ID: 1184483151

View in Genome Browser
Species Human (GRCh38)
Location 22:44759844-44759866
Sequence CCTCACCTCTTGCAGCTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 301
Summary {0: 1, 1: 0, 2: 2, 3: 27, 4: 271}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184483146_1184483151 -5 Left 1184483146 22:44759826-44759848 CCCTGGGAGGCGGGACAGCCTCA No data
Right 1184483151 22:44759844-44759866 CCTCACCTCTTGCAGCTGGAGGG 0: 1
1: 0
2: 2
3: 27
4: 271
1184483142_1184483151 9 Left 1184483142 22:44759812-44759834 CCTAACTGGGCGGGCCCTGGGAG 0: 1
1: 0
2: 0
3: 14
4: 162
Right 1184483151 22:44759844-44759866 CCTCACCTCTTGCAGCTGGAGGG 0: 1
1: 0
2: 2
3: 27
4: 271
1184483147_1184483151 -6 Left 1184483147 22:44759827-44759849 CCTGGGAGGCGGGACAGCCTCAC 0: 1
1: 0
2: 3
3: 19
4: 196
Right 1184483151 22:44759844-44759866 CCTCACCTCTTGCAGCTGGAGGG 0: 1
1: 0
2: 2
3: 27
4: 271

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184483151 Original CRISPR CCTCACCTCTTGCAGCTGGA GGG Intronic
900029379 1:359627-359649 CCTCTCCACATGCAGCAGGAAGG - Intergenic
900398882 1:2464776-2464798 TCTCATCTCTTTCAGCTGGAGGG - Intronic
900689203 1:3969692-3969714 CCTCATCTCTTGCAGCCAGAGGG - Intergenic
901345413 1:8536332-8536354 TCTCACCTCTTGGATCTGGGTGG - Intronic
901528052 1:9836342-9836364 GCTTGCCTCCTGCAGCTGGAAGG - Intergenic
902227261 1:15004308-15004330 CCTCAGCTCTGGAAGCTGGCTGG - Intronic
902282096 1:15382177-15382199 CCTCACCTTCTGCTGCCGGATGG - Exonic
903244469 1:22005644-22005666 CCTCACCTCTGCCTGCAGGAGGG + Exonic
903445342 1:23419071-23419093 CCCCACCTGTAGTAGCTGGATGG + Exonic
903500572 1:23798111-23798133 TCTCACCTCCAGAAGCTGGATGG + Exonic
904253563 1:29240676-29240698 CCCCACCCCTAGCAGCTGGCAGG + Intronic
904271551 1:29353587-29353609 CCTCACCTCATGGAACAGGAGGG + Intergenic
904773916 1:32895335-32895357 CCTCAGCTCCAGCAGCTGGTGGG + Exonic
905352402 1:37356706-37356728 CCTCACCTGCAGCAGCTGGGGGG - Intergenic
906658234 1:47564227-47564249 CATCAACTCTTACAGCTGGTAGG - Intergenic
907000418 1:50846992-50847014 CCTCACCTCTTGCAGCAAAGGGG - Intronic
911517742 1:98888488-98888510 CCTCACTTCTTGAATCTGGCTGG + Intergenic
911665246 1:100543938-100543960 CCTCACCTATTGCACCAGGCAGG - Intergenic
912554146 1:110504121-110504143 TCTCCCCTCTTCCAGCTGGTTGG - Intergenic
914943724 1:152045443-152045465 CCTCACCTCCTGCTCTTGGAAGG + Intronic
915064150 1:153210753-153210775 CCTCACCTCGGGCAGCAGCAAGG + Intergenic
917085491 1:171300855-171300877 CTTAACCTCTTGTATCTGGATGG - Intergenic
917318939 1:173758940-173758962 CCTTTTCTCTTGCAGCTGGGAGG + Intronic
917458191 1:175203901-175203923 CACCTTCTCTTGCAGCTGGAGGG - Intergenic
918884066 1:190167570-190167592 TTTCACCTCTTGCAGCTGTAGGG + Intronic
919572341 1:199264415-199264437 CCTCCCCTCTTGCATCTTGATGG + Intergenic
921851494 1:219936709-219936731 CCTCTCCTATTGCAGTTTGAAGG - Intronic
923874636 1:238034476-238034498 CCTTTCCTTTTGCAGCTGGGAGG + Intergenic
1063116375 10:3074651-3074673 ACTCAGCTGTTACAGCTGGAAGG + Intronic
1064035030 10:11908078-11908100 CCTCACCGCTCACAGCAGGAGGG - Intergenic
1065866608 10:29920112-29920134 CCTCTTCTCTTCCAGATGGAGGG + Intergenic
1067500225 10:46796963-46796985 TCTGACCTCTTGTAGCTAGAGGG + Intergenic
1067594404 10:47543350-47543372 TCTGACCTCTTGTAGCTAGAGGG - Intronic
1067641513 10:48051465-48051487 TCTGACCTCTTGTAGCTAGAGGG - Intergenic
1068943113 10:62701001-62701023 CCTGACTTCTTGCATCTTGAGGG - Intergenic
1069560007 10:69422710-69422732 CCTCATCTCGTCCAGCTGGCAGG + Intergenic
1069907163 10:71738696-71738718 CCACAGCTCTCACAGCTGGAGGG + Intronic
1070597868 10:77845311-77845333 CCTCGGCTGTTGGAGCTGGAAGG - Intronic
1070779533 10:79129564-79129586 CCTCCCCTCTGCCAGCAGGAGGG + Intronic
1072842472 10:98789700-98789722 CCTCATTTCTTATAGCTGGATGG + Intronic
1074199770 10:111224433-111224455 CCTCACCTTTTGCAGCAGAAAGG + Intergenic
1074248132 10:111714528-111714550 TCTCACCTGCTGCAGCTGTAGGG - Intergenic
1074857807 10:117486227-117486249 TCTCACCTCTTGCAGCCCCAGGG + Intergenic
1075025074 10:118978399-118978421 AGTCACCTGCTGCAGCTGGAAGG - Intergenic
1075467011 10:122659036-122659058 CCTCCACTCATGAAGCTGGAAGG + Intergenic
1075469909 10:122680245-122680267 CCTCCACCCTTGAAGCTGGAAGG + Intergenic
1076831368 10:132996079-132996101 CCTCACCTCTGACCCCTGGAGGG + Intergenic
1077167961 11:1152247-1152269 CCTCTCCTGATGCTGCTGGAGGG + Intergenic
1077387691 11:2278853-2278875 CCTCTCCTCTTCCAGCAGGCTGG - Intergenic
1078061583 11:8049254-8049276 CCTCAGCTCTTCCTACTGGATGG - Intronic
1078625167 11:12948704-12948726 CCTCAGCCCATGCAGCTGGAGGG - Intergenic
1079367837 11:19824703-19824725 CCTCACCCCATGCAGCTAAAAGG + Intronic
1081015425 11:37872226-37872248 CCCCACCCCTTTCAGCAGGATGG + Intergenic
1081549799 11:44100651-44100673 CCGCATCTCCTGCAGCTGGAGGG + Intronic
1081611204 11:44564699-44564721 CCTCACCTCAGGCAGCTGCTGGG + Intronic
1082925970 11:58547645-58547667 CCTCGCCTCCTGCAGCTTGAAGG + Intronic
1083315495 11:61812553-61812575 CTGCACATCTTGCTGCTGGATGG - Exonic
1083528581 11:63396129-63396151 CCTTTTCTCTTGCAGCTGGGAGG - Intronic
1084176492 11:67424970-67424992 CCTCTCCTCTTGTAGATGGCAGG - Exonic
1085703486 11:78765398-78765420 CCTCATCTCTTATTGCTGGAAGG - Intronic
1086462175 11:87016946-87016968 CCTCCTCTCTTGGAGGTGGAAGG - Intergenic
1088206367 11:107397231-107397253 CCTTTTCTCTCGCAGCTGGAAGG + Intronic
1088649408 11:111944146-111944168 CCTCATCTTCTGCTGCTGGAGGG + Intronic
1089164976 11:116468851-116468873 CCTCACCTATTAGAGTTGGAAGG + Intergenic
1089416425 11:118296010-118296032 CCTCATCTCCTGCAGCTAGAGGG + Intergenic
1089625515 11:119748529-119748551 CCTCACCTGGCCCAGCTGGAGGG + Intergenic
1090173419 11:124625450-124625472 GCTTATCTCTTGCATCTGGACGG - Intronic
1090433346 11:126665114-126665136 CCTCACCTCAGGCAGGTGGAAGG - Intronic
1091196027 11:133731348-133731370 CCTCACCTCCTCCACCTGAAGGG + Intergenic
1093905791 12:24690642-24690664 CCTCTCCCATTGCACCTGGAGGG - Intergenic
1095672471 12:44876653-44876675 CCTTGCCTCCTGCAGCTGGGTGG - Exonic
1097083844 12:56453249-56453271 CCTCTCCACTTGCTGCTGGCTGG - Intronic
1097631004 12:62062322-62062344 TCACACTTCTTGCATCTGGAGGG + Intronic
1098985522 12:77007777-77007799 CCTCACCTCTTAAACCTGGCTGG - Intergenic
1100647908 12:96550860-96550882 CCTCATCTCTTGTCCCTGGATGG - Intronic
1101672351 12:106887498-106887520 CATCTCCTCTGGCAGCTGAAAGG - Intronic
1101828631 12:108240322-108240344 CCTCACCTCTGGCTGCGGGAAGG + Exonic
1101853703 12:108424790-108424812 CCTCATCTTCTGTAGCTGGAAGG - Intergenic
1102347696 12:112170099-112170121 CCTGACCCCATGCAGCTGGGTGG + Intronic
1102721343 12:115019031-115019053 CTTCACTCCTTGCAGCTGAATGG + Intergenic
1102951510 12:117034619-117034641 CCTCAACTCTAGCAGCCTGAAGG - Intergenic
1104523079 12:129493706-129493728 CCTCACCACATGCAGGAGGAAGG + Intronic
1104713138 12:130998801-130998823 CCTGTCCACTAGCAGCTGGACGG + Intronic
1106765513 13:32909461-32909483 CTCCACCTCTTGAATCTGGAAGG - Intergenic
1111452850 13:88441545-88441567 CCTTATCTCCTGCAGCTGCAGGG + Intergenic
1111912658 13:94329355-94329377 CCTCACATCTTCCACCTCGAAGG + Intronic
1113456016 13:110449671-110449693 GGTCACCTCTGGCACCTGGAAGG - Exonic
1116914273 14:50507237-50507259 ACTCACCCCTGGCAGCAGGATGG - Intronic
1117102165 14:52360959-52360981 CCCCACCTCTTGTATCTGGTCGG - Intergenic
1118206292 14:63727260-63727282 CCTCACCTATGGCCGCTGGCAGG - Exonic
1118245952 14:64110892-64110914 CCTCAGCTCTTGAAGCTGTATGG + Intronic
1121429699 14:93878290-93878312 GCAAACTTCTTGCAGCTGGAAGG + Intergenic
1122305798 14:100765674-100765696 TCTCATCTCCTGCAGCTGGAGGG - Intergenic
1123012238 14:105355055-105355077 CCTCACTTCTTGAAGAGGGAAGG + Exonic
1126572664 15:50168747-50168769 CCTTTTCTCTTGCAGCTGGTAGG + Intronic
1126807489 15:52366047-52366069 CCTCACCTCTCCTAGCTGAAGGG - Intronic
1127855271 15:62948874-62948896 CCTCACCCCTTGCAGTTAGATGG - Intergenic
1127977253 15:64006824-64006846 CCTCACCTCCTCCAGCTGCCAGG - Intronic
1128522064 15:68381958-68381980 CCCCACCTCTGGGAGGTGGATGG + Intronic
1128566098 15:68701083-68701105 CAATACCTCTTGGAGCTGGAAGG + Intronic
1128666930 15:69545157-69545179 CCTCACCCCTAGGAGATGGAGGG + Intergenic
1131430831 15:92387665-92387687 CCGCATCCCTTGCAGCTGGCGGG + Intergenic
1132577697 16:671539-671561 CCTCCCCTATCGCAGCTGCAAGG + Intronic
1133287859 16:4698794-4698816 ACTCACCTTGTGCAGCTGGATGG + Exonic
1133773645 16:8882259-8882281 CCTCACTTCCTGCAGGAGGAGGG - Intergenic
1134200068 16:12190746-12190768 CCCCTCCTCTTGCAGCTGTCAGG - Intronic
1135422194 16:22313048-22313070 CCACATCCCTTGCAGCGGGAGGG + Intronic
1137734213 16:50712077-50712099 CCTCACCCGGTGCAGCTGGCGGG - Exonic
1140941821 16:79728685-79728707 TCTCATCACTTGGAGCTGGAGGG - Intergenic
1141421831 16:83922539-83922561 CCCCACCACTTCCAGCTGGGTGG + Exonic
1141746201 16:85928062-85928084 TCTCAACTCGTGCAGATGGAGGG + Intergenic
1142480109 17:213850-213872 CCTCAGCCCAGGCAGCTGGAGGG + Exonic
1142883200 17:2896787-2896809 CCTCATCTAATGCACCTGGAGGG + Intronic
1143662735 17:8336749-8336771 TCTCCCCTCCAGCAGCTGGAGGG + Intergenic
1144366043 17:14545799-14545821 CCTCACCTACTGCAGATGGGAGG + Intergenic
1146316321 17:31809930-31809952 CCTCATTCCTTGCAGCTGAATGG + Intergenic
1146686196 17:34843097-34843119 CCTCACCTCCCGTAGCAGGACGG - Intergenic
1146885095 17:36465098-36465120 CCTGCCCTCCCGCAGCTGGAAGG - Intergenic
1148124820 17:45231222-45231244 CCGCAGCCCTTGAAGCTGGAGGG - Intronic
1148462320 17:47845875-47845897 CCACAGCCCTTGCAGCCGGAGGG - Exonic
1148779607 17:50113937-50113959 CCGCAGCTGCTGCAGCTGGACGG - Exonic
1149031236 17:52084930-52084952 CCTCACCTCTTCCAGCAAGCCGG + Intronic
1150131908 17:62674102-62674124 CCTGCCTTCTTGCAGATGGATGG - Exonic
1152296650 17:79471176-79471198 CCTGGCCTCTTCCAGCAGGAGGG - Intronic
1152695405 17:81741504-81741526 CCTCCCCTTTTGCAGGAGGATGG + Intergenic
1152950378 17:83226929-83226951 CCTCTCCACATGCAGCCGGAAGG + Intergenic
1154063467 18:11084965-11084987 CTTCACCTCCTTCACCTGGAAGG + Intronic
1155293239 18:24362106-24362128 CCTAACATCTTGCAGCTGGAAGG - Intronic
1155740974 18:29287170-29287192 TTTCATCTCCTGCAGCTGGAGGG - Intergenic
1156281659 18:35645175-35645197 CTTCACCTCTTGCACCTGTTGGG + Intronic
1156482920 18:37447504-37447526 CTTCCTCTCCTGCAGCTGGAGGG + Intronic
1156499278 18:37546841-37546863 CCTCACCCCTTGCAGCCAGCTGG + Intronic
1157194053 18:45606054-45606076 CCTCCCCGCCTCCAGCTGGATGG - Intronic
1158025040 18:52886060-52886082 CCTCACCTCAAGCAGAAGGAAGG + Intronic
1159731432 18:72033170-72033192 CCTCTCCTCAAGCAGATGGAAGG + Intergenic
1160370423 18:78368446-78368468 CCTCTCCTATTGCAGATGGGAGG + Intergenic
1160546302 18:79658457-79658479 CCAAATCTCTTGCTGCTGGAGGG + Intergenic
1161074116 19:2276625-2276647 ACTGACCTCCTGCTGCTGGAGGG - Intronic
1162367505 19:10258347-10258369 CCCCACCTCTAGCAGCTGTCTGG - Intronic
1162693080 19:12449839-12449861 CCTCACCTCAAGCAGAAGGAAGG + Intronic
1163129970 19:15266204-15266226 CCTCACTTTTTGCAGCTGGTTGG - Intronic
1164764255 19:30751551-30751573 CCTCATCTCTTACAGTAGGAGGG - Intergenic
1165936004 19:39389474-39389496 ACTCACCTCTTGGAGCTGGTGGG + Exonic
1166656739 19:44617889-44617911 CCTTACCTTTTGCTGCTGGTTGG - Intronic
925130170 2:1488824-1488846 CCTCACCAGTGGCATCTGGAAGG + Intronic
925184785 2:1839580-1839602 CCTGACCCATTGCAGATGGAAGG + Intronic
925219986 2:2131192-2131214 GCTCACCTCGTGCAGCTCGGAGG + Intronic
925262106 2:2537928-2537950 CCTCACCTCCTTCATCTGGTTGG + Intergenic
926149094 2:10414790-10414812 CCTCACTCCTTTCAGCTGAAAGG - Intronic
926787365 2:16531367-16531389 CCTAAACTCTCGGAGCTGGAAGG - Intergenic
926971731 2:18473552-18473574 CCTCCCCTCTTACCCCTGGAAGG + Intergenic
926991737 2:18687781-18687803 CCTCACCTCAAGCAGAAGGAAGG + Intergenic
928364420 2:30690373-30690395 CCTCACCTCTGCCTGCAGGAAGG - Intergenic
929489883 2:42386593-42386615 CTTCACCCCTTACACCTGGAAGG - Intronic
929774258 2:44918384-44918406 CCCCACCTCTGGAATCTGGACGG + Intergenic
930651677 2:53970578-53970600 CCACAGCTCTTGGAGCTGCACGG + Exonic
932497528 2:72153750-72153772 CCCCACCCCTTGCAGCTTCAGGG + Intergenic
932623019 2:73277228-73277250 CCTCAGCTCCAGCAGATGGAGGG - Intronic
933298117 2:80513744-80513766 TCTCCTCTCTTGCAGTTGGATGG - Intronic
933968506 2:87450848-87450870 CCTGACCTCTTAAAGCTGCAGGG + Intergenic
936325286 2:111499656-111499678 CCTGACCTCTTAAAGCTGCAGGG - Intergenic
937245528 2:120489784-120489806 CCTCAACTGTTAGAGCTGGAGGG + Intergenic
940009354 2:149038421-149038443 CCTCCCCTCTTTAAGCTGGGTGG + Intronic
940803331 2:158156851-158156873 CCTCCCATATTGAAGCTGGATGG - Intergenic
941021446 2:160411103-160411125 CCTCACCTCACTCAGCTGGTAGG + Intronic
941065207 2:160893841-160893863 GCTTAGCTCTTGCAGCTAGATGG + Intergenic
943212110 2:184980193-184980215 CCTCATCTCCTGCAGCTGCAGGG + Intergenic
944108074 2:196101048-196101070 CCTCACCTCTGGCACAAGGAAGG - Intergenic
948855026 2:240726108-240726130 AGTCACCTCTTGCACTTGGAAGG + Intronic
1169906661 20:10611525-10611547 CCTCACCTCCCCCTGCTGGAAGG - Intronic
1172318023 20:33971516-33971538 CCTCACCTAGGGCAGCAGGAAGG + Intergenic
1174170911 20:48617770-48617792 CCGCAGTTCTGGCAGCTGGAGGG + Intergenic
1174548295 20:51343025-51343047 CCTCACCTCTTGGTTCTGCATGG - Intergenic
1175138200 20:56840676-56840698 CCTCACCTCATGCAGATTGCAGG - Intergenic
1177095082 21:16822765-16822787 CCTAATCTCCTGTAGCTGGAAGG + Intergenic
1178465594 21:32844541-32844563 GTTCACCTCTTCCACCTGGATGG - Intergenic
1178807297 21:35850394-35850416 GATCCCCTCTTGCAGTTGGAAGG - Intronic
1180140000 21:45887475-45887497 CCACACCTCATTCAGTTGGAGGG + Intronic
1180146569 21:45923327-45923349 CTGCACCACTTGCAGCTGCAAGG - Intronic
1180963007 22:19770801-19770823 CCTCACCTCTCACTGGTGGAGGG + Intronic
1181173580 22:21023585-21023607 GCTCTTCTCCTGCAGCTGGAAGG - Exonic
1181685590 22:24525624-24525646 CACCACCTCTTGCCACTGGAGGG - Intronic
1182361972 22:29752053-29752075 CCACACCTCTTGGGGCTTGAAGG - Intronic
1183745329 22:39688458-39688480 CCTGAGCTCTCGCAGTTGGAGGG + Exonic
1184483151 22:44759844-44759866 CCTCACCTCTTGCAGCTGGAGGG + Intronic
1184829647 22:46976375-46976397 CCTCAACTCTTGCTCCTGGGAGG - Intronic
949115367 3:314818-314840 CCTCACTTCTTGAATCTGGTAGG - Intronic
951699239 3:25478212-25478234 CCCCTCCTCTTGTACCTGGATGG - Intronic
952212761 3:31245741-31245763 CCTGACCTCTTGGAGCCGGCTGG - Intergenic
953809825 3:46102620-46102642 CCTCACCTCTTGAACTTGGGCGG - Intergenic
956045807 3:65194560-65194582 CCTCCCCTCTCCCAGTTGGATGG - Intergenic
958610286 3:96416369-96416391 CCCCACCTCTTTTAGCTAGATGG - Intergenic
959120424 3:102225669-102225691 CATCCCATCTTACAGCTGGAAGG + Intronic
960707390 3:120494091-120494113 CCCCACCTCTTGCAATTGGTGGG + Intergenic
961781520 3:129323488-129323510 CCTCATCTCTGGGAGCTGGGTGG - Intergenic
963852660 3:150223941-150223963 CTTCATCTCCTGCAGCTGGAAGG + Intergenic
966836479 3:184053202-184053224 ACTCACCTCTAGCACTTGGAGGG + Intronic
967399892 3:189049209-189049231 CCTTTTCTCTTGCAGCTGGGAGG + Intronic
967547474 3:190748903-190748925 CCTCATCTCTTGCAGCTACAAGG - Intergenic
968577987 4:1376808-1376830 CCTCAGCTCCTGCCGCAGGACGG + Intronic
969698107 4:8747431-8747453 CCCCAACTCATGCAGGTGGAGGG - Intergenic
970070092 4:12148396-12148418 CCTCACCTCATCCTCCTGGAAGG + Intergenic
970404433 4:15748654-15748676 CCTCACCCCCTGCAGCCAGAGGG - Intergenic
971402923 4:26293271-26293293 CCCCATCTCTTGCATCTGGAAGG + Intronic
972750519 4:41983095-41983117 CCTTACCCCTGGCAGCCGGATGG - Exonic
973298323 4:48551980-48552002 TCTTGCCTCTTGCAGCTGGGTGG + Intronic
974237540 4:59201020-59201042 CCTCTTCTCTTGCTTCTGGATGG + Intergenic
975199610 4:71570977-71570999 CCTCCTCTCTTGGAGGTGGAAGG - Exonic
978633651 4:110777914-110777936 CCTAACCTCTTGAATCTGGGTGG - Intergenic
978827092 4:113038627-113038649 CTTCACCCCTTGAATCTGGAAGG + Intronic
982662008 4:158218528-158218550 CCTTTCCTCTTGCCCCTGGATGG + Intronic
985101115 4:186459575-186459597 CCCTATTTCTTGCAGCTGGAAGG + Intronic
986315463 5:6583595-6583617 CCTCTCCTCTGCCACCTGGAAGG - Intergenic
987450892 5:18082937-18082959 CTTAATTTCTTGCAGCTGGAGGG + Intergenic
991256689 5:64622052-64622074 CCTCATCTTCTGTAGCTGGAGGG - Intergenic
991550020 5:67825699-67825721 ACTCACATCTTGCAGGTGGGAGG - Intergenic
995244487 5:109920944-109920966 CATTACCTCTTGCAGTTGGTTGG + Intergenic
995507221 5:112872985-112873007 TCTGACCTCTTGTAGCTGAAGGG + Intronic
995730659 5:115237857-115237879 CCTCCCATCTTCCAGCTGAAGGG + Exonic
996081298 5:119261170-119261192 CCTCCCCTCTTAAAGCTGGATGG - Intergenic
996409819 5:123145497-123145519 CCTCATCTCTTGGATCTTGATGG + Intronic
996968229 5:129331208-129331230 CCTCACCTCAAGCAGAAGGAAGG - Intergenic
998130578 5:139649329-139649351 CCTCACCTCTTGGCGTTGGGCGG + Intronic
999535026 5:152506648-152506670 CCTCATCTCCTGCAGCTAGAGGG - Intergenic
1001043309 5:168352503-168352525 CCTTAGGTCCTGCAGCTGGAAGG - Intronic
1001073674 5:168607836-168607858 CCTCATCGCCTGCAGCTAGAGGG - Intergenic
1002744611 5:181460744-181460766 CCTCTCCACATGCAGCAGGAAGG + Intergenic
1005099117 6:22150267-22150289 CCTCCCCTCATGCATCTTGAGGG - Intergenic
1007218675 6:40261528-40261550 CCTTGCTTCTTGGAGCTGGAAGG + Intergenic
1007636742 6:43304178-43304200 CCTCGTCTCTGGCAGCAGGAGGG - Exonic
1010830606 6:80523743-80523765 CAACACCGCTTGCAGTTGGAAGG + Intergenic
1013633586 6:112008308-112008330 CCTGACCTCCTGGAGCAGGATGG + Intergenic
1014603848 6:123448301-123448323 CCTTTTCTTTTGCAGCTGGAAGG + Intronic
1014787876 6:125638803-125638825 CCTAATCTCTTGCAGCTGGAGGG - Intergenic
1015241096 6:131024421-131024443 GGGAACCTCTTGCAGCTGGAAGG - Intronic
1015259353 6:131217331-131217353 CGCCACCTGCTGCAGCTGGATGG + Intronic
1015338082 6:132064665-132064687 CCTCAACTCTAGCTGCGGGATGG + Intergenic
1015902595 6:138083191-138083213 CATTACCTCCTGCAGCTGTAGGG + Intergenic
1015937835 6:138420478-138420500 CCACACTCCTTGCAGCTGGATGG - Exonic
1016425599 6:143933303-143933325 CCTCTACTATTGCAGCTGGCTGG - Intronic
1016758660 6:147714501-147714523 CCTCCCCTCTTCCAGGTAGAAGG - Intronic
1017907992 6:158769898-158769920 CCTCTCCTCCTCCAGCTGCAGGG + Exonic
1018903037 6:168060636-168060658 CCTCACGTCTGGCCACTGGAGGG + Intronic
1018907511 6:168084075-168084097 CCTCACAACTTGCACCTGGGAGG - Intergenic
1019211004 6:170404819-170404841 CCTCTGCTGTTGCAGCTGCAAGG + Exonic
1019249521 6:170734285-170734307 CCTCTCCACATGCAGCCGGAAGG + Intergenic
1024186084 7:46949414-46949436 CCTCACCTCCAGCAGAGGGAGGG + Intergenic
1024735225 7:52297005-52297027 CCTCTCCCCTTACAGCTTGAAGG - Intergenic
1026953049 7:74360254-74360276 CCTCTCCTCCTCCAGCTGGTTGG - Exonic
1027329797 7:77079800-77079822 CCCCACCTCCTGAAGCAGGAAGG - Intergenic
1029136263 7:98374449-98374471 CCCCACCTCTCGCTGCTGGTAGG - Intronic
1032084280 7:128875694-128875716 ACTCGCCTCTTGCTGATGGACGG - Intronic
1032470419 7:132174610-132174632 CCCCACCTCTTCCAGAGGGATGG + Intronic
1032783987 7:135186308-135186330 CCTGTCCTCTTGCAGCTGGGTGG - Exonic
1033759310 7:144422731-144422753 CCCCTCCTCCTGCAGCTTGAAGG + Intergenic
1035115403 7:156519260-156519282 CGTCTCCTCTTGCAAATGGATGG - Intergenic
1035498575 8:73371-73393 CCTCTCCACATGCAGCCGGAAGG - Intronic
1035994499 8:4530967-4530989 CCTCACATCTTGGTGCCGGAGGG - Intronic
1036738792 8:11343152-11343174 CCTCTACTCCTGCAACTGGAAGG + Intergenic
1039474784 8:37833959-37833981 CATCACCTCTACCAGCTGGGGGG - Exonic
1041321791 8:56621389-56621411 CTTAACCTCTTGGAGCAGGAGGG - Intergenic
1041381418 8:57257951-57257973 CCTGCCCTCCTGCAGCTGCAGGG - Intergenic
1042088557 8:65133681-65133703 CCTTTTCTCTTGCAGCTGGGAGG + Intergenic
1044080049 8:87872648-87872670 CCTTACCCCTAGCAGCCGGATGG + Exonic
1044269836 8:90228990-90229012 CACCACCTCATGCAGCTGGCAGG + Intergenic
1045651711 8:104347667-104347689 TCTCACATCTGGCAGTTGGACGG + Intronic
1045651812 8:104348361-104348383 CCTCAACTCTTGGTGGTGGAAGG + Intronic
1047961547 8:130015557-130015579 CTCCACCTCTTGCAGCAGGGTGG + Intronic
1048377940 8:133838752-133838774 CCTCACCTCTTCCTTCTTGATGG - Intergenic
1048707097 8:137165983-137166005 TCTCATCTCCTGCAGCTGTATGG + Intergenic
1049166897 8:141131837-141131859 CCTCACCTCCTGCAGCAGACTGG + Intronic
1049501968 8:142971733-142971755 CCTGACCTCCTGCAGGTGGTGGG - Intergenic
1049693940 8:143974594-143974616 CCTGACCTGTTCCAGCCGGAGGG - Intronic
1049706993 8:144047623-144047645 CCTCAGCTCCTGCAGCAGGTGGG - Intergenic
1052518372 9:29511842-29511864 CCTCTCTACTTGCAGCTGAAAGG + Intergenic
1055401525 9:75929559-75929581 CCTCCCCTACTGCAGCTGGAGGG - Intronic
1056788098 9:89606688-89606710 CCTCCCCTCTGGCAGAGGGAGGG + Intergenic
1058181265 9:101803052-101803074 CCACAGCTCTTGCAGCAGTAGGG - Intergenic
1059411490 9:114135122-114135144 CCTCACCCCTAGCTGCTGAAGGG + Intergenic
1060585008 9:124780340-124780362 CCCCACCCCTTGATGCTGGAGGG - Intronic
1061366716 9:130175783-130175805 CCTAACCTGTTGCTGGTGGAAGG - Intronic
1061476621 9:130871811-130871833 CCCCACCTCTTGGAGCTCGTGGG - Intronic
1061877740 9:133553358-133553380 CCTCGTGTCCTGCAGCTGGAAGG - Intronic
1062136909 9:134933945-134933967 CCTCACCTTTTGTAGCTGGTAGG - Intergenic
1062137104 9:134934976-134934998 CCTCACCTTTTCTAGCTGGTAGG - Intergenic
1203610421 Un_KI270748v1:91223-91245 CCTCTCCACATGCAGCCGGAAGG + Intergenic
1187128990 X:16482571-16482593 CCTCACCTCTTGATGGGGGAGGG - Intergenic
1189996373 X:46642718-46642740 CCTCACCTGTTGCAGTTTCATGG - Intronic
1190015049 X:46819600-46819622 CCTCTCCTCAAGCAGATGGAAGG - Intergenic
1190115820 X:47625913-47625935 CCCCACTTCCTGCAGCTGGGAGG + Intronic
1190634043 X:52417312-52417334 CCCCCTCTCTTGCAGTTGGAGGG - Intergenic
1190650699 X:52565824-52565846 CCAGTTCTCTTGCAGCTGGAGGG + Intergenic
1193779693 X:85686485-85686507 CCTTTTCTCTTGCAGCTGGGAGG - Intergenic
1194870481 X:99125532-99125554 CCTTATCTCTTGTAGCTGCAAGG + Intergenic
1196153971 X:112406743-112406765 CCTCTCCTCAAGCAGATGGAAGG - Intergenic
1196164699 X:112526054-112526076 CCTCAACTCTAGCAGCAGGGAGG - Intergenic
1196652133 X:118178645-118178667 TCTCACCCCTTGCAGGTGGGAGG + Intergenic
1198569441 X:137939494-137939516 ACTCATTTCTTTCAGCTGGAAGG + Intergenic
1198918770 X:141701804-141701826 TATCACATCTTGAAGCTGGAAGG + Intergenic
1199198177 X:145057015-145057037 TCTCATCTCCTGCAGCTGAAGGG + Intergenic
1200058623 X:153474292-153474314 CCTCACCTCCTGCAGTTGAGGGG + Intronic