ID: 1184479521

View in Genome Browser
Species Human (GRCh38)
Location 22:44738425-44738447
Sequence ATGAGAGGCGAGCGCGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 74
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 68}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184479521_1184479530 25 Left 1184479521 22:44738425-44738447 CCTTCCACGCGCTCGCCTCTCAT 0: 1
1: 0
2: 0
3: 5
4: 68
Right 1184479530 22:44738473-44738495 GTGCTGAGCAAATGAAGGACAGG 0: 1
1: 0
2: 1
3: 22
4: 238
1184479521_1184479529 20 Left 1184479521 22:44738425-44738447 CCTTCCACGCGCTCGCCTCTCAT 0: 1
1: 0
2: 0
3: 5
4: 68
Right 1184479529 22:44738468-44738490 AAGGAGTGCTGAGCAAATGAAGG 0: 1
1: 0
2: 2
3: 79
4: 502
1184479521_1184479525 -8 Left 1184479521 22:44738425-44738447 CCTTCCACGCGCTCGCCTCTCAT 0: 1
1: 0
2: 0
3: 5
4: 68
Right 1184479525 22:44738440-44738462 CCTCTCATGGCGTTTTCTCAAGG 0: 1
1: 0
2: 0
3: 13
4: 142
1184479521_1184479528 1 Left 1184479521 22:44738425-44738447 CCTTCCACGCGCTCGCCTCTCAT 0: 1
1: 0
2: 0
3: 5
4: 68
Right 1184479528 22:44738449-44738471 GCGTTTTCTCAAGGTGGGAAAGG 0: 1
1: 0
2: 1
3: 9
4: 110
1184479521_1184479527 -4 Left 1184479521 22:44738425-44738447 CCTTCCACGCGCTCGCCTCTCAT 0: 1
1: 0
2: 0
3: 5
4: 68
Right 1184479527 22:44738444-44738466 TCATGGCGTTTTCTCAAGGTGGG 0: 1
1: 0
2: 0
3: 2
4: 91
1184479521_1184479526 -5 Left 1184479521 22:44738425-44738447 CCTTCCACGCGCTCGCCTCTCAT 0: 1
1: 0
2: 0
3: 5
4: 68
Right 1184479526 22:44738443-44738465 CTCATGGCGTTTTCTCAAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184479521 Original CRISPR ATGAGAGGCGAGCGCGTGGA AGG (reversed) Intronic
900713959 1:4132420-4132442 AAGAGAGGAGAGGGCGGGGAGGG - Intergenic
901808599 1:11752920-11752942 ATGAGATGGGAGCCCCTGGAGGG + Intronic
905917711 1:41697425-41697447 AAGAAAGGCGTGCACGTGGAGGG - Intronic
907268049 1:53274763-53274785 AAGAGTGGCAAGCGCGTGGACGG - Intronic
907888653 1:58617497-58617519 ATGAGAGGCAGGTGGGTGGATGG + Intergenic
915479141 1:156173290-156173312 ATGAAAGGTGAGTGGGTGGAGGG + Intronic
917390723 1:174533266-174533288 ACCAGAGGGGAGCGCATGGAAGG - Intronic
923051646 1:230394599-230394621 ATGAGAGAGGAGCTCGGGGATGG - Intronic
923051825 1:230395220-230395242 ATGAGAGAGGAGCTCGGGGATGG - Intronic
1076073929 10:127517042-127517064 ATGAGAGGGGGGCTGGTGGAGGG + Intergenic
1084284278 11:68121426-68121448 ATCAGTGGCGAGCGCGAGGGCGG - Intronic
1084640523 11:70423272-70423294 ATGAGAGGTGAGAGCCTCGAGGG + Intronic
1085887505 11:80537461-80537483 ATGAGAGAAGAGCGGGAGGAGGG + Intergenic
1087514168 11:99136240-99136262 ATGAGAGGTGAGGGTGAGGAGGG - Intronic
1090248748 11:125236513-125236535 ATGAGAGCTGAGAGCGTGGGGGG + Intronic
1090975166 11:131673749-131673771 AGGAGAGCCGAGAGAGTGGAGGG - Intronic
1096848035 12:54418673-54418695 GGGAGAGGAGAGCGCGTGAATGG - Intronic
1100368403 12:93942877-93942899 ATGAGAGGCGAGAGACAGGAGGG - Intergenic
1102920632 12:116789138-116789160 ATGAGAGGAGAGTGAGTAGATGG + Intronic
1107600397 13:42006648-42006670 ATCAGAGGTGAGAGTGTGGAGGG - Intergenic
1109217720 13:59608890-59608912 ATGGGAGGCTAGCACATGGATGG - Intergenic
1123096893 14:105771089-105771111 GTGAGAGGCCAGCGCAGGGAGGG - Intergenic
1123703149 15:22930932-22930954 GTGAGTGGCGAGCGAGTGGGAGG - Intronic
1132466091 16:78036-78058 CTGCGAGGCGAGAGCGGGGAAGG - Intronic
1132688045 16:1170453-1170475 AGGGGAGGGGAGCGGGTGGACGG + Intronic
1134106153 16:11486990-11487012 ATGAGAGGGATGTGCGTGGATGG + Intronic
1134112431 16:11523953-11523975 AGGAGAGGGGAGCGGGTGGGTGG - Intergenic
1137426281 16:48384524-48384546 TAGAGAGGAGAGCGCGTGAACGG - Intronic
1142067407 16:88070664-88070686 ATGACAGGCCAGCACGTGGGGGG + Intronic
1146262344 17:31430285-31430307 ATGGGAGGAGAGGGAGTGGAAGG + Intronic
1146502020 17:33372635-33372657 ATGAGAGGCCAGAGTGTGGGAGG - Intronic
1152711470 17:81872245-81872267 AGGAGAGGCGAGCCCGGGGCTGG - Intergenic
1157125967 18:44956199-44956221 ATGAGAGGCTAAGGCTTGGAAGG - Intronic
1164575642 19:29403961-29403983 CTGAAAGGGGAGCACGTGGAAGG - Intergenic
1167147885 19:47693942-47693964 ATGAGAGGCGAGGGAGGGAAGGG + Intronic
1168523436 19:57070500-57070522 AAGAGAGGCGAGCGTGTGCCTGG + Intergenic
926035290 2:9631107-9631129 ATGAGGACCGAGCGCGCGGAAGG + Intergenic
937062719 2:118992342-118992364 ATGAGTGGGGAGCGGGTGGAGGG - Intronic
948088127 2:235267535-235267557 ATGAGAGGAGAGTTCATGGAGGG - Intergenic
948143047 2:235688423-235688445 GTGAGAGGTGAGTGAGTGGAGGG - Intronic
948447078 2:238041057-238041079 TTGAGGGGGGAGCACGTGGAAGG - Intronic
1171725794 20:28620147-28620169 ATGGAAGGGCAGCGCGTGGAGGG + Intergenic
1171857717 20:30362211-30362233 ATGGAAGGGCAGCGCGTGGAGGG - Intergenic
1174214365 20:48904690-48904712 ATGAGAGGCGAGGGGATGGGAGG + Intergenic
1176032407 20:63019206-63019228 GTGAGTGGCGAGCGGGTGGGTGG - Intergenic
1178273974 21:31219289-31219311 TTGAAAGGCGAGCGGGTGGGTGG - Intronic
1180390695 22:12279754-12279776 ATGGAAGGGCAGCGCGTGGAAGG + Intergenic
1180409048 22:12585003-12585025 ATGGAAGGGCAGCGCGTGGAAGG - Intergenic
1184479521 22:44738425-44738447 ATGAGAGGCGAGCGCGTGGAAGG - Intronic
1184481931 22:44752924-44752946 GAGAGAGGCGAGGGCGGGGAAGG - Intronic
1184731251 22:46372289-46372311 ATGGGTGGGGAGCGAGTGGATGG - Intronic
1184731264 22:46372341-46372363 ATGGGTGGGGAGCGAGTGGATGG - Intronic
1184817379 22:46882278-46882300 ATGGGAGGCGAGGGTGTGGGAGG + Intronic
962286055 3:134086312-134086334 AGGAGAGGAGAGAGAGTGGATGG + Intronic
969182413 4:5452264-5452286 CAGAGAGGCCAGCGAGTGGAGGG + Intronic
969858932 4:10020894-10020916 GTGAGTGGGGAGCGGGTGGAGGG - Intronic
982406961 4:155031582-155031604 ATGGGAGGGGAGTGCGAGGAGGG + Intergenic
989401350 5:41010868-41010890 ATGTGAGGGGAGCGGGTAGATGG + Intronic
996923547 5:128796726-128796748 ATGAGAGAAGAGCGTGTGAAAGG - Intronic
999283361 5:150379492-150379514 ATGAGAGGAGAGAGCCTGGAGGG - Intronic
1002451449 5:179321359-179321381 GTGAGAGGCAAGGGAGTGGAGGG - Intronic
1005964888 6:30720323-30720345 AGGAGAGGGGAGGGCGCGGAGGG - Exonic
1017945044 6:159089713-159089735 ATGAGAGGCTTGCGAGTGGGAGG - Intergenic
1024919476 7:54542655-54542677 AAGAAAGGCGTGCGAGTGGATGG - Exonic
1028193286 7:87876403-87876425 ACGAGGGGCGAGCGCGAGGCGGG + Exonic
1028871093 7:95772503-95772525 AGGAGGGGCGCGGGCGTGGAGGG + Intronic
1048985476 8:139732541-139732563 CGTAGAGGCGAGGGCGTGGAAGG + Intronic
1049789482 8:144466268-144466290 CTGGAAGGCGAGCGCGGGGACGG - Exonic
1053723815 9:40975721-40975743 ATGGAAGGGCAGCGCGTGGAGGG - Intergenic
1060554909 9:124503271-124503293 GTGAGCGGCGAGCGCGCGGCAGG - Intronic
1187282287 X:17866939-17866961 ATGAGAGGCAAGGGCAAGGACGG - Intergenic
1188582953 X:31737548-31737570 ATGAGAGGAGAGTGAGTCGAGGG - Intronic
1194112594 X:89853807-89853829 ATGAGAGGCAAGAGCGGGGAGGG + Intergenic
1200465247 Y:3508619-3508641 ATGAGAGGCAAGAGCGGGGAGGG + Intergenic