ID: 1184488541

View in Genome Browser
Species Human (GRCh38)
Location 22:44795962-44795984
Sequence CTGCAGACATGGAAAGGAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184488541_1184488549 23 Left 1184488541 22:44795962-44795984 CCTACTCCTTTCCATGTCTGCAG No data
Right 1184488549 22:44796008-44796030 TGTCCCTCCCCCTCCTCACCTGG 0: 1
1: 0
2: 7
3: 69
4: 675
1184488541_1184488545 -1 Left 1184488541 22:44795962-44795984 CCTACTCCTTTCCATGTCTGCAG No data
Right 1184488545 22:44795984-44796006 GCCTCCACTGGCCTTGCTGTAGG 0: 1
1: 0
2: 2
3: 30
4: 206

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184488541 Original CRISPR CTGCAGACATGGAAAGGAGT AGG (reversed) Intronic
No off target data available for this crispr