ID: 1184489396

View in Genome Browser
Species Human (GRCh38)
Location 22:44800475-44800497
Sequence TACCCCTTGAGAGCTGGGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184489396_1184489402 4 Left 1184489396 22:44800475-44800497 CCAGTCCCAGCTCTCAAGGGGTA No data
Right 1184489402 22:44800502-44800524 TCCCCGCAGCTGTCCATATGTGG 0: 1
1: 11
2: 14
3: 6
4: 62
1184489396_1184489406 6 Left 1184489396 22:44800475-44800497 CCAGTCCCAGCTCTCAAGGGGTA No data
Right 1184489406 22:44800504-44800526 CCCGCAGCTGTCCATATGTGGGG 0: 1
1: 12
2: 16
3: 6
4: 63
1184489396_1184489408 7 Left 1184489396 22:44800475-44800497 CCAGTCCCAGCTCTCAAGGGGTA No data
Right 1184489408 22:44800505-44800527 CCGCAGCTGTCCATATGTGGGGG 0: 1
1: 11
2: 14
3: 8
4: 78
1184489396_1184489404 5 Left 1184489396 22:44800475-44800497 CCAGTCCCAGCTCTCAAGGGGTA No data
Right 1184489404 22:44800503-44800525 CCCCGCAGCTGTCCATATGTGGG 0: 1
1: 11
2: 14
3: 6
4: 72
1184489396_1184489409 8 Left 1184489396 22:44800475-44800497 CCAGTCCCAGCTCTCAAGGGGTA No data
Right 1184489409 22:44800506-44800528 CGCAGCTGTCCATATGTGGGGGG 0: 1
1: 7
2: 3
3: 13
4: 194

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184489396 Original CRISPR TACCCCTTGAGAGCTGGGAC TGG (reversed) Intronic
No off target data available for this crispr