ID: 1184482328

View in Genome Browser
Species Human (GRCh38)
Location 22:44755098-44755120
Sequence CGTGCCTCCTGATGTGAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184482328_1184482336 28 Left 1184482328 22:44755098-44755120 CCTTGCTCACATCAGGAGGCACG No data
Right 1184482336 22:44755149-44755171 GAAACAGACAAGGAAGGTTAAGG 0: 1
1: 0
2: 2
3: 45
4: 383
1184482328_1184482330 6 Left 1184482328 22:44755098-44755120 CCTTGCTCACATCAGGAGGCACG No data
Right 1184482330 22:44755127-44755149 TACTGCCCCGTTCACAGATGAGG 0: 1
1: 0
2: 2
3: 19
4: 225
1184482328_1184482335 22 Left 1184482328 22:44755098-44755120 CCTTGCTCACATCAGGAGGCACG No data
Right 1184482335 22:44755143-44755165 GATGAGGAAACAGACAAGGAAGG 0: 1
1: 2
2: 12
3: 108
4: 901
1184482328_1184482334 18 Left 1184482328 22:44755098-44755120 CCTTGCTCACATCAGGAGGCACG No data
Right 1184482334 22:44755139-44755161 CACAGATGAGGAAACAGACAAGG 0: 1
1: 1
2: 34
3: 151
4: 870

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184482328 Original CRISPR CGTGCCTCCTGATGTGAGCA AGG (reversed) Intronic
No off target data available for this crispr