGACTCGCTCGCCGCCCCGAGG + Exonic
1194108266 X:89798662-89798684 GAGCCACGCTGGCTGCTGCTTGG + Intergenic
1194977465 X:100409191-100409213 GGGCCACACTGGCCTCTTCGAGG + Exonic
1200460929 Y:3453398-3453420 GGGCCACGCTGGCTGCTGCTTGG + Intergenic