ID: 1184486551

View in Genome Browser
Species Human (GRCh38)
Location 22:44783328-44783350
Sequence CTGTCCACACAGAGGCAGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 406
Summary {0: 1, 1: 1, 2: 4, 3: 42, 4: 358}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184486536_1184486551 9 Left 1184486536 22:44783296-44783318 CCTCCCCACCCCCGCAGCGGTCC No data
Right 1184486551 22:44783328-44783350 CTGTCCACACAGAGGCAGGCGGG 0: 1
1: 1
2: 4
3: 42
4: 358
1184486543_1184486551 -2 Left 1184486543 22:44783307-44783329 CCGCAGCGGTCCATCCCCGAGCT 0: 1
1: 0
2: 0
3: 4
4: 81
Right 1184486551 22:44783328-44783350 CTGTCCACACAGAGGCAGGCGGG 0: 1
1: 1
2: 4
3: 42
4: 358
1184486532_1184486551 12 Left 1184486532 22:44783293-44783315 CCCCCTCCCCACCCCCGCAGCGG No data
Right 1184486551 22:44783328-44783350 CTGTCCACACAGAGGCAGGCGGG 0: 1
1: 1
2: 4
3: 42
4: 358
1184486537_1184486551 6 Left 1184486537 22:44783299-44783321 CCCCACCCCCGCAGCGGTCCATC 0: 1
1: 0
2: 0
3: 19
4: 129
Right 1184486551 22:44783328-44783350 CTGTCCACACAGAGGCAGGCGGG 0: 1
1: 1
2: 4
3: 42
4: 358
1184486541_1184486551 0 Left 1184486541 22:44783305-44783327 CCCCGCAGCGGTCCATCCCCGAG 0: 1
1: 0
2: 0
3: 3
4: 70
Right 1184486551 22:44783328-44783350 CTGTCCACACAGAGGCAGGCGGG 0: 1
1: 1
2: 4
3: 42
4: 358
1184486542_1184486551 -1 Left 1184486542 22:44783306-44783328 CCCGCAGCGGTCCATCCCCGAGC 0: 1
1: 0
2: 1
3: 13
4: 232
Right 1184486551 22:44783328-44783350 CTGTCCACACAGAGGCAGGCGGG 0: 1
1: 1
2: 4
3: 42
4: 358
1184486534_1184486551 11 Left 1184486534 22:44783294-44783316 CCCCTCCCCACCCCCGCAGCGGT 0: 1
1: 0
2: 7
3: 61
4: 551
Right 1184486551 22:44783328-44783350 CTGTCCACACAGAGGCAGGCGGG 0: 1
1: 1
2: 4
3: 42
4: 358
1184486538_1184486551 5 Left 1184486538 22:44783300-44783322 CCCACCCCCGCAGCGGTCCATCC 0: 1
1: 0
2: 0
3: 12
4: 129
Right 1184486551 22:44783328-44783350 CTGTCCACACAGAGGCAGGCGGG 0: 1
1: 1
2: 4
3: 42
4: 358
1184486539_1184486551 4 Left 1184486539 22:44783301-44783323 CCACCCCCGCAGCGGTCCATCCC 0: 1
1: 0
2: 1
3: 19
4: 206
Right 1184486551 22:44783328-44783350 CTGTCCACACAGAGGCAGGCGGG 0: 1
1: 1
2: 4
3: 42
4: 358
1184486540_1184486551 1 Left 1184486540 22:44783304-44783326 CCCCCGCAGCGGTCCATCCCCGA No data
Right 1184486551 22:44783328-44783350 CTGTCCACACAGAGGCAGGCGGG 0: 1
1: 1
2: 4
3: 42
4: 358
1184486535_1184486551 10 Left 1184486535 22:44783295-44783317 CCCTCCCCACCCCCGCAGCGGTC No data
Right 1184486551 22:44783328-44783350 CTGTCCACACAGAGGCAGGCGGG 0: 1
1: 1
2: 4
3: 42
4: 358
1184486531_1184486551 26 Left 1184486531 22:44783279-44783301 CCACTCTCTGAGTGCCCCCTCCC 0: 1
1: 0
2: 6
3: 71
4: 645
Right 1184486551 22:44783328-44783350 CTGTCCACACAGAGGCAGGCGGG 0: 1
1: 1
2: 4
3: 42
4: 358

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184486551 Original CRISPR CTGTCCACACAGAGGCAGGC GGG Intronic
900457264 1:2783372-2783394 CTATCCACACAGACTGAGGCTGG + Intronic
901005353 1:6169207-6169229 CTGTGCACACACAGGCACACAGG + Intronic
901733158 1:11295013-11295035 CTGCCCACCCCGAGGCAGGAAGG - Intronic
901872266 1:12145055-12145077 CTGTGCCCAGGGAGGCAGGCTGG - Intergenic
902513463 1:16978272-16978294 ATGGCAACAAAGAGGCAGGCCGG + Exonic
902579768 1:17401122-17401144 CTGACCGCAGAGAGGCAGGTGGG + Intronic
902860639 1:19242793-19242815 CTGTCCATTGGGAGGCAGGCAGG - Intronic
903231607 1:21925732-21925754 GTGTCCAGACAGAGGAAGTCTGG - Intronic
903262597 1:22139486-22139508 CGCTGCACTCAGAGGCAGGCCGG - Intronic
903574546 1:24330797-24330819 CAGGGCACACAGAGGCAGGAAGG - Intronic
903592460 1:24467438-24467460 CTGTCCACCCAGACCCAGGCTGG - Intronic
903829647 1:26166935-26166957 ATGTCTACACAGAGGCATGCAGG + Intergenic
904476788 1:30770248-30770270 CCATCCACACAGAAGGAGGCTGG + Intergenic
904585869 1:31580324-31580346 CTGCCCACACAGGTCCAGGCAGG - Intronic
904702493 1:32366193-32366215 CTGTCCATACATAAGCAGGCAGG - Intronic
904746934 1:32717145-32717167 TTGGCCACACAAAGGCACGCTGG - Intergenic
905242449 1:36589651-36589673 CTGTCCACACAGCTTCAGCCAGG - Intergenic
905908778 1:41639643-41639665 CTGACCACAGAGAGGGAGGTGGG - Intronic
907423451 1:54363047-54363069 CTATCCACACTGATGGAGGCTGG - Intronic
907640192 1:56181274-56181296 CTGTGCACAAAGAGAGAGGCAGG + Intergenic
909480228 1:76122410-76122432 ATGTCTGCTCAGAGGCAGGCAGG + Intronic
910485672 1:87710926-87710948 CTGTCAAGACAGAGCCAGGGAGG - Intergenic
912082336 1:105952124-105952146 GTGTGCAGACAGGGGCAGGCAGG - Intergenic
912487300 1:110039343-110039365 CTGCCCACTCAGATGCAGGGAGG + Intronic
913218395 1:116639514-116639536 CAGTCTACACAGAGGCAAGAAGG + Intronic
914330613 1:146666877-146666899 CCAAGCACACAGAGGCAGGCAGG + Intergenic
914463915 1:147909356-147909378 CTGTCCAACCAGAGGCTGGTGGG - Intergenic
915089890 1:153416914-153416936 CTGCCCCCACAGAGGGAGGAGGG + Intronic
915721525 1:157989275-157989297 CTGCCCCAACAGAAGCAGGCAGG - Intergenic
918008315 1:180562717-180562739 GTGTGCACAGAGAGGAAGGCTGG + Intergenic
919349293 1:196428859-196428881 CTGCCCACACATGGGCAGCCAGG + Intronic
919568410 1:199218228-199218250 TTGCCCACAGGGAGGCAGGCAGG - Intergenic
920007215 1:202842195-202842217 ATATACACACACAGGCAGGCAGG - Intergenic
920028963 1:203024590-203024612 CTGTTCACACAGAGTGAGCCTGG + Exonic
920203921 1:204277728-204277750 CTGTCCACACAGAAGAAGGCTGG - Intronic
921325306 1:213982722-213982744 CTGTCCCCACAGCAACAGGCGGG + Intergenic
921482493 1:215679067-215679089 CTGTCCACATGTAGGCAGGCTGG + Intronic
922501023 1:226096982-226097004 CACCCCACACAGAGGTAGGCTGG - Intergenic
923996050 1:239495601-239495623 CTGTTCAAAGAGAGGAAGGCTGG - Intronic
924934533 1:248756861-248756883 ATGTCCACCCAGATGTAGGCTGG + Intergenic
1063148490 10:3317821-3317843 CTGCCCACGCAGAGGCTGCCGGG - Intergenic
1063148508 10:3317889-3317911 CTGCCCACGCAGAGGCTGCCGGG - Intergenic
1063148526 10:3317957-3317979 CTGCCCACGCAGAGGCTGCCGGG - Intergenic
1063148583 10:3318161-3318183 CTGCCCACACAGAGGCTGCCGGG - Intergenic
1063148617 10:3318298-3318320 CTGCCCACACAGAGGCTGCAGGG - Intergenic
1063148653 10:3318435-3318457 CTGCCCACACAGAGGCTGCCGGG - Intergenic
1063148671 10:3318503-3318525 CTGCCCACACAGAGGCTGCCGGG - Intergenic
1063148689 10:3318571-3318593 CTGCCCACACAGAGGCTGCAGGG - Intergenic
1063218338 10:3943916-3943938 CTGTCATCACAGTGGCAGGAAGG + Intergenic
1063377875 10:5564874-5564896 CTGACCCCACAGAGTAAGGCTGG + Intergenic
1063386493 10:5619553-5619575 CCGACCACACAGGGGCAGGTGGG - Intergenic
1063975020 10:11408160-11408182 CTGTGCACACAGAGTGGGGCAGG + Intergenic
1065617692 10:27545770-27545792 CTGGCCACCCCGAGGCAGGTTGG + Intergenic
1066232456 10:33449568-33449590 ATGTGAGCACAGAGGCAGGCAGG + Intergenic
1069909094 10:71749048-71749070 CTCTCCACACAGCAGCAGCCAGG + Exonic
1070085921 10:73237007-73237029 ATGTAAAGACAGAGGCAGGCTGG - Intronic
1070548428 10:77470944-77470966 CTGCCCTCAGAGAGGCAGCCCGG + Intronic
1070949370 10:80418657-80418679 CTAAGCACACAGAAGCAGGCTGG + Intronic
1070955284 10:80459640-80459662 CTGTCAACGCATAGTCAGGCAGG - Intronic
1072575684 10:96698129-96698151 CTGTCCTCACAAAGGCTGCCAGG + Intronic
1072616162 10:97050002-97050024 CTGTACAAACCGAGGCAGCCTGG + Intronic
1072692437 10:97580832-97580854 CTGTCCCCAGAGAGGCTGTCAGG - Intronic
1073435326 10:103512805-103512827 GTGTCCACACTGAGGGAGGCAGG + Intronic
1074671396 10:115796154-115796176 ATCTCCACAGAGAGGCAGCCTGG - Intronic
1076141289 10:128080398-128080420 CTGTGCATAGAGAGGCAGGAAGG + Intronic
1076669666 10:132112561-132112583 CTGTGAACACAGAGCCAAGCGGG - Intronic
1076783035 10:132734972-132734994 AAGGCCACACAGAGGCGGGCAGG + Intronic
1077009400 11:373445-373467 CTGTCCACTCGGAGCCAGTCTGG - Exonic
1077340761 11:2025374-2025396 TGGTCCACACAGAGGCTGGGAGG - Intergenic
1078879533 11:15434349-15434371 CTCTCCTCACAGAGGAAAGCAGG - Intergenic
1083266564 11:61549748-61549770 AGGACCACACAGAGGCAGGCTGG + Intronic
1083323600 11:61862407-61862429 CAGTCCAGCCAGAGGCAGGGAGG + Intronic
1083365729 11:62140537-62140559 CTGCCCACTCAGAGGAAGGGAGG - Intronic
1083624610 11:64065833-64065855 CTCTCCATGCACAGGCAGGCAGG + Intronic
1083714610 11:64568283-64568305 CCATCCCCACACAGGCAGGCTGG + Intronic
1084429209 11:69101971-69101993 GTGTCCCCACAGTGGCTGGCAGG - Intergenic
1084530231 11:69722970-69722992 GTGACCTCACAGGGGCAGGCAGG + Intergenic
1084964716 11:72738611-72738633 CTGTCCCAGCACAGGCAGGCAGG + Intronic
1085644296 11:78213214-78213236 CTGTCCAGATGGAGGCAGGGTGG + Intronic
1087666412 11:101053825-101053847 CTGCCCACACAGAGAAAGGAAGG - Intronic
1088302507 11:108374062-108374084 CTGAGCCTACAGAGGCAGGCAGG - Intronic
1089310809 11:117557017-117557039 CAGTCCACACAGGACCAGGCAGG + Intronic
1089842012 11:121426696-121426718 TTGGCAACACAGAGGCAGTCTGG + Intergenic
1090386597 11:126360977-126360999 CAGACCTCAGAGAGGCAGGCAGG + Intronic
1090634074 11:128678182-128678204 CTGTCCCCACTGGGGCAGGCAGG + Intergenic
1091105014 11:132910291-132910313 ATGCCCCCACAGGGGCAGGCCGG + Intronic
1202823746 11_KI270721v1_random:80563-80585 TGGTCCACACAGAGGCTGGGAGG - Intergenic
1091836732 12:3591377-3591399 CCGTGCACAGAGAAGCAGGCAGG + Intronic
1092934935 12:13351942-13351964 CTGTCATCAAAGGGGCAGGCTGG - Intergenic
1092937563 12:13378245-13378267 CTGTCCACACATAGGAAGGCAGG + Intronic
1092956939 12:13560005-13560027 CATTCCACACAAAGACAGGCTGG - Exonic
1094165491 12:27438726-27438748 ATGGCCACACAGAAGCAAGCTGG + Intergenic
1094725256 12:33107908-33107930 CAGACCCTACAGAGGCAGGCAGG + Intergenic
1096211553 12:49769995-49770017 TTCTCCACATTGAGGCAGGCTGG + Intergenic
1096874071 12:54613730-54613752 CTGTCCACAGAGTGGCTGGAGGG + Intergenic
1097287339 12:57888345-57888367 CTGCCCACCAAGAGCCAGGCTGG - Intergenic
1102595813 12:113991874-113991896 TTGTCCACACATTGGTAGGCAGG + Intergenic
1102741814 12:115214028-115214050 GTGTCCACACGTAGGTAGGCAGG + Intergenic
1103717376 12:122952914-122952936 CTGTCCACACAGTAGAAGGCAGG + Intronic
1103911415 12:124354531-124354553 CTGTCCCCACGGGGCCAGGCTGG - Exonic
1105295961 13:19088131-19088153 CTGTCTACACATATGCAGCCAGG - Intergenic
1105384058 13:19913858-19913880 CTATCAACATAGATGCAGGCAGG - Intergenic
1105643323 13:22288813-22288835 CTGGTCACAGAAAGGCAGGCTGG - Intergenic
1106583048 13:31034044-31034066 GGCTCCACACTGAGGCAGGCTGG + Intergenic
1106669300 13:31887983-31888005 CTATGCTGACAGAGGCAGGCAGG - Intergenic
1107431094 13:40341086-40341108 CTGTCCACAAAGAAACTGGCTGG - Intergenic
1108577168 13:51800491-51800513 CTGCCCACGCACAGGCAGGCTGG + Intronic
1110114162 13:71791408-71791430 CTGTCCCCCAAGTGGCAGGCGGG + Intronic
1113004727 13:105687314-105687336 CTGTCTACGAAGGGGCAGGCAGG + Intergenic
1113782890 13:112986701-112986723 GTGTCCACCCACAGGCAGGCAGG - Intronic
1114354328 14:21890794-21890816 CTTTCCACACTGAGGCAAGGGGG + Intergenic
1114980453 14:28157786-28157808 CTGCCCACAATGTGGCAGGCAGG + Intergenic
1116568714 14:46487340-46487362 CTGTCCACTCAGAGGCAGGCTGG - Intergenic
1117615315 14:57528344-57528366 CTGTTCACACAGGGGTGGGCAGG + Intergenic
1117638801 14:57775166-57775188 ATGTGCACACAGTAGCAGGCGGG + Intronic
1118336135 14:64854892-64854914 CTGTGCACAGAGAGGCTGGCTGG + Intronic
1118358299 14:65034203-65034225 CTGTCCAGACTGAAGCAGGAGGG - Intronic
1118748427 14:68790233-68790255 CTGCCCACCCAGAAGCAGCCCGG - Exonic
1119320491 14:73727277-73727299 ACTTCCACACAGAGGCAGGGCGG + Intronic
1119646690 14:76353448-76353470 AAACCCACACAGAGGCAGGCAGG - Intronic
1119856957 14:77908103-77908125 CTGTGCACACAGCGGCCTGCAGG + Intronic
1121006121 14:90491732-90491754 CCGCCCACGCACAGGCAGGCGGG - Intergenic
1121574239 14:94970257-94970279 CTGTCCAGATACAGGCAGTCGGG + Intergenic
1122479743 14:102039304-102039326 TTGGCCGCACAGAGGCTGGCGGG + Intronic
1122795025 14:104201714-104201736 CTGTCCTCAGAGAAGCAGGAGGG + Intergenic
1122886848 14:104714017-104714039 CTGTCTACACTGTGGCAGGGTGG - Intronic
1123019782 14:105392270-105392292 CTGGAAACACAGAGGCAGGGGGG - Intronic
1124081647 15:26504276-26504298 CTGTCAAAACAGTGGAAGGCAGG - Intergenic
1124112454 15:26804593-26804615 TTTCCCACACAGAGGCAGTCAGG - Intronic
1124351454 15:28958624-28958646 CTGTCCCCACTGGGGCAGGGAGG + Intronic
1124690976 15:31822558-31822580 CTGCCCACAAAGAGGCAGGGTGG - Intronic
1125599397 15:40907103-40907125 CTGTTCACACAGGGGGGGGCGGG - Intergenic
1125733682 15:41908985-41909007 CAGTCCTCACAGAGCCAGGCTGG - Intronic
1127480283 15:59371908-59371930 CGGGCCGCACAAAGGCAGGCGGG - Intronic
1127808897 15:62546125-62546147 CTCTCCACACTGTGCCAGGCAGG - Intronic
1128450632 15:67804145-67804167 CTGTCCAGAGGCAGGCAGGCGGG - Intronic
1128497441 15:68206464-68206486 CTTTCCACACAGAGGCGGTCAGG - Intronic
1129166845 15:73783329-73783351 CAGTCCAGACAGAGTGAGGCTGG - Intergenic
1129702575 15:77776150-77776172 CTGTCCCCATAAAGGGAGGCAGG - Intronic
1129985830 15:79919266-79919288 TCTTCCACACAGAGCCAGGCTGG + Intronic
1130145777 15:81272812-81272834 TTTCCCACACAGAGGGAGGCTGG - Intronic
1130225615 15:82056293-82056315 CTGGCCACACAGAGAGAGGCGGG + Intergenic
1131360807 15:91789023-91789045 CTGTCCACACCCTGGCAGCCTGG + Intergenic
1131502026 15:92977556-92977578 CTGAGCACTCAGACGCAGGCAGG + Intronic
1132573018 16:652206-652228 CTGTCCACAAAGAGTAAGGCAGG + Intronic
1132577796 16:671948-671970 CAGTCCGCACAGAGGCCGGCCGG + Exonic
1132592884 16:734004-734026 CTGCTCACCCAGAGGCAGCCAGG - Intronic
1132855310 16:2042312-2042334 GTGTCCACTGAGAGGCTGGCAGG + Intronic
1132872038 16:2119634-2119656 CTGTCCACCCAGGGCCAGGAAGG + Intronic
1133205677 16:4232083-4232105 CTGTCTACACAGAGGCAGAGCGG - Intronic
1134520486 16:14917262-14917284 CTGTCCACCCAGGGCCAGGAAGG - Intronic
1134551088 16:15138712-15138734 CTGTCCACCCAGGGCCAGGAAGG + Intronic
1134708158 16:16315913-16315935 CTGTCCACCCAGGGCCAGGAAGG - Intergenic
1134715374 16:16355946-16355968 CTGTCCACCCAGGGCCAGGAAGG - Intergenic
1134761790 16:16720936-16720958 CTGTGCTCACCAAGGCAGGCCGG - Intergenic
1134951444 16:18352732-18352754 CTGTCCACCCAGGGCCAGGAAGG + Intergenic
1134959383 16:18396213-18396235 CTGTCCACCCAGGGCCAGGAAGG + Intergenic
1134984268 16:18638234-18638256 CTGTGCTCACCAAGGCAGGCCGG + Intergenic
1135956271 16:26958959-26958981 CTGACCACACAGATGAAGCCAGG - Intergenic
1136658576 16:31731891-31731913 CTGTCCACACAGAGACCCTCAGG - Intronic
1137665369 16:50246291-50246313 CGGTCCCCACACAGGCGGGCGGG + Intronic
1138423399 16:56914554-56914576 TTGTCCACACACAGGGAGTCTGG + Exonic
1138465175 16:57185240-57185262 CAGTCCACACAGAGGAAAGGGGG - Intronic
1139277091 16:65738017-65738039 CTGCTCACAGGGAGGCAGGCAGG - Intergenic
1139283351 16:65788582-65788604 CTCTCCAATCAGGGGCAGGCTGG - Intergenic
1139374184 16:66486635-66486657 CCCTCCACAGAGTGGCAGGCAGG - Intronic
1139485757 16:67255749-67255771 CTGACCACAAACAGGGAGGCTGG - Exonic
1140002941 16:71044029-71044051 CCAAGCACACAGAGGCAGGCAGG - Intronic
1140558892 16:75954424-75954446 CGGTGCACACAGAGGGAGCCTGG + Intergenic
1141442954 16:84041246-84041268 CTCCCCACACAGAGCCGGGCCGG - Intronic
1141461167 16:84179588-84179610 CTGTCCACACAGGAGGAGCCAGG + Exonic
1141519920 16:84571807-84571829 GTGTCCACTCAGGAGCAGGCTGG - Intronic
1141912697 16:87070837-87070859 CTGTGCACACAGGGAGAGGCTGG + Intergenic
1142278670 16:89136720-89136742 CTGTAGGCACAGAGGCAGGTGGG - Intronic
1142582322 17:949758-949780 CTTTCCAGACTGAGGCAGGGAGG - Intronic
1143017086 17:3896643-3896665 CTGTTCAGACAGAGCCAGGCAGG + Exonic
1143325967 17:6098633-6098655 CTGACCACGCAGAGGCAGCCCGG - Intronic
1143866857 17:9929901-9929923 GTGTCCTCACAGACTCAGGCCGG + Intronic
1144655421 17:17032257-17032279 CTGGCCACACGCAGGCACGCAGG + Intergenic
1144702720 17:17349384-17349406 CTGTCCACAAAGAGGGGAGCAGG + Intergenic
1145907517 17:28524491-28524513 CTGTCTACCCAGAAGCATGCCGG + Exonic
1145996211 17:29106371-29106393 GGGCACACACAGAGGCAGGCTGG + Intronic
1146917849 17:36689561-36689583 CTGACCCCACAGAGGCAGGGTGG + Intergenic
1147399959 17:40174769-40174791 CTGCCCACCCAGAGGCAGGCTGG - Intergenic
1147685383 17:42283913-42283935 CTGTCCAAGCAGAGGCAAGGTGG + Intergenic
1148767176 17:50046206-50046228 CTGACCGCACAAAGCCAGGCTGG + Intergenic
1149085514 17:52710567-52710589 CTGCCTACAGAGAGGCAGGTGGG + Intergenic
1149085522 17:52710608-52710630 CTGCCTACAGAGAGGCAGGTGGG + Intergenic
1149294357 17:55248344-55248366 CTGTCCAGAGATAGGCAGCCTGG - Intergenic
1150714262 17:67557953-67557975 CTTTCCTCAGAGAGGCAGCCCGG + Intronic
1152534559 17:80942990-80943012 CTGCACTCACAGAGGCAGGCAGG - Intronic
1152573408 17:81130212-81130234 CTGGGAACACAGAGGCAGGAGGG - Intronic
1152620874 17:81364267-81364289 CTGCCAACACAGCCGCAGGCAGG + Intergenic
1153677514 18:7468653-7468675 CTGTCAACACTAAGGCATGCTGG - Intergenic
1153747762 18:8198016-8198038 GTGTCCACACAGAAGAAGGTGGG - Intronic
1153777806 18:8469042-8469064 CTTCCCTGACAGAGGCAGGCAGG + Intergenic
1153922591 18:9804719-9804741 CTGTCCTAACAGAGGCAGCTGGG + Intronic
1155158481 18:23177484-23177506 CTGACCACACATAGACCGGCGGG - Intronic
1155577454 18:27263676-27263698 CTATCCACACAGAGCCAGCCAGG - Intergenic
1156472230 18:37384459-37384481 TTGTCCAGACAGGGGCGGGCAGG + Intronic
1157102381 18:44742700-44742722 CTAAGGACACAGAGGCAGGCTGG - Intronic
1157212297 18:45754084-45754106 GTGTCCACACTGAGGAAGGGAGG + Intergenic
1158624145 18:59057167-59057189 CTGGCCAGAAAGGGGCAGGCTGG - Intergenic
1158852265 18:61506768-61506790 CTGTCCATGGAGAGGCAGGCTGG + Intronic
1159550093 18:69885766-69885788 CTGTCCACACAGTGCCATGAGGG - Intronic
1160156595 18:76438854-76438876 CTGTGCTCCCACAGGCAGGCTGG + Intronic
1160389415 18:78518860-78518882 CTGTGCCCACAGAGCCAGGATGG + Intergenic
1160518058 18:79489256-79489278 ATGTCCACGCACAGTCAGGCAGG - Intronic
1163415861 19:17186111-17186133 CAGTCCATCCAGAGGCAGCCGGG + Intronic
1163677414 19:18662319-18662341 GTGTCCACAGAAAGGCCGGCAGG + Intronic
1164424057 19:28124528-28124550 CTGTCCAGACAGATGCAGCAAGG - Intergenic
1164708663 19:30339224-30339246 CTGTGGACTCCGAGGCAGGCTGG - Intronic
1164976932 19:32580756-32580778 CGGTGCACACAGAGGCCGGCCGG - Intergenic
1165377036 19:35450073-35450095 CACTCCATACAGAGGCCGGCGGG - Exonic
1166750361 19:45161595-45161617 CAGGGCACACAGAGGCAGGGCGG + Intronic
1167508495 19:49883524-49883546 CTGACCACACAGACCCAAGCAGG - Intronic
925204709 2:1996251-1996273 CAGTCCACACTGAGGCAGGGCGG - Intronic
925204733 2:1996389-1996411 CAGTCCACACTGAGGCAAGACGG - Intronic
925204758 2:1996527-1996549 CAGCCCACACTGAGGCAGGGCGG - Intronic
925204771 2:1996596-1996618 CAGCCCACACTGAGGCAGGGCGG - Intronic
925204812 2:1996799-1996821 CAGCCCACACTGAGGCAGGGCGG - Intronic
925204825 2:1996868-1996890 CAGTCCACACTGAAGCAGGGCGG - Intronic
925204863 2:1997071-1997093 CAGCCCACACTGAGGCAGGGCGG - Intronic
925286479 2:2719402-2719424 CCTTCCTCACAGAGGGAGGCAGG - Intergenic
925302175 2:2825299-2825321 CTGACAGCACAGAGGCACGCAGG + Intergenic
927441209 2:23119341-23119363 CTGTCCACACAGATGGTGGAGGG + Intergenic
927517847 2:23682464-23682486 AAATCCACACAGAGGCAGGATGG - Intronic
927576920 2:24208038-24208060 CTGCCCACACAGACACGGGCTGG - Intronic
932079372 2:68697766-68697788 CAGTCCCCACAAAGGCAGTCTGG + Intronic
932413346 2:71559955-71559977 CTGGCCCCGCAGAGGCAGGCAGG + Intronic
933226460 2:79754751-79754773 CCATCCATACAGAGGCAGTCAGG - Intronic
933373287 2:81445273-81445295 CTTTCCAAACAGTGGAAGGCAGG - Intergenic
933652167 2:84858315-84858337 CTGGCCACAGGGTGGCAGGCTGG - Intronic
933982088 2:87558907-87558929 CCGACCACACAGAGTGAGGCTGG + Intergenic
936045880 2:109187757-109187779 ATGTCCACACACAGGCACACAGG + Intronic
936311749 2:111391905-111391927 CCGACCACACAGAGTGAGGCTGG - Intergenic
937961947 2:127466715-127466737 CTGTGCACTCAGAAGAAGGCTGG + Intronic
938229490 2:129646181-129646203 CTGTGGACACAGAGCCATGCTGG - Intergenic
938318579 2:130346625-130346647 CTGACCACTCAGAGGCAGGCGGG - Intronic
940855008 2:158723039-158723061 CTCTCCACACCTGGGCAGGCAGG - Intergenic
942497909 2:176558997-176559019 CTGACCACACAGAGAACGGCAGG - Intergenic
944059533 2:195557703-195557725 CTTTACACACTGAGGAAGGCAGG + Intergenic
944087275 2:195863820-195863842 CTGTTCACAGAGGGGTAGGCAGG - Intronic
946023351 2:216656941-216656963 TTGTGCCCACAGAGGCAGGAAGG - Intronic
946203898 2:218089664-218089686 CTGTGCTCACAGAGGAAGGAGGG - Intronic
947876640 2:233471881-233471903 CTGTGCAGAGAGAGGCAGGAAGG + Exonic
948249012 2:236510440-236510462 CTGTCAGCACAGAAGAAGGCAGG + Intergenic
948648488 2:239424322-239424344 CTGTGCAGACTGAGACAGGCTGG + Intergenic
1168779160 20:473951-473973 CTGTCAACAAAGAGGAAGGGAGG + Intronic
1169395638 20:5226535-5226557 CAGTCCAGACACAGCCAGGCAGG - Intergenic
1169858898 20:10131769-10131791 CTCTCTAGAGAGAGGCAGGCTGG - Intergenic
1169913700 20:10667439-10667461 CTGGCCACCCAGACACAGGCAGG - Intronic
1170846900 20:19969847-19969869 CTGTCCTGACACAGACAGGCAGG - Intronic
1171485311 20:25481595-25481617 CTGTTCAGACAGAGGCTGTCGGG - Intronic
1172286498 20:33744378-33744400 TTGTCCTCAGAGAGGCAGCCTGG + Intronic
1173834909 20:46118677-46118699 CTGGCCACACAGAGACTGGTAGG + Intronic
1174737008 20:52973682-52973704 CTGACCACGCAGAGGGATGCAGG - Intronic
1174846463 20:53948120-53948142 CTGGGCAAACAGAGGCAGGATGG - Intronic
1175368402 20:58470825-58470847 GTGGCCACAGAGAGCCAGGCAGG + Intronic
1175772789 20:61634247-61634269 CTGTCCACACACAGGAAGGAGGG - Intronic
1176000383 20:62828911-62828933 CTGTCCTCACAGGGAGAGGCTGG + Exonic
1176101639 20:63367096-63367118 CTGTCTACAAAGAGCCTGGCAGG - Intronic
1177637084 21:23801469-23801491 CTCTTCACACAGTGGCAGGAAGG + Intergenic
1180025371 21:45158154-45158176 CTGGCCAGACAGGGCCAGGCTGG - Intronic
1180167622 21:46038163-46038185 CAGTCCACACAGAGACACACGGG + Intergenic
1180597497 22:16988290-16988312 CTGTCCTCCCAGAGGAGGGCTGG + Intronic
1180819696 22:18817594-18817616 CGGTCTACACAGAGGCAAGAAGG + Intergenic
1180990706 22:19934063-19934085 ATGTGCACCCACAGGCAGGCTGG + Intronic
1181205921 22:21252039-21252061 CGGTCTACACAGAGGCAAGAAGG + Intergenic
1181486899 22:23237285-23237307 CTGTGCTCATGGAGGCAGGCTGG + Intronic
1181961975 22:26628718-26628740 ATAGTCACACAGAGGCAGGCAGG - Intronic
1181985502 22:26797533-26797555 CTGTTCACCCAGACACAGGCTGG + Intergenic
1182349675 22:29692260-29692282 CTGCCCACACAGAAGTAGGAAGG - Intronic
1183379185 22:37482318-37482340 CTGGCCACACTTAGGGAGGCTGG - Intronic
1183477314 22:38042736-38042758 CTGACCACACAGAAGAGGGCTGG + Intergenic
1183734448 22:39636121-39636143 TTTACCACCCAGAGGCAGGCTGG + Intronic
1184022551 22:41830609-41830631 TTGTTCACACACAGGGAGGCTGG - Intergenic
1184486551 22:44783328-44783350 CTGTCCACACAGAGGCAGGCGGG + Intronic
1184785133 22:46667974-46667996 CTGTCCCCACACAGCCAGGGGGG - Intronic
1184810570 22:46828734-46828756 CAGTCCAAACAGAGACAGGAGGG - Intronic
1184947122 22:47811378-47811400 CAGCACACACAGAAGCAGGCAGG - Intergenic
1185317146 22:50184186-50184208 CTGTCCACACGGCAGCAGGCTGG - Intergenic
1203221000 22_KI270731v1_random:43374-43396 CGGTCTACACAGAGGCAAGAAGG - Intergenic
1203269825 22_KI270734v1_random:43447-43469 CGGTCTACACAGAGGCAAGAAGG + Intergenic
949689218 3:6615381-6615403 GTGTCTACTCAGAGGCAAGCTGG - Intergenic
950599863 3:14024293-14024315 CACTCAACACAGAAGCAGGCAGG - Intronic
952828908 3:37546738-37546760 CAGTCCAGACAGAGGCAAGCAGG - Intronic
953983773 3:47426261-47426283 CTTTCAACACAGGGGCAGGAGGG - Intronic
954124283 3:48519574-48519596 CTGTCAACAAAGAGCCAGGTGGG + Exonic
954577765 3:51686213-51686235 CTGGTCCCACAGAGGCAGGGAGG - Intronic
956742679 3:72287365-72287387 CTGTCCAGAGATAGGGAGGCTGG + Intergenic
961129790 3:124455346-124455368 GAGTCAACACAGAGGTAGGCAGG + Exonic
961778449 3:129306929-129306951 CTGGCCACACCTAGACAGGCAGG - Intergenic
964122172 3:153196329-153196351 CAGAGCACACAGAGGCTGGCAGG + Intergenic
964542146 3:157791307-157791329 CTGTCCTCATAGAGACAGGCAGG + Intergenic
966655489 3:182353055-182353077 CTGTCTACCCAGAGCCAGGCTGG + Intergenic
968422448 4:497159-497181 CTGTCGATGCAGAAGCAGGCAGG + Intronic
969209102 4:5672578-5672600 CTTTCCACACTGTGGGAGGCTGG + Intronic
969234385 4:5855380-5855402 CTGTCCAGAAAGGGGCAGTCGGG - Intronic
969590920 4:8121533-8121555 CCCCCCACACAGAGGCAGACAGG + Intronic
970260454 4:14218884-14218906 CTGTACACACAGAGGCATTGTGG + Intergenic
971069298 4:23072730-23072752 GTGTCCACACAAAGGTAAGCAGG + Intergenic
973293976 4:48495452-48495474 CTGTCCACATTGATGCAGGTGGG - Intergenic
974090216 4:57302990-57303012 GTCTACATACAGAGGCAGGCAGG + Intergenic
979342515 4:119543368-119543390 TTGTTTACACAGAGGTAGGCTGG - Intronic
980730839 4:136823201-136823223 CTGTGCACAATAAGGCAGGCTGG + Intergenic
980888260 4:138786336-138786358 TGCTCCACACAGAGGCAGCCAGG + Intergenic
983707094 4:170675282-170675304 CTTTTCACAAAGAGGCAGGATGG + Intergenic
986644019 5:9898792-9898814 CTGTCCACAGACAGGCAGAGGGG + Intergenic
988066501 5:26232790-26232812 CTGCCCACATGGAGGCAGCCGGG + Intergenic
989732587 5:44665439-44665461 CTGTCCACAGCGAGGCACACTGG - Intergenic
991519644 5:67481485-67481507 CTGTTCACACAGAGACATGATGG - Intergenic
992356912 5:75995122-75995144 CTGCCCTCACAAATGCAGGCAGG - Intergenic
993733944 5:91453394-91453416 CAGGCCACACAGAGACAGGGAGG - Intergenic
995570170 5:113471756-113471778 CTGCCCCCAGAGAGGCAGGCAGG + Intronic
995667650 5:114561656-114561678 CTGTCCACTGAGGGGCAGGGTGG - Intergenic
996545657 5:124676000-124676022 CTGGCCACACAAAGGCCTGCTGG + Intronic
996755161 5:126927503-126927525 CTGTGCCCATACAGGCAGGCAGG - Intronic
997296737 5:132773299-132773321 CTGGCAGCACAGAGGCAGGAAGG + Intronic
997476241 5:134144221-134144243 CTGTCCCCACACAGGGAAGCTGG + Intronic
997804713 5:136905720-136905742 CTGAATACACAGAGGCAGACAGG - Intergenic
999262126 5:150244766-150244788 CAGCCCACACATAGGCAGGACGG + Intronic
999432125 5:151533453-151533475 CAGTCAACACAAAGGCAGGGTGG - Intronic
999917696 5:156281432-156281454 CTTTCCACACACAGGCACACAGG - Intronic
1000596646 5:163221962-163221984 GTGTCCACCCAGAGGAAGACAGG + Intergenic
1001101586 5:168818813-168818835 TTGCCCACACAGTGGCAGGAAGG - Intronic
1002191902 5:177482727-177482749 CCGTCCAAACAGAAGAAGGCAGG - Intergenic
1002562562 5:180092222-180092244 CTGAGCACACCGAGTCAGGCTGG - Intergenic
1002922996 6:1586425-1586447 AGGACGACACAGAGGCAGGCTGG + Intergenic
1003168728 6:3703703-3703725 CTGTCAGCACAGGGTCAGGCAGG - Intergenic
1004601032 6:17150153-17150175 CTGTCCTCACACAGGCATGACGG + Intergenic
1006026483 6:31150377-31150399 CTGCCCACAGGGAGGGAGGCAGG + Intronic
1006083404 6:31580385-31580407 CTGGCCATTCAGAGGCAGGGAGG + Intergenic
1006249191 6:32766165-32766187 CTGTCCCCACAGAGGCCGGGTGG - Intergenic
1006721573 6:36156482-36156504 TTCTCCACACAGTGGCAGGAAGG + Intergenic
1008753184 6:54761679-54761701 GTGCCCACATAGAGGCAGACTGG + Intergenic
1010639670 6:78308970-78308992 ATGTACATACAGAGGCAGGTAGG - Intergenic
1013614361 6:111827904-111827926 CTAACTGCACAGAGGCAGGCAGG + Intronic
1014925661 6:127267134-127267156 CTGTCCGCGCAGAGGCGGGATGG + Intronic
1017501754 6:155032231-155032253 CTGTGCACAGACAAGCAGGCAGG - Intronic
1017563780 6:155662562-155662584 CTGTCTACACATAGTCATGCAGG + Intergenic
1018748072 6:166778205-166778227 AGCCCCACACAGAGGCAGGCAGG - Intronic
1019271236 7:150224-150246 CAGTCCAGACACAGGCAGGGCGG + Intergenic
1019427353 7:983906-983928 CTGTCCTCGCTCAGGCAGGCAGG + Intronic
1019593860 7:1849469-1849491 CCGTCGAGACAGTGGCAGGCAGG + Exonic
1021677788 7:23098189-23098211 CTGTGCACAGCCAGGCAGGCTGG - Intergenic
1021842163 7:24729613-24729635 CTGTCTGCACAGAGGCATGAAGG - Intronic
1022557083 7:31308840-31308862 CTGCTCACACAGCGGCAGTCTGG + Intergenic
1026901556 7:74040193-74040215 CTGTCCACAGAGGGGCTGGGAGG - Intronic
1026931167 7:74223790-74223812 CTGCCCAGCCAGAGGCAGGCTGG + Intronic
1027185343 7:75967750-75967772 CGGTCCATACAGAGGGAGGAGGG + Intronic
1029098240 7:98106293-98106315 CAGTCCACACAGGGCCAGGGCGG + Intergenic
1029608771 7:101615459-101615481 CTGAGCACAGAGCGGCAGGCGGG - Intronic
1029610707 7:101625207-101625229 CTGACATCACAGAGGCAGGAAGG - Intronic
1029706571 7:102279661-102279683 CTGGCCACCCAGAGCCAGGCTGG - Intronic
1030866842 7:114710565-114710587 CTGCCCACACAAAGGCAGGTGGG - Intergenic
1032576431 7:133059793-133059815 GTGTCCACTAAGAGGCAAGCAGG - Intronic
1034733122 7:153405129-153405151 CTGTCACGACAGAGGGAGGCAGG + Intergenic
1037299640 8:17437847-17437869 CTGTCCAAAGAGAGACAGACAGG + Intergenic
1037631062 8:20656832-20656854 TGGTTCATACAGAGGCAGGCAGG - Intergenic
1043472317 8:80575286-80575308 CTGTCCAGAGAGAGGGAGCCAGG - Intergenic
1044992110 8:97805256-97805278 CTGACCACATGGAGTCAGGCTGG - Intronic
1045666582 8:104493817-104493839 CTTTCCCCATAGAGGCAGGAGGG - Intronic
1049015997 8:139920510-139920532 CTGCCTACACAGTGGCAGCCAGG + Intronic
1049345988 8:142138901-142138923 CCGTCCACACAGAGGGAGACGGG + Intergenic
1049708843 8:144054776-144054798 CTGCCCCAGCAGAGGCAGGCGGG + Intronic
1049806707 8:144544284-144544306 GTGGGCACACAGAGGCAGGGTGG - Intronic
1049852961 8:144843968-144843990 CCTTCCTCAGAGAGGCAGGCTGG + Intronic
1050463903 9:5900653-5900675 TTGTCCACAGAGAGGCTGGTTGG + Intronic
1052313419 9:27092738-27092760 CTGCACACAGAGAGGCCGGCAGG + Intergenic
1055943662 9:81673669-81673691 GTATCCACACAAAGGGAGGCTGG + Intronic
1056431204 9:86529647-86529669 TTGTCCAGACAGATGAAGGCAGG + Intergenic
1056825638 9:89874624-89874646 CTGTCCACACATAGGGACACAGG + Intergenic
1057146786 9:92764239-92764261 AGGTCCGCACAGAAGCAGGCGGG + Intronic
1057206059 9:93173335-93173357 CTGTCCACACAGACCCCCGCTGG + Intergenic
1057261630 9:93587786-93587808 CTGGCTACACAGACACAGGCTGG - Intronic
1057380075 9:94559564-94559586 CTGTCCCCAGAGAGACAAGCCGG - Intronic
1057437808 9:95058527-95058549 CCCTCCAGACAAAGGCAGGCAGG - Intronic
1057580953 9:96287287-96287309 CTGGACCCACAGGGGCAGGCAGG + Intronic
1058120731 9:101135833-101135855 CTGGGCAGACAGAGGCAGGAAGG - Intronic
1058714959 9:107715222-107715244 CTGCCCACACTGCGGCAGTCAGG - Intergenic
1061238854 9:129357728-129357750 GTCTCCGAACAGAGGCAGGCAGG + Intergenic
1061286734 9:129627764-129627786 CTGTCCACAAAGATCCAGGGAGG + Intronic
1061322737 9:129841500-129841522 CAGTCCACACTCAGGCATGCTGG + Intronic
1061605201 9:131704818-131704840 CTGCCCTCCCAGAGGTAGGCAGG - Intronic
1061783110 9:133007394-133007416 CAGTCCACACAGTGTCAGGTAGG - Intergenic
1061840094 9:133353702-133353724 CTGTCCTGGCAGAGGCAGTCAGG - Intronic
1061867012 9:133497433-133497455 CAGTCCACACTGAGACAGGGTGG - Intergenic
1061919177 9:133772764-133772786 CTGTCCTGAGAGATGCAGGCAGG + Intronic
1062214670 9:135382762-135382784 AGCTCCACACAGAGGCAGGAGGG + Intergenic
1062459470 9:136656884-136656906 CTCTCCCCACACGGGCAGGCGGG + Intergenic
1186417269 X:9394614-9394636 CTGGCCATACAGAGGAAAGCAGG + Intergenic
1187474168 X:19595482-19595504 CTTTCTACACCGAGGCTGGCAGG + Intronic
1188000528 X:24976338-24976360 CTGTGCATACAGAGGTGGGCAGG - Intronic
1189436608 X:40998366-40998388 CTGTCCAGAGAGAGGTTGGCAGG - Intergenic
1190399235 X:50014913-50014935 CTGTCCACACACAGGGTGGTGGG + Intronic
1192174532 X:68877710-68877732 CTACCCACACCGGGGCAGGCGGG - Intergenic
1195069631 X:101266695-101266717 CTTTCCAGATAAAGGCAGGCAGG - Intergenic
1195704468 X:107729010-107729032 CTGCCCACTCAGAGGCAGTTTGG - Intronic
1197766939 X:130065500-130065522 CAGTCATCACAGAGGCAGGCTGG + Exonic
1197873853 X:131084046-131084068 CTGTGCCCTCAGAGGCAGGGGGG + Intronic
1198112785 X:133516318-133516340 CTGTACTCACTGAGGCAGACAGG + Intergenic
1198402652 X:136282360-136282382 CTGGCCAGACAGGAGCAGGCAGG + Intergenic
1198831208 X:140752481-140752503 CTGTTCACACAGAGAAAGCCAGG - Intergenic
1199471330 X:148199052-148199074 TTGTCCACTCAGAGGAAGCCTGG + Intergenic
1200068005 X:153514232-153514254 CTGTCCCAACAGTGGCAGGAGGG + Intergenic