ID: 1184485687

View in Genome Browser
Species Human (GRCh38)
Location 22:44777517-44777539
Sequence CTGAGCAGGGTCACTCTGTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 149}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184485687 Original CRISPR CTGAGCAGGGTCACTCTGTT GGG Intronic
900252161 1:1676599-1676621 CTCAGCTGGGGCTCTCTGTTTGG - Exonic
900262571 1:1739457-1739479 CTCAGCTGGGGCTCTCTGTTTGG - Exonic
901862683 1:12084957-12084979 ATGACCAGGGTCACACAGTTGGG + Intronic
902816697 1:18920607-18920629 CTGAGCAGGCTCTCTGTGGTGGG - Intronic
904052212 1:27646519-27646541 CTGAGTATGGGCGCTCTGTTGGG + Intergenic
905937467 1:41836259-41836281 CTCAGCAGGGACAGTCTGCTTGG - Intronic
906518641 1:46454260-46454282 CTCAGGAAGATCACTCTGTTAGG - Intergenic
906645200 1:47469865-47469887 CAGCCCAGGGTGACTCTGTTGGG - Intergenic
907268362 1:53276287-53276309 CTGGGCTGGGTCCCTCTGCTGGG - Intronic
908044832 1:60157382-60157404 CTCAGCAGGCTCACTCAGTGTGG - Intergenic
908320372 1:62972659-62972681 AGGGCCAGGGTCACTCTGTTGGG - Intergenic
909519884 1:76555509-76555531 ATGACCAGGTTCACTTTGTTTGG - Intronic
910118497 1:83758636-83758658 AAGAGCAGGATCACTCTGGTGGG + Intergenic
914286987 1:146236280-146236302 TTCAGCAGGGTCACCCTGTTTGG - Intergenic
914548019 1:148687022-148687044 TTCAGCAGGGTCACCCTGTTTGG - Intergenic
916710715 1:167404721-167404743 CTGAGCTGGGACTCTCTGTGAGG + Intronic
918295047 1:183148655-183148677 CTGACCATGGTCTCTGTGTTGGG + Intergenic
918929162 1:190831866-190831888 CTAAGCTGGGTTACTCTTTTAGG - Intergenic
918964858 1:191330334-191330356 TTGAGCACGGTCTCTCTGTCTGG + Intergenic
919448644 1:197742974-197742996 CTCAGAAAGGTCACACTGTTAGG + Intronic
1063949445 10:11208496-11208518 CTGAGCAGGGACACTCGGCAAGG + Intronic
1064261788 10:13792108-13792130 CTGTGCAGGGGCACTCTGCCAGG + Intronic
1064555300 10:16541637-16541659 CTGTTCAGGGTCTCTCTGTAGGG - Intergenic
1065869200 10:29941610-29941632 CTCAGAAGGGTCCCTCAGTTGGG - Intergenic
1069290058 10:66767809-66767831 CTGAGCAAGCTCACTATTTTGGG - Intronic
1070421298 10:76239839-76239861 CTGATCATGGTAACTCTGTGAGG + Intronic
1072317219 10:94214824-94214846 CTGAGCAGGGTCACGATGTTTGG - Intronic
1076540790 10:131213533-131213555 CTCAGCTGGGCCACTCTGTCTGG + Intronic
1078059819 11:8035975-8035997 CTGAGCAGGGTCTGTCAGTAGGG + Intronic
1087056836 11:93945091-93945113 TTCAGCAGGGTCACCCTGTTTGG + Intergenic
1088775246 11:113076149-113076171 CTGACCAGGGACACTGAGTTTGG - Intronic
1088817575 11:113432195-113432217 GTGAAAAGGGTCAATCTGTTAGG + Intronic
1090136743 11:124207309-124207331 CTGAGCATGATCACTCTAATAGG + Intergenic
1090938314 11:131365235-131365257 CTGAGCATGGTCACTTTGGATGG - Intergenic
1091355849 11:134937166-134937188 CTGAGCTGGCTCACTGTGCTCGG + Intergenic
1091355858 11:134937223-134937245 CTGAGCAGGCTCACCGTGCTCGG + Intergenic
1091355868 11:134937280-134937302 CTGAGCTGGCTCACTGTGCTCGG + Intergenic
1091355901 11:134937517-134937539 CTGAGCAGGCTCACCATGCTCGG + Intergenic
1091355911 11:134937574-134937596 CTGAGCTGGCTCACTGTGCTCGG + Intergenic
1096547343 12:52349581-52349603 CTGTGCAGGGTCTCACTCTTTGG - Intergenic
1099232212 12:80039989-80040011 CTGAACAGGGACTCTCTATTTGG - Intergenic
1100823863 12:98456889-98456911 GTGAGCAGGCTCACACTGTCTGG + Intergenic
1101590259 12:106119304-106119326 CTGGTCGGGGTCACTCAGTTAGG - Intronic
1103000478 12:117381980-117382002 TTCAGCTGGGTCACTCTATTCGG - Intronic
1104042872 12:125141888-125141910 CTGACCACTGTCTCTCTGTTTGG - Intronic
1107739859 13:43438277-43438299 CTGAGGAGGGTAAATCTATTTGG + Intronic
1108592661 13:51924681-51924703 CTGAGTGGGGCCACACTGTTTGG - Intergenic
1115469774 14:33756438-33756460 CTGAGCAGTCTCAATCTGTCTGG - Intronic
1116797660 14:49409225-49409247 ATGAGCAGAGTTACTCTGATGGG + Intergenic
1123050210 14:105537809-105537831 CTGAGTGGGGTCTCTCTGTGTGG - Intergenic
1202839343 14_GL000009v2_random:107004-107026 CTGTGTAGGGTCTCTCTGTAAGG - Intergenic
1202908721 14_GL000194v1_random:97157-97179 CTGTGTAGGGTCTCTCTGTAAGG - Intergenic
1123849806 15:24343188-24343210 CCTAGCAGGGTCACTCTTTTTGG - Intergenic
1124236042 15:27990122-27990144 CTGAGCAGGGCCTCTCTGGCAGG - Intronic
1128340674 15:66820670-66820692 CTGAGCAGGGACCCTGTGCTGGG - Intergenic
1129046609 15:72740267-72740289 GTGTGCAGGGTCAGTCTTTTGGG + Intergenic
1129455874 15:75675989-75676011 CTGAGCAGGGCCACGCTGTAGGG + Exonic
1129813110 15:78526785-78526807 CTGTGCAGGATCTCTCAGTTTGG - Intronic
1135629821 16:24027348-24027370 CAGAGCAGGGGGACTCTGATAGG + Intronic
1136279895 16:29202184-29202206 CTGAGCAGAGCCAGGCTGTTGGG + Intergenic
1136279925 16:29202354-29202376 CTGAGCAGAGCCAGGCTGTTGGG + Intergenic
1141909354 16:87047975-87047997 GTGTGCAGGGCCCCTCTGTTTGG - Intergenic
1142084287 16:88168292-88168314 CTGAGCAGAGCCAGGCTGTTGGG + Intergenic
1142854448 17:2722089-2722111 GTGAACAGGGTGACTTTGTTAGG - Intergenic
1145262067 17:21360432-21360454 CAGCTCAGGGTCACTATGTTGGG - Intergenic
1145870679 17:28270782-28270804 CTGACCTGGGTCCCCCTGTTGGG + Intergenic
1146812525 17:35915286-35915308 CTGAGCTGGGGCCCTGTGTTTGG + Intergenic
1147312463 17:39603647-39603669 ATGTCCAGGGTCCCTCTGTTTGG + Intronic
1148619233 17:49022191-49022213 CTGAGCTGGGGCAGTGTGTTGGG - Intronic
1149974493 17:61252320-61252342 CTTAGCAGGGTCTCTCTGAATGG + Intronic
1150281286 17:63930985-63931007 CAGTGCAGGGTCACTATGTGAGG - Intronic
1151931943 17:77237972-77237994 CTGTGCAGGGTCATTCTCTGCGG + Intergenic
1154312407 18:13277433-13277455 CAGAGCATGCTCACTCAGTTGGG + Intronic
1157181212 18:45499946-45499968 CAGAGCAGGCTCACTCTGTTTGG - Intronic
1162056722 19:8068897-8068919 CTGAGCAAGGTCCCTCAGCTGGG - Intronic
1165154821 19:33780655-33780677 CTGAAGAGGGTCCCTCTGTGGGG - Intergenic
1167242015 19:48349695-48349717 CTGAGCAGGGCCACCCTGTGTGG + Intronic
1168393311 19:56028229-56028251 CTGCACTGGGTCTCTCTGTTGGG + Exonic
1202633691 1_KI270706v1_random:23531-23553 CTGTGTAGGGTCTCTCTGTAAGG + Intergenic
1202652190 1_KI270707v1_random:16523-16545 CTGTGTAGGGTCTCTCTGTAAGG - Intergenic
930528175 2:52558073-52558095 CTGGGGAAGGTCACTGTGTTAGG + Intergenic
931632879 2:64317074-64317096 CTGCACAAGGTCACACTGTTGGG - Intergenic
934112648 2:88757181-88757203 CTGCCCAGGGCCTCTCTGTTAGG + Intergenic
936979843 2:118254410-118254432 TTGAGCTGTGTGACTCTGTTGGG - Intergenic
937222534 2:120349966-120349988 CTGAGTACAGTCATTCTGTTGGG + Exonic
939297945 2:140294568-140294590 CTGAGCAGAGTCACAATGTCAGG + Intronic
945539699 2:211069763-211069785 CTGAGAAAGTTCACTCTGCTTGG - Intergenic
948013023 2:234665011-234665033 CTGAGCAGTGTCACTCAGATGGG - Intergenic
948480679 2:238248254-238248276 CTGAGAAGTGACACTGTGTTCGG + Intronic
1172230207 20:33331327-33331349 CAGCGCAGGGTCTCTCTGTGTGG - Intergenic
1173706381 20:45113410-45113432 CTGCGCAGGGCCACTCTGCATGG - Intronic
1174049361 20:47757129-47757151 CGGAGCAGGGTCCCTGGGTTAGG - Intronic
1176599963 21:8783131-8783153 CTGTGTAGGGTCTCTCTGTAAGG + Intergenic
1176628079 21:9111820-9111842 CTGTGTAGGGTCTCTCTGTAAGG - Intergenic
1176645906 21:9349388-9349410 CTGTGTAGGGTCTCTCTGTAAGG + Intergenic
1177716108 21:24841371-24841393 CCCAGCAGGGTTATTCTGTTTGG - Intergenic
1177729494 21:25009423-25009445 CTGAGCAAGTTGACCCTGTTAGG - Intergenic
1179449849 21:41461028-41461050 CCCAGCAGGTTCACTCTGCTGGG - Intergenic
1180066509 21:45415194-45415216 CTGCGAAGGGCCACTCTGTGGGG + Intronic
1180367020 22:11949765-11949787 CTGTGTAGGGTCTCTCTGTAAGG - Intergenic
1180379064 22:12121586-12121608 CTGTGTAGGGTCTCTCTGTAAGG + Intergenic
1180960132 22:19758811-19758833 CTGGGCAGCGTCCCTCTGCTGGG + Intronic
1184485687 22:44777517-44777539 CTGAGCAGGGTCACTCTGTTGGG + Intronic
949144778 3:685478-685500 CTAATCAGTGTCACTATGTTTGG - Intergenic
950188478 3:10960106-10960128 CTGTGCAGGGCCACACTGTGTGG - Intergenic
950535102 3:13574102-13574124 CTCAACACGGTGACTCTGTTAGG - Intronic
950551559 3:13669273-13669295 AGGAGCTGGGTCACTCAGTTTGG + Intergenic
953614714 3:44479194-44479216 TTGAGCAGGTTCTCTGTGTTTGG + Intergenic
954331273 3:49891661-49891683 CTGCTCAGGGTCACTCAGTAAGG + Intronic
961363030 3:126380109-126380131 CTGGGCAGGGTCAGTGTGGTTGG - Intergenic
962115601 3:132503233-132503255 CAGAGCATGGACACTCAGTTTGG - Exonic
1202740979 3_GL000221v1_random:55675-55697 CTGTGTAGGGTCTCTCTGTAAGG - Intergenic
968529798 4:1085582-1085604 CTGTGCTGGGTCACTCTGAGAGG + Intronic
969178060 4:5414968-5414990 CTGACATGTGTCACTCTGTTTGG + Intronic
970603803 4:17660921-17660943 ATGAGAAGGGGCACTCTGCTTGG + Intronic
973533114 4:51852823-51852845 ATGTACAGGGTCACTCAGTTGGG + Intronic
978562095 4:110044092-110044114 CTCAGCTGGGTCTCCCTGTTTGG + Intergenic
979072090 4:116221127-116221149 GTTAACAGGGTCACTCTGTCAGG + Intergenic
981943475 4:150312856-150312878 CTGAGCAGTGTTACTCACTTAGG - Intronic
1202760682 4_GL000008v2_random:107066-107088 CTGTGTAGGGTCTCTCTGTAAGG + Intergenic
985634898 5:1031105-1031127 CTGAGCAGGGTCACCCTCGAGGG - Intronic
987244737 5:16037327-16037349 CTGAGCTGAGTCACTCTCCTTGG - Intergenic
989829310 5:45894065-45894087 CTGAGCTGAGTCTCCCTGTTTGG - Intergenic
995395366 5:111681455-111681477 CTAGGCAGGGGCACTCTATTGGG + Intronic
995939244 5:117559067-117559089 CTGAGCAGATTTACTCTGTGTGG - Intergenic
997717248 5:136051556-136051578 CAGAGCAAGGACACTCTGTTTGG + Intronic
1001024378 5:168211199-168211221 GTGAGCAGGGTCTCTCTCTTGGG + Intronic
1008699824 6:54085624-54085646 CTGTTCAGGCTCACTCTGCTGGG - Intronic
1016320751 6:142843065-142843087 CTGAGGAAGGTCCCTCTCTTGGG - Intronic
1019267684 7:127552-127574 CTGCCCAGGGCCACTCTGTGTGG - Intergenic
1019971051 7:4541124-4541146 CTGAGAAGGGTCACCCTGGATGG - Intergenic
1020466160 7:8482100-8482122 TTCAGCAGTTTCACTCTGTTGGG - Intronic
1021163321 7:17301937-17301959 CTGAGTAGGGTCACTAAGTATGG - Intronic
1022512600 7:30950199-30950221 CTTAGTAGAGTCATTCTGTTGGG - Intronic
1024605517 7:51019589-51019611 CTGAGGATGGTCACTGTGGTAGG + Intronic
1026257348 7:68723975-68723997 CTAAGCAGGATCAGTCTGGTTGG - Intergenic
1029364864 7:100110194-100110216 CTGAGCTGGGACACGATGTTAGG - Exonic
1032660374 7:133977157-133977179 CTTAGCAAGGTCACTCAATTTGG - Intronic
1033426965 7:141253304-141253326 CTGAGCATGCCCACTGTGTTGGG + Intronic
1034413051 7:150951168-150951190 CTGAGCAGGGTCCCTGTGGGTGG - Intronic
1035102448 7:156412492-156412514 CTTAGCACTGTCACTCTGGTGGG - Intergenic
1037404613 8:18528476-18528498 CTCAGCAGGGTCACGCTATCAGG + Exonic
1037406708 8:18550091-18550113 CTGATAAGGGTCACTCTATTGGG - Intronic
1037990629 8:23319319-23319341 CTCAGCTGAGTCACTCTCTTTGG + Intronic
1042131827 8:65594784-65594806 CTGAGCAAGGAGACACTGTTAGG - Intergenic
1043515142 8:80989219-80989241 GTGAGATGGGTCACTGTGTTAGG + Intronic
1050806211 9:9681837-9681859 CTGAGTAGAGTCCCTCTGCTGGG - Intronic
1051614534 9:18994649-18994671 CTCAGCAGGAGCACTCTGCTCGG + Intronic
1057192890 9:93097052-93097074 CAGGGCAGAGTCACCCTGTTTGG - Intronic
1057197202 9:93121721-93121743 CTGTGCAGGGTCCCTGGGTTAGG + Exonic
1060194194 9:121612663-121612685 CTGAGCAGGCTCTCTCTCTAAGG - Intronic
1060538974 9:124416457-124416479 CAGAGCAGGGTTACCCTCTTAGG - Intergenic
1062155723 9:135047097-135047119 CTGAGCAGGGACACCATGGTTGG - Intergenic
1203750922 Un_GL000218v1:79500-79522 CTGTGTAGGGTCTCTCTGTAAGG - Intergenic
1203483063 Un_GL000224v1:24844-24866 CTGTGTAGGGTCTCTCTGTAAGG + Intergenic
1203709618 Un_KI270742v1:85605-85627 CTGTGTAGGGTCTCTCTGTAAGG - Intergenic
1203541453 Un_KI270743v1:91951-91973 CTGTGTAGGGTCTCTCTGTAAGG + Intergenic
1187952843 X:24487657-24487679 ATGAGCTGGATCATTCTGTTGGG + Intronic
1190320892 X:49178656-49178678 ATGAGCAGGGTCAGTCTCTAAGG - Intronic
1193628753 X:83853661-83853683 CTTAGCAGGGTCATTGTGGTGGG - Intergenic
1197051263 X:122061732-122061754 CTGAGAAGTGTCTCTCTGTCAGG - Intergenic
1201164578 Y:11197125-11197147 CTGTGTAGGGTCTCTCTGTAAGG - Intergenic
1202049733 Y:20768003-20768025 CTGAGCAGTGACACTCTGTGGGG + Intronic