ID: 1184483110

View in Genome Browser
Species Human (GRCh38)
Location 22:44759602-44759624
Sequence CTGGGTATGCAGATGAGACC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 232
Summary {0: 1, 1: 0, 2: 2, 3: 21, 4: 208}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184483110_1184483114 19 Left 1184483110 22:44759602-44759624 CCGGGTCTCATCTGCATACCCAG 0: 1
1: 0
2: 2
3: 21
4: 208
Right 1184483114 22:44759644-44759666 GTGGTTCTGTCTTGAGAAACAGG 0: 1
1: 0
2: 1
3: 24
4: 189
1184483110_1184483113 0 Left 1184483110 22:44759602-44759624 CCGGGTCTCATCTGCATACCCAG 0: 1
1: 0
2: 2
3: 21
4: 208
Right 1184483113 22:44759625-44759647 CTGCGCAGAGACTCTCACAGTGG 0: 1
1: 0
2: 0
3: 10
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184483110 Original CRISPR CTGGGTATGCAGATGAGACC CGG (reversed) Intronic
900237859 1:1601003-1601025 CTGTGTATGCAGACGTGGCCGGG + Intergenic
900562884 1:3316381-3316403 ATGGGTGTGCAACTGAGACCGGG - Intronic
900623013 1:3596045-3596067 CTGGGGAGACAGAGGAGACCTGG + Intronic
901092117 1:6648870-6648892 CTGGGTCTGCAAAGGGGACCGGG - Intronic
902319417 1:15650362-15650384 CTGGGTATTTAGATGAGATTAGG + Intronic
904198217 1:28801905-28801927 CAGAGTATGCAAATGAGGCCTGG + Intergenic
904498986 1:30903253-30903275 CTGAGTCTGCAGAGGTGACCAGG - Intronic
905274596 1:36809029-36809051 CTGGGAAAGCAGAAGAGACAAGG - Intronic
906527124 1:46500494-46500516 CTGGATATGAGGATGAAACCAGG - Intergenic
907519773 1:55015541-55015563 GTGGGTAGGTGGATGAGACCAGG + Intergenic
909335139 1:74464658-74464680 CTGTGTACACAGATGAGACTGGG - Intronic
909945620 1:81659511-81659533 CTGGGTTTTCAGATAAGAACAGG - Intronic
910910722 1:92230913-92230935 CTGTGTGTGCAGATGTCACCTGG + Intronic
916877673 1:168987328-168987350 CTGGGAAGGCAGAGGAGACCTGG - Intergenic
918033283 1:180839069-180839091 GTGGCTATGCAGATGAGAATAGG + Intronic
918788084 1:188790443-188790465 CTGGGTAACATGATGAGACCCGG + Intergenic
919801050 1:201354902-201354924 CTGGGGGTGCAGGGGAGACCAGG - Intergenic
920871818 1:209801322-209801344 CTGTGTAGCCAGATGAGCCCAGG + Exonic
921604192 1:217136605-217136627 TTGGGTCTGCAGATGTGAGCGGG - Intronic
921746967 1:218750829-218750851 CTGGGTATGCAGTGGTAACCTGG - Intergenic
923094367 1:230762884-230762906 CTGGGTTTGCAGGTGAGGCTCGG + Intronic
923234285 1:232017616-232017638 CTGGGTAAGCAGTTGAGTCACGG + Intronic
1063498284 10:6530092-6530114 CTGGATATGCATATGGGACAGGG + Intronic
1064561339 10:16597898-16597920 CTGTGTGGGCAGATGAGAGCTGG + Intronic
1067993046 10:51237404-51237426 CTGGATATGCAAATGTGCCCTGG - Intronic
1070149187 10:73795321-73795343 CTGGGTAAGCAGATTGGACCTGG + Intronic
1070519006 10:77235620-77235642 CCGGGTATGCAGAGGAGCCAAGG + Intronic
1070519318 10:77238094-77238116 CTGGGAATTCAGATGAGATGAGG + Intronic
1072785360 10:98275765-98275787 CTGGGCAGGCAGAAGAGACCCGG + Intergenic
1073095172 10:100975093-100975115 CTGGGGAGGCAGATGGAACCAGG + Intronic
1074028665 10:109663317-109663339 CTGGGTCTGCAGCTGTGACTTGG - Intergenic
1075220272 10:120578638-120578660 CTGGGGAGGCAGAAAAGACCAGG - Intronic
1078466276 11:11552866-11552888 CTGGGTGTGGAGCAGAGACCTGG - Intronic
1078933683 11:15934040-15934062 CTGGCTATGCAGTTGTGTCCAGG + Intergenic
1083132098 11:60634116-60634138 CTGGATATTCAGATCAGACAGGG - Intergenic
1084591207 11:70091700-70091722 CTGGCTGTGCAGGTGTGACCTGG + Intronic
1088691729 11:112334286-112334308 CTGGGTGTGCACATGAGACTGGG - Intergenic
1088787156 11:113192606-113192628 ATTGGGATGCAGGTGAGACCGGG + Intronic
1089934176 11:122346463-122346485 CTGGAGATGCAGTTGTGACCAGG + Intergenic
1090065744 11:123502033-123502055 CTGGGGATGCTGGTGAGCCCAGG - Intergenic
1090623081 11:128579143-128579165 CTGGGTATGAAGATGGCACATGG + Intronic
1091026342 11:132144775-132144797 CTGGCAATGCAGATGAGAGGTGG - Intronic
1094027681 12:25976065-25976087 CTGGGTGAGGAGAGGAGACCAGG - Intronic
1099550581 12:84038617-84038639 CAGGGTATGCGGGTCAGACCCGG + Intergenic
1103743142 12:123104860-123104882 CTGGCTATGGTGATGAGAGCAGG - Intronic
1103971269 12:124674266-124674288 CAGGGTATGCAGAGGAGACCTGG + Intergenic
1104031480 12:125068117-125068139 GTGTGTCTGGAGATGAGACCTGG - Intronic
1104856565 12:131905001-131905023 CTGGGCAGGCAGGTGAGGCCAGG + Intronic
1105903673 13:24781609-24781631 CTGGGTAACCAAGTGAGACCTGG + Intronic
1107287069 13:38805490-38805512 CAGGGCATGCAGGTGAAACCAGG + Intronic
1111118733 13:83817391-83817413 CTGGGTTTGCTGATCAGACAAGG + Intergenic
1111344642 13:86935088-86935110 CCGGGTATGCAGAATAGCCCAGG - Intergenic
1114644863 14:24249696-24249718 CTGGCTATGCAGAGGCGCCCTGG - Intronic
1120941468 14:89954478-89954500 CCGGGTGTGCAGATAAGACCTGG - Intronic
1121391904 14:93582949-93582971 CTGGGGATCTATATGAGACCTGG + Intronic
1121721398 14:96111346-96111368 CTCAGTATACAGATGAGAACTGG + Intergenic
1122655770 14:103258420-103258442 CTGGGGGTGCAGTAGAGACCAGG - Intergenic
1123030474 14:105449035-105449057 CAGGCTGTCCAGATGAGACCGGG - Intronic
1124147801 15:27144688-27144710 CTGGGTATGCATATGACACTGGG - Intronic
1127900531 15:63337843-63337865 CTGGGATTGCAGGTGAGAACGGG + Intronic
1128635973 15:69302644-69302666 CTGGGTCTGCTGAGGAGTCCAGG - Intronic
1129231167 15:74197863-74197885 CTGGGTGTGCAGATGGGTCTGGG + Intronic
1129323878 15:74789454-74789476 CTGGTTCTGCAGAGGACACCAGG - Intronic
1129899223 15:79132907-79132929 CTGAGTATGCAGGTGTCACCTGG + Intergenic
1130169218 15:81494626-81494648 CTGGATATTGAGGTGAGACCTGG - Intergenic
1131276195 15:90983470-90983492 CTGGGTATGGAGCTGAGAAGTGG - Intronic
1133130813 16:3675169-3675191 CTGGGTGTGGGGATGAGACAGGG - Intronic
1135650090 16:24198368-24198390 CTGGGTAGGGGGATGAGCCCAGG + Intronic
1135728093 16:24872618-24872640 CTGGGGAGGCTGGTGAGACCAGG - Intronic
1136710627 16:32234025-32234047 CTGGGTAGGCAGAGGTGAGCAGG - Intergenic
1136810824 16:33174989-33175011 CTGGGTAGGCAGAGGTGAGCAGG - Intergenic
1136817300 16:33285069-33285091 CTGGGTAGGCAGAGGTGAGCAGG - Intronic
1136823863 16:33341598-33341620 CTGGGTAGGCAGAGGTGAGCAGG - Intergenic
1137601548 16:49759824-49759846 CTGTCTGTGCAGATGAGACTAGG + Intronic
1140246072 16:73250966-73250988 CTCAGATTGCAGATGAGACCAGG - Intergenic
1140633043 16:76877556-76877578 CTGGTTAACCATATGAGACCAGG - Intergenic
1141286892 16:82681028-82681050 ATGAGGATGCAGATGAGAGCAGG + Intronic
1141748924 16:85945459-85945481 CTGGGCCTGCAGTGGAGACCGGG + Intergenic
1141768254 16:86072732-86072754 CGGGGTATGCAGCTGTGGCCTGG - Intergenic
1142220310 16:88851054-88851076 CAGGGTCAGCAGATGAGAGCTGG - Intronic
1203059434 16_KI270728v1_random:955737-955759 CTGGGTAGGCAGAGGTGAGCAGG + Intergenic
1144416040 17:15048181-15048203 CTGGGAATGCAGCTGTGAGCTGG - Intergenic
1144959536 17:19037329-19037351 CTGGGTATGCAGAAGTTGCCTGG + Intronic
1144975623 17:19137195-19137217 CTGGGTATGCAGAAGTTGCCTGG - Intronic
1145070002 17:19796783-19796805 CAGGGTCTGCGGGTGAGACCTGG + Intronic
1145233044 17:21188852-21188874 CTAGGTATGGAGGTGAGGCCCGG + Exonic
1145296781 17:21598934-21598956 CTGGGTCTGCAGGTGAGTCAGGG + Intergenic
1148534896 17:48430614-48430636 CTGGGGATGGAGATGTGAACTGG - Intergenic
1148860648 17:50602745-50602767 TTGTGTATGCAGAGCAGACCTGG + Intronic
1149258203 17:54850854-54850876 CTGGATTTGCAAATGAGACAGGG + Intergenic
1149314208 17:55423063-55423085 CTGGGTATGGACACGATACCTGG - Intergenic
1149538281 17:57449266-57449288 GTGGGGATAGAGATGAGACCAGG - Intronic
1149641780 17:58207417-58207439 CTGGGTATGCAGGTAATAACTGG - Intronic
1150481571 17:65515458-65515480 CTGGGCTTGGAAATGAGACCTGG + Intergenic
1150506220 17:65701599-65701621 CTGGGTATGGAGATGAGTATAGG - Intronic
1151860038 17:76753922-76753944 CTGGGAATGCATCTCAGACCTGG + Intronic
1152469505 17:80482970-80482992 CAGGGCTTGCAGAAGAGACCTGG + Intergenic
1157586551 18:48804896-48804918 CTGGGGATGAGGATGAGACTGGG - Intronic
1157710551 18:49847076-49847098 CTGGGGATGGAGATGGGAGCGGG + Intronic
1158080738 18:53587502-53587524 CTGGGTATGAAAATGAAACAAGG - Intergenic
1158880415 18:61773922-61773944 CTGGGGATGAACATGAGACAAGG - Intergenic
1160594745 18:79965284-79965306 CTGGCTATGAGGAAGAGACCTGG + Intronic
1161195969 19:2986979-2987001 CTGGTTCAGCAGGTGAGACCTGG - Exonic
1163233061 19:16016704-16016726 CTGGGGATGCAGATGGGGCAGGG - Intergenic
1164538045 19:29101192-29101214 CTGAGTGTGCAGATGTCACCTGG + Intergenic
1164869279 19:31629693-31629715 CTGGGTATGCAGGAAAAACCAGG + Intergenic
1166346253 19:42167958-42167980 CTGGGCATGCAGCTCAGGCCTGG + Intronic
1168679136 19:58301017-58301039 CTAGGGATGTAGATGACACCTGG - Exonic
925044528 2:762289-762311 CATGGTATGCAGAAGAGAACAGG + Intergenic
925444975 2:3919825-3919847 CTGGTTCTGCAGATGAAAGCTGG + Intergenic
925532986 2:4884420-4884442 CTGGGGAGGCAGCTGAGGCCCGG - Intergenic
927170241 2:20363224-20363246 CGGGGTATGCAGGTCAGGCCTGG - Intergenic
928190525 2:29161675-29161697 CTGGCTGTGCAGGTGACACCTGG - Intronic
928840394 2:35598727-35598749 CTGGGTCTGCAGCTGAGGCTTGG - Intergenic
929029160 2:37634872-37634894 CTGAATATCCAGATGAGCCCTGG - Intergenic
930060299 2:47283032-47283054 CAGGGTCTGCAGGTCAGACCCGG + Intergenic
931453635 2:62389404-62389426 CTGGAGATGCAGATCAGCCCAGG - Intergenic
931504772 2:62912866-62912888 TAGGGTATGCATATGATACCTGG + Intronic
931656670 2:64515559-64515581 CTTAGTATGCAGATGAGATCTGG - Intergenic
932113915 2:69027336-69027358 CTGGGGATCAAGATGAGGCCAGG + Intronic
936284669 2:111173018-111173040 CTGGAGATGCAAGTGAGACCTGG - Intergenic
937115724 2:119403920-119403942 CTGAGAATGCAGATGAGCCATGG + Intergenic
938560700 2:132469836-132469858 CTGGGGAGGGAGATGAGAACGGG - Intronic
939024114 2:136991493-136991515 CTGGGTATGCAGTGGAGAGGGGG + Intronic
940531047 2:154876419-154876441 CTGGGTACTCAGATAAGTCCAGG - Intergenic
944298270 2:198092196-198092218 CTGGAGATGCAGGTGAGACTGGG - Intronic
945034907 2:205696461-205696483 CTGGGAAGGCACATGAGACATGG - Intronic
946003595 2:216504180-216504202 TTGGGTATGAAGTTGAGACATGG + Intronic
946132470 2:217617645-217617667 CTGGGTATTAAGACCAGACCGGG + Intronic
946276747 2:218637240-218637262 CTGGGTAGTCAGGTGAGACAAGG + Intergenic
946959945 2:224973966-224973988 GTGGCAATGCAGCTGAGACCTGG - Intronic
948059783 2:235034256-235034278 CAACGTATGCAGATGAAACCAGG - Intronic
948293210 2:236842705-236842727 CTGGCACTGGAGATGAGACCAGG - Intergenic
948605142 2:239130221-239130243 CTGGGGATGGAGCTGAGGCCAGG + Intronic
1170849474 20:19991480-19991502 GTGGGGATGCAGATGACATCTGG - Intronic
1172094060 20:32452167-32452189 CTGGGTCTGCAGAGCAGCCCTGG - Intronic
1173045416 20:39504851-39504873 ATGGGAATTCAGATGAGATCTGG - Intergenic
1173494095 20:43506710-43506732 TAGGGTATGCAGATGAAAACAGG - Intergenic
1174403137 20:50286737-50286759 TTGGGTATGGACATGTGACCAGG + Intergenic
1174839571 20:53888796-53888818 CTGGGGCTGCAGGTGAAACCTGG + Intergenic
1175170216 20:57074914-57074936 GTGGCTATGCAGAAGAGACCTGG + Intergenic
1176056023 20:63149679-63149701 CTGGGTCTGCAGCTGGGCCCAGG + Intergenic
1177654713 21:24002945-24002967 CTGGATTTGCAGAGGAGACTGGG - Intergenic
1178179224 21:30140689-30140711 CTGGATATGCATATCAGACAAGG + Intergenic
1178492319 21:33060596-33060618 CTGGGGATCCAGCTGAGAGCAGG + Intergenic
1178668111 21:34566526-34566548 CTGGGTCTTCAGGTGAGGCCTGG - Intronic
1180588967 22:16919550-16919572 CCGGGTTTGCAGATGCCACCTGG + Intergenic
1180940553 22:19657560-19657582 CTGGGTATCCACCTGGGACCTGG + Intergenic
1181853923 22:25769061-25769083 CTGGGAAGGCAGGTGAGTCCTGG + Exonic
1184483110 22:44759602-44759624 CTGGGTATGCAGATGAGACCCGG - Intronic
1184948941 22:47826032-47826054 CTGGGTCTGTTGATGAGACCTGG - Intergenic
950483057 3:13256651-13256673 CTGGGGATGCAGAAGGGACCAGG + Intergenic
950485228 3:13269427-13269449 AGGGGGATGCAGATGAGAACAGG + Intergenic
951462705 3:22968585-22968607 CTGGTGGTCCAGATGAGACCAGG + Intergenic
952376154 3:32769084-32769106 GTGGGTATGGAGATAAGACAGGG - Intronic
953795891 3:45985629-45985651 CTGGGTGTGCAGATGCTGCCTGG + Intronic
954219434 3:49144012-49144034 CTGGCTATGCAGGTGAGGCATGG - Intergenic
954435435 3:50493440-50493462 CTGGGTCTGCAGATGATGCCTGG + Intronic
955303688 3:57809111-57809133 CTGGGTGTGCAGCTGAGACTTGG - Intronic
959390272 3:105763954-105763976 CAGTGTATGCAGATGTCACCTGG - Intronic
960225902 3:115168273-115168295 ATGGGCATGCAAATGAAACCTGG - Intergenic
960649185 3:119927308-119927330 ATGGGTATGGAGAGGAGACTTGG + Intronic
961561619 3:127734181-127734203 CTGGTTATGAAAGTGAGACCCGG - Intronic
962286723 3:134092550-134092572 CTGGGAATGCAGTCTAGACCGGG - Intronic
962665416 3:137649413-137649435 CTGGGTCTAGAGATGAGAACTGG + Intergenic
966077198 3:175951573-175951595 CTGAGTAGCCAGATGAGACCAGG - Intergenic
966876103 3:184322635-184322657 CTGAGGAAGCAGATGAGACCTGG + Exonic
969221390 4:5761174-5761196 CTGGGTGTGCCGAGGAGAGCAGG + Intronic
970488631 4:16549187-16549209 CTGGGCATTCAGATGAAACCAGG - Intronic
972931452 4:44076505-44076527 GTGGAGATGAAGATGAGACCAGG - Intergenic
972931680 4:44079682-44079704 GTGGAGATGAAGATGAGACCAGG + Intergenic
974235712 4:59179387-59179409 CTGGGTCTGCAGCTGAGGCTGGG - Intergenic
974369724 4:60999745-60999767 CTAGGCATGCTGATGAGACCTGG + Intergenic
974972565 4:68847474-68847496 CAGGGTATGCAGTTGAGAAAAGG - Intergenic
977536299 4:98260369-98260391 CTGGGCATGCACGTGAGGCCGGG - Intergenic
978209208 4:106114644-106114666 CAGGGTCTGCAGATTGGACCTGG + Intronic
979439409 4:120733650-120733672 CTGGGTATGCAGAGAACTCCAGG + Intronic
979664199 4:123293064-123293086 CTGGATATTCAGATCAGACGAGG + Intronic
984309558 4:178039692-178039714 CTGGGATTTCAGATGAGCCCTGG - Intergenic
986484128 5:8218087-8218109 CATGGTATCCAGATGAGCCCTGG + Intergenic
987719289 5:21614234-21614256 CAGGGTATGCAGAAGAGGCATGG - Intergenic
990966925 5:61458575-61458597 TCAGGTATACAGATGAGACCAGG + Intronic
991378065 5:65987262-65987284 CTGGGTTTACAGGTGTGACCTGG - Intronic
994043867 5:95285999-95286021 CTGGGGATGCAGCTGTGAACAGG + Intergenic
997259369 5:132454319-132454341 CAGGGTGTGGAGGTGAGACCTGG + Intronic
998159409 5:139804701-139804723 CTGGGTATGCAGAAGGGACTGGG - Intronic
999420793 5:151440691-151440713 CTGGAAAAGCAGATGAGATCAGG - Intronic
1001138082 5:169119217-169119239 CTTGTTACGCAGATGACACCTGG + Intronic
1002182825 5:177440392-177440414 CTGGGTATGCAGTTGGGGCGGGG - Intronic
1005886407 6:30101043-30101065 CTGGGTAGGCGGATGGGACCAGG - Intergenic
1007202108 6:40118340-40118362 CTGGGTAAGCCAATGGGACCAGG + Intergenic
1013116315 6:107106307-107106329 CAAGGGATGCAGCTGAGACCAGG + Intronic
1014893371 6:126870034-126870056 CTGTGAATGCAGATGATACTGGG - Intergenic
1014983304 6:127971949-127971971 CTGGCTATGGAGATGAGAAAGGG - Intronic
1018902996 6:168060450-168060472 TTGGGGTTGCAGATGAGTCCAGG - Intronic
1020279110 7:6641372-6641394 CTGGGTATAAACCTGAGACCGGG - Intronic
1020963174 7:14831542-14831564 CTGCTTGTGCAGATGTGACCTGG + Intronic
1021181843 7:17516132-17516154 CTGGGTTTGATGATGACACCAGG + Intergenic
1021359393 7:19692393-19692415 GTGGGTAGGCAGCTGAGGCCTGG + Intergenic
1022432299 7:30337473-30337495 CTGAGTATGGAGATGTCACCTGG - Intronic
1028314823 7:89387573-89387595 CAGGGACTGCAGGTGAGACCGGG - Intergenic
1028339696 7:89703485-89703507 ATGGGTATGGATATGAGACAAGG - Intergenic
1029315924 7:99713769-99713791 ATGGGTATGCAGTTAGGACCAGG - Intronic
1029601256 7:101564806-101564828 CTGGGCACGCAGACGTGACCTGG - Intergenic
1030464022 7:109876874-109876896 GTGGGTATGGAGATGAGAAAGGG + Intergenic
1032421298 7:131782127-131782149 CTGGGTATGGAGATGAGACAAGG - Intergenic
1032473184 7:132192988-132193010 TTGGGTATGCAGGTGAGAGGTGG + Intronic
1035285850 7:157806863-157806885 CTGTGCATGCAGAGGAGAGCGGG - Intronic
1035330813 7:158096299-158096321 CTGGGCATGTGGCTGAGACCCGG - Intronic
1035396382 7:158537696-158537718 CTGGGCTGGCAGATGAGGCCGGG - Intronic
1036043365 8:5111823-5111845 CATGGTATTCAGATGAGATCGGG - Intergenic
1036088817 8:5642368-5642390 TTGTGAATGCAGAAGAGACCTGG + Intergenic
1036762255 8:11517573-11517595 CGGGGAAAGCAGATGAGGCCGGG - Intronic
1038443264 8:27586232-27586254 CCTGGTTTGCAAATGAGACCTGG - Intergenic
1044404190 8:91808722-91808744 CTGGCTATGCAGAGGACACAAGG + Intergenic
1044845582 8:96377311-96377333 CTGGGTAAGCCGATGACAGCTGG - Intergenic
1048190463 8:132283542-132283564 CTGATGATGCAAATGAGACCAGG - Intronic
1049205472 8:141361591-141361613 CTGGGTGTGCAGCCTAGACCAGG + Intronic
1049533137 8:143166404-143166426 CTGGGGATGCAGATGGGCCGAGG + Intergenic
1049736694 8:144211391-144211413 CTGGGTAAGCAAATGGTACCTGG - Intronic
1057279569 9:93700033-93700055 CTGAGTGTGCAGATGTGACAAGG - Intergenic
1057468403 9:95337126-95337148 CTGGGTCTGCAGCCGTGACCTGG - Intergenic
1058190085 9:101903323-101903345 CTGGGAATCCAGAGGAGTCCTGG + Intergenic
1060039410 9:120286824-120286846 CTGGGAATGCAGAAGTGAACAGG - Intergenic
1062187828 9:135228004-135228026 CAGGGGCTGCAGATGAGACAGGG + Intergenic
1062546668 9:137066657-137066679 CTGGGTGTGCAGAAGAGAGCTGG - Intronic
1185953148 X:4458571-4458593 CAGGGGATGGAGATGAGACCAGG - Intergenic
1186413026 X:9360405-9360427 CTGAGTTTGAAGATGAGGCCTGG - Intergenic
1189243076 X:39540758-39540780 TTGGGGTTGCAGAAGAGACCTGG - Intergenic
1189522268 X:41782396-41782418 CTGTATATCGAGATGAGACCTGG - Intronic
1190999583 X:55646128-55646150 GTGGGTTCGCAGATGAGACCAGG - Intergenic
1198235619 X:134733749-134733771 CTGGGGATGAGGATGAGGCCTGG + Intronic