ID: 1184492745

View in Genome Browser
Species Human (GRCh38)
Location 22:44819786-44819808
Sequence TTTTCCCCATTCCAAAGAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 742
Summary {0: 1, 1: 0, 2: 2, 3: 69, 4: 670}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184492743_1184492745 7 Left 1184492743 22:44819756-44819778 CCGCAAAACAGTACTGTGAAGTC 0: 1
1: 0
2: 2
3: 32
4: 318
Right 1184492745 22:44819786-44819808 TTTTCCCCATTCCAAAGAAGAGG 0: 1
1: 0
2: 2
3: 69
4: 670
1184492742_1184492745 13 Left 1184492742 22:44819750-44819772 CCAGCACCGCAAAACAGTACTGT 0: 1
1: 0
2: 1
3: 7
4: 60
Right 1184492745 22:44819786-44819808 TTTTCCCCATTCCAAAGAAGAGG 0: 1
1: 0
2: 2
3: 69
4: 670
1184492741_1184492745 22 Left 1184492741 22:44819741-44819763 CCTTATGTGCCAGCACCGCAAAA 0: 1
1: 0
2: 0
3: 0
4: 73
Right 1184492745 22:44819786-44819808 TTTTCCCCATTCCAAAGAAGAGG 0: 1
1: 0
2: 2
3: 69
4: 670

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184492745 Original CRISPR TTTTCCCCATTCCAAAGAAG AGG Intronic
900565009 1:3327875-3327897 TTACCCCCATTCCACAGATGGGG + Intronic
901014968 1:6223699-6223721 TTGACCCCATTCCACAGATGGGG + Exonic
901680429 1:10909855-10909877 TTGTCCCCATTTCACAGATGAGG - Intergenic
901806453 1:11741575-11741597 CTCTCCCCATTACAAAGATGGGG - Intronic
902174233 1:14637399-14637421 TCATCCCCATTCCACAGATGAGG + Intronic
902239105 1:15076462-15076484 TTATCTCCATTTCAAAGAGGGGG - Intronic
902565551 1:17308857-17308879 TTATCCCCATTTCACAGATGAGG - Intronic
902712154 1:18247794-18247816 TTGTCCCCATTCTATAGATGAGG + Intronic
902718330 1:18288083-18288105 TTATCCCCATTTCACAGATGAGG + Intronic
903060112 1:20663508-20663530 TTATCCCCATTTCACAGATGAGG + Intergenic
903268460 1:22172914-22172936 TTATCTCCATTTCACAGAAGAGG + Intergenic
903300866 1:22377904-22377926 TTATCCCCATTTCATAGACGAGG - Intergenic
903441757 1:23393603-23393625 TTATCCCCATTCTACAGATGAGG - Intronic
903553912 1:24179673-24179695 TTTTCCCCATTCTAGAGGTGAGG - Intronic
903654435 1:24940442-24940464 TTCTCCCCATTTCATAGATGAGG - Intronic
903760217 1:25692571-25692593 TTATCCCCATTGCACAGATGAGG + Intronic
904353458 1:29923783-29923805 TTGTCCCCATTTCAAAGAGGAGG - Intergenic
904472902 1:30746784-30746806 TTATCCCCATTCCTCAGATGAGG - Intronic
904844276 1:33397074-33397096 TTATCCCCATTTCACAGATGAGG - Intronic
904956291 1:34286827-34286849 TTCTCCACCTTCCAAAGTAGTGG + Intergenic
905098387 1:35495826-35495848 TTTTCCCCATTTTTAAAAAGTGG - Intronic
905160382 1:36028007-36028029 TTGTCCCAATTCCAGAGATGAGG - Intronic
905371841 1:37486595-37486617 TTTCCCCCACTCTAGAGAAGTGG - Intergenic
905425788 1:37883206-37883228 TTTACCCCATTCCTGGGAAGAGG + Intronic
905878898 1:41450836-41450858 TCTGCCCCTTTCCAAGGAAGTGG - Intergenic
906695791 1:47822689-47822711 TTATCCCCATTTCAGAGATGAGG + Intronic
906720900 1:48003737-48003759 TTATCCCCATTTTAAAGATGAGG + Intergenic
907043080 1:51280942-51280964 CTTACCCCATTCCCAAGAACAGG - Intergenic
907185319 1:52604701-52604723 TTTTCCCCCTTCCAAAAGAGCGG + Intronic
907332989 1:53683487-53683509 TTCTCCCCATTTCACAGATGAGG - Intronic
907474235 1:54694952-54694974 TTATCCCCATTTCATAGATGAGG - Intronic
907548855 1:55287302-55287324 TTTTCCCCCTCTCAGAGAAGAGG + Intergenic
907621736 1:55988245-55988267 GTTTCCCCATACCAAAAATGAGG - Intergenic
907737932 1:57133833-57133855 TTTTTTCCATATCAAAGAAGTGG - Intronic
907928545 1:58977630-58977652 TTTTCTCCATTGTAAAGATGAGG - Intergenic
907936592 1:59047244-59047266 CTTTCCCCATTTCACAGATGAGG - Intergenic
907956792 1:59236200-59236222 TTGTTCCCATTCCATAGAAAAGG - Intergenic
907972457 1:59396736-59396758 TTATCCCCATTTTAAAGATGAGG - Intronic
907992156 1:59593484-59593506 TTATCCCCATTTTAAAGATGAGG - Intronic
908000804 1:59677120-59677142 TTTGCTCCCCTCCAAAGAAGAGG + Intronic
908098376 1:60764273-60764295 TTTTCCCCATTTCATAGAGAGGG - Intergenic
908785925 1:67734492-67734514 TTTTCCCCACTACACAGATGGGG + Intronic
908855854 1:68427247-68427269 TTTTCACCATTTTAAAGATGAGG - Intergenic
909477641 1:76098596-76098618 TTTTCCCCATTTAAAAAAATGGG + Intronic
910986304 1:93008064-93008086 TTCTCCCCATTACAAACATGTGG + Intergenic
911093620 1:94037714-94037736 TTTTCCCCTTTTCACAGATGAGG - Intronic
911171701 1:94776800-94776822 TCTTCCCCTTGCCAAGGAAGGGG - Intergenic
911696759 1:100896984-100897006 TTCTCCCAATTCCAACAAAGTGG - Intronic
912408632 1:109464722-109464744 TTATCCCTATTCCATAGAACAGG + Intergenic
912564862 1:110580347-110580369 TTTTCCCTCTCCCAAATAAGGGG + Intergenic
913484604 1:119322392-119322414 GTTTCCCCATTCAAGACAAGAGG - Intergenic
914225383 1:145715705-145715727 TTATCCCCATTCCACAGTTGAGG + Intergenic
915035905 1:152924806-152924828 TTTTCACCTTTTCAAAGAATCGG + Intergenic
915079424 1:153341665-153341687 TTCTCGCCTTTCCCAAGAAGTGG + Exonic
915128412 1:153681013-153681035 TGATGCCCATTCCAAAGCAGGGG - Intronic
915165036 1:153943791-153943813 TTTTCCCCATTTGACAGATGAGG + Intronic
916602064 1:166302923-166302945 TTATCCCCATTTTACAGAAGAGG + Intergenic
917256512 1:173121989-173122011 TTATCCCCATTTCAGAGATGGGG + Intergenic
917483060 1:175429446-175429468 TTTTGCCCATTTCACAGATGAGG - Intronic
917666611 1:177231208-177231230 TTTTCCCCATTTTACAGATGGGG + Intronic
917915866 1:179700986-179701008 TTAGCCCCATTCCTAACAAGTGG + Intergenic
918384212 1:183989002-183989024 TTATCCCCATTTTACAGAAGAGG + Intronic
918549563 1:185726701-185726723 TGATCCCCATTTCATAGAAGAGG - Intergenic
918595661 1:186289779-186289801 TTTTCCCCAGTCCAAGGGACAGG + Intergenic
918664281 1:187130409-187130431 TTTTTCCCATTTTACAGAAGAGG + Intergenic
918791443 1:188835648-188835670 TTTTCCTCATCCAAAAAAAGAGG - Intergenic
918906958 1:190508920-190508942 TTTTCCCAATTTCACAAAAGAGG + Intergenic
918938029 1:190950171-190950193 TTTTCCCCATCACTGAGAAGGGG - Intergenic
921110206 1:212028821-212028843 TTTTCCCCATTTGAAAGGTGAGG + Intronic
921219850 1:212965740-212965762 TTTTCCTAATTTCAAAGAACTGG - Intronic
921799897 1:219390671-219390693 ATTTCCCCTTCCCAATGAAGAGG + Intergenic
921990569 1:221361525-221361547 TTTTCACTACTCCAAGGAAGGGG - Intergenic
922580790 1:226696207-226696229 TTATCCCCATTTCACAGATGTGG - Intronic
922946165 1:229516042-229516064 TCTTCCCCATTTCACAGAGGAGG - Intergenic
924242596 1:242055401-242055423 CCTTCCCCATCCCAAGGAAGAGG + Intergenic
1062845524 10:700927-700949 TTTTCCCCATTCCTTAAAAGAGG - Intergenic
1063094836 10:2900177-2900199 TATTCTCTATTCCAAAGAGGTGG + Intergenic
1063622844 10:7665462-7665484 TTCTCCACATTTCACAGAAGAGG + Intronic
1063826368 10:9903015-9903037 TTATCTCCATTTCACAGAAGGGG + Intergenic
1064412997 10:15124397-15124419 TTATCCCCATAGCACAGAAGGGG - Intronic
1065545131 10:26811442-26811464 GTGTCCTCCTTCCAAAGAAGGGG + Intronic
1066290926 10:34013809-34013831 ATTTCCCCATTCTAAAACAGGGG + Intergenic
1067192442 10:44082645-44082667 CTTTCCCAAGTCCAAATAAGAGG + Intergenic
1067485373 10:46644407-46644429 TTATCTCCATTTCAAAGAAAAGG + Intergenic
1068793340 10:61050676-61050698 TTATCCCCATTATACAGAAGAGG - Intergenic
1068825990 10:61439680-61439702 TTTTCCCCATTTTACAGATGAGG - Intronic
1069664056 10:70143348-70143370 TTAGCCCCATTTCAAAGACGTGG + Intronic
1069702588 10:70437491-70437513 TTATTCCCATCGCAAAGAAGAGG - Intronic
1069715317 10:70517141-70517163 TTGTTCCCATTTCACAGAAGTGG + Intronic
1069951423 10:72021086-72021108 TTATCCCCATTTCACAGATGAGG - Intergenic
1070462322 10:76682404-76682426 TTTTCCCAATGCCTAAGAACTGG + Intergenic
1070607261 10:77907690-77907712 TTATCCCCATTCCACAGATGAGG + Intronic
1070830755 10:79416792-79416814 TTATCCCCATTGCACAGAGGAGG - Intronic
1071083192 10:81837503-81837525 TTTTCTCCATTCCACAGATGTGG - Intergenic
1071172267 10:82880222-82880244 TTTTCCCCAAACCAAAGATTAGG - Intronic
1071371327 10:84954516-84954538 TTGTCCCCATTTTAAAGAAGAGG + Intergenic
1071531674 10:86394380-86394402 TGTTGGCCATTCTAAAGAAGTGG - Intergenic
1072104632 10:92262444-92262466 TTATCCCCATTTCACAGATGAGG + Intronic
1072921023 10:99577437-99577459 TTATCCCCATTTTAAAGACGAGG + Intergenic
1073274555 10:102298689-102298711 TTATCCCCATTGTATAGAAGAGG + Intronic
1073674110 10:105626037-105626059 TTATCCCCATGTCAAAGATGAGG - Intergenic
1073978040 10:109122466-109122488 TTTTTCCCATTCTAAGGATGTGG - Intergenic
1074933245 10:118151179-118151201 TTTTCCCCATTTCCCAGAAGAGG + Intergenic
1075279688 10:121129002-121129024 TTATCCCCATTTTATAGAAGTGG + Intergenic
1075491813 10:122878126-122878148 TTTTTCCTATCCAAAAGAAGGGG + Intronic
1075781036 10:125017297-125017319 TTATCGCCTCTCCAAAGAAGCGG - Intronic
1076105103 10:127815746-127815768 TTGTCCCCATTTCACAGAAGTGG - Intergenic
1076540800 10:131213575-131213597 TTGTCCCCATTCCATAGACGGGG - Intronic
1076676648 10:132150372-132150394 TTTCCCCCAAGCCAAGGAAGTGG - Intronic
1077497643 11:2894122-2894144 TTGTCCCCATTTCACAGATGGGG + Intronic
1077631947 11:3816965-3816987 TTATTCCCATTTCACAGAAGGGG - Intronic
1077674729 11:4185931-4185953 TTATCCCCATTGCACAGAGGAGG - Intergenic
1078196151 11:9138568-9138590 CTTTCCCCACTCCACAGAGGAGG - Intergenic
1078800388 11:14638091-14638113 TTATCCCCATTTCACAGATGAGG + Intronic
1078858925 11:15229534-15229556 TTATCCCCATTACACAGATGAGG - Intronic
1078950987 11:16134156-16134178 TTTTCCCCATTTTACAGATGAGG + Intronic
1080157427 11:29128183-29128205 TTTCCCCCATTTTATAGAAGAGG + Intergenic
1080643242 11:34170210-34170232 TTTTCCCCATTGTATAGATGAGG - Intronic
1080897640 11:36459561-36459583 TGTTCAACATTGCAAAGAAGAGG - Intronic
1080967823 11:37234126-37234148 TTTTCCCCATTTAACAGCAGAGG - Intergenic
1081063586 11:38510490-38510512 TTTGGCCCATTTCAAATAAGTGG - Intergenic
1081541865 11:44040423-44040445 TTTGCCCCATTACAGAGAAAAGG - Intergenic
1081753213 11:45526937-45526959 GTTACCCCATTACATAGAAGGGG - Intergenic
1081840206 11:46194901-46194923 TTATCCCCATTTTAAAGATGGGG + Intergenic
1082803881 11:57434317-57434339 TTATCCCCAATTCAGAGAAGGGG - Intergenic
1082952156 11:58828982-58829004 ATTACCCCATTCCACAGATGAGG + Intergenic
1083062035 11:59883773-59883795 TTATCCCCATTGTACAGAAGAGG + Intergenic
1083190888 11:61051521-61051543 TTCTCCCCATTTCACAGATGAGG - Intergenic
1084069072 11:66722246-66722268 TTGTCCCCATTTCATAGATGAGG + Intronic
1084114030 11:67031439-67031461 TTTTCCCCATTTTACAGATGAGG - Intronic
1084489095 11:69468710-69468732 TTTCCCCCATTCCACAGAGGAGG + Intergenic
1084616085 11:70236774-70236796 TCATCCCCCTTCCAAAGTAGTGG + Intergenic
1084710568 11:70841406-70841428 TTTTCCCCATTACACAGCAGAGG + Intronic
1084861439 11:72021153-72021175 TATTCCCCATTTCAGAGATGAGG + Intronic
1085445446 11:76597968-76597990 TTTTGCCCATTCTACAGATGAGG - Intergenic
1085486051 11:76863787-76863809 TTATCCCCATTTCAAAGATAAGG + Intronic
1085862225 11:80247601-80247623 TTATCCCCATTCTATAGATGAGG + Intergenic
1085876935 11:80419024-80419046 ATTTCACCAATCCAAAGAGGAGG - Intergenic
1086059372 11:82684570-82684592 TTATCCCCATTTCAGAGAGGTGG + Intergenic
1086451578 11:86922328-86922350 TTTTGCCCATTTTAAAGAGGAGG - Intronic
1087159284 11:94933584-94933606 TTTTCTCCATTTCATAGATGAGG + Intergenic
1087284949 11:96255368-96255390 TTATCCCCATTTTACAGAAGAGG + Intronic
1087595788 11:100253447-100253469 TTATCCCCATTTCATAGAGGAGG - Intronic
1088199155 11:107311428-107311450 TTTGCACCATGCCACAGAAGGGG + Intergenic
1088305106 11:108399391-108399413 TTTTTCCCCTTCAAATGAAGTGG + Intronic
1089414675 11:118277587-118277609 TTTTCCCCTTTCCAAAGCTAAGG - Intergenic
1090140730 11:124257709-124257731 TTTCCTGGATTCCAAAGAAGGGG + Intergenic
1091788663 12:3258396-3258418 CTTTCCCCATCTCAAAGGAGAGG - Intronic
1091813697 12:3420340-3420362 TTATCCCCATTTCACAGATGAGG - Intronic
1092230183 12:6771876-6771898 TTTTCCCCATTGTACAGATGAGG - Intergenic
1093338985 12:17948518-17948540 TTATCCCTATTCCAATGAATAGG + Intergenic
1093702055 12:22232435-22232457 TTTTCCCCATCTCAAAGAAATGG - Intronic
1093746731 12:22750873-22750895 TTTTCCACCTTCCAAAAGAGAGG - Intergenic
1095357884 12:41297666-41297688 TTCTCCCCTTTCCACTGAAGAGG - Intronic
1095422028 12:42034124-42034146 TTATCCCCATTTTAAAGAAGAGG + Intergenic
1096463343 12:51834906-51834928 TTCTCCCCATTTTATAGAAGAGG + Intergenic
1096504702 12:52085396-52085418 TTTTCCCCACCCTAAAGAGGAGG - Intergenic
1097202401 12:57290480-57290502 TTTTCCCCATTTTATAAAAGAGG - Intronic
1097769801 12:63570691-63570713 TTTTCCCAATTCCTAAGAATTGG + Intronic
1098766718 12:74499526-74499548 TTTTCTTCATTCCTAAGTAGTGG - Intergenic
1098898406 12:76087736-76087758 TTTTCCCCATTTTACAGATGTGG - Intergenic
1098927898 12:76372979-76373001 TTGTCCCCATTTTACAGAAGAGG - Intronic
1098993246 12:77089558-77089580 TTTTTGCTATTCCAAAGCAGAGG + Intergenic
1099039797 12:77637594-77637616 TTATCCCCATTTTACAGAAGTGG + Intergenic
1099289852 12:80762935-80762957 TTTTCCCCATTTTACAAAAGAGG + Intergenic
1099413118 12:82356556-82356578 TTTTTCCCATTTTAAAGAAGAGG + Intronic
1100144033 12:91655114-91655136 TTTTCCCCATTTTAAAGATAAGG - Intergenic
1100183194 12:92107605-92107627 TTTTCTCCTTTCAATAGAAGTGG - Intronic
1100461215 12:94801306-94801328 TTATCCCCATTCTATAGATGAGG + Intergenic
1100605234 12:96146972-96146994 ATTTCCCCATTTCACAGAGGAGG - Intergenic
1101065562 12:101016860-101016882 TTATCCCCATTTCACAGATGAGG + Intronic
1101652904 12:106693971-106693993 TTATCCCCATTTCACAGAAGGGG + Intronic
1101725429 12:107384657-107384679 TTGTCCCCAGTCCAGACAAGGGG + Intronic
1102021596 12:109687203-109687225 TTATCCCCATTCTAAAGGTGAGG + Intergenic
1102177763 12:110888377-110888399 TTTTCCCCACTCCTCATAAGGGG + Intronic
1102196833 12:111032568-111032590 TCTTCCCCACTCAAAAAAAGGGG - Intergenic
1102512465 12:113425086-113425108 TTATCCCCATTTTAGAGAAGGGG + Intronic
1102547502 12:113667284-113667306 TCATCCCCATTCCACAGATGAGG - Intergenic
1102633962 12:114306339-114306361 TTATCCCCATTCTATAGAAAAGG + Intergenic
1102647933 12:114415675-114415697 TTTTCCCAGTTCCCAGGAAGTGG - Intergenic
1102717160 12:114984237-114984259 TTTTCCCCACTGTAAAGAAGGGG - Intergenic
1102878374 12:116465536-116465558 TTATCCCCATTTCACAGATGAGG + Intergenic
1102922321 12:116801096-116801118 TTGTTCCCATTCCACAGATGAGG + Intronic
1103124919 12:118413458-118413480 TTGGCCCCATTTTAAAGAAGAGG - Intronic
1103244397 12:119443852-119443874 TTGTCCCCATTTCATAGATGAGG - Intronic
1103441574 12:120966744-120966766 TTATCCCCATTTCACAGATGCGG - Intergenic
1103917416 12:124383200-124383222 TTGTCCCCATTTCACAGATGGGG + Intronic
1104423747 12:128657956-128657978 TTATCCCCATTTCACAGATGAGG + Intronic
1104790433 12:131478194-131478216 TTATCCCCATTCTACAGAGGCGG - Intergenic
1105068748 12:133221078-133221100 TTTTCAGCAATCCAAAGGAGAGG + Intronic
1105440418 13:20410789-20410811 TTGTCCCCATTTCACAGATGGGG + Intronic
1105556846 13:21455302-21455324 TTCTCTACATGCCAAAGAAGAGG + Intronic
1107081067 13:36375343-36375365 TTAGCCCCATTCTAAAGAAGAGG + Intergenic
1107392358 13:39979695-39979717 TTTTTGCCAATCCAAAGATGAGG + Intergenic
1110039726 13:70737907-70737929 TTTTCTCCATTTCCCAGAAGAGG + Intergenic
1110636575 13:77774044-77774066 TTATCTCCATTTCAAAGATGGGG + Intergenic
1111887873 13:94045951-94045973 TTGTCCCCATTTTACAGAAGAGG + Intronic
1112027277 13:95423046-95423068 TGTTTCCCATCCCAAAGCAGTGG + Intergenic
1112172556 13:96989564-96989586 TCATCCCCATTCAACAGAAGAGG + Intronic
1112375712 13:98838254-98838276 TTATCCCCATTCTACAGATGAGG - Intronic
1112588712 13:100744087-100744109 TAATCCCCATTCCACAGATGGGG - Intergenic
1112857448 13:103788296-103788318 TTTTGGCTATTCCAAAGTAGAGG + Intergenic
1113582117 13:111437289-111437311 TTATCCCCATTTCACAGATGGGG + Intergenic
1113712409 13:112476734-112476756 TTTTCCTCATCTCAAAGCAGTGG - Intergenic
1115304080 14:31915881-31915903 TTCTCCCCATTTTACAGAAGAGG - Intergenic
1115347074 14:32354397-32354419 TTATCCCCATTTCACAGAATGGG - Intronic
1115354119 14:32428933-32428955 TTTACACAAATCCAAAGAAGAGG - Intronic
1115406341 14:33021311-33021333 TTATCCCCATTTTACAGAAGAGG + Intronic
1115502622 14:34062990-34063012 TTATCCCCATTTCACAGAAGAGG - Intronic
1115614371 14:35079641-35079663 TTCTCCTCATTACAAAGATGAGG - Intronic
1115960605 14:38832848-38832870 TTTTCCCCTTTAGAGAGAAGAGG - Intergenic
1118118145 14:62804713-62804735 TTATCCCCATTTCACAGATGAGG - Intronic
1118199593 14:63659834-63659856 TTTTTGCCTTTCCATAGAAGAGG - Intergenic
1118596474 14:67439174-67439196 TTATCCCCATTTCACAGACGGGG - Intergenic
1120918348 14:89730295-89730317 TTATCCCCATTTCACAGATGAGG - Intergenic
1120938313 14:89920269-89920291 TTTTCCCTGTTCCTATGAAGTGG - Intronic
1121013001 14:90533028-90533050 TTCTCCCCATTTCACAGATGAGG + Exonic
1121058214 14:90878610-90878632 TTTTCCTCATTCCGCAGAAGTGG + Intronic
1121269675 14:92629755-92629777 TTATCCCCATTCTACAGATGAGG + Intronic
1121869653 14:97395371-97395393 TTGTCCCCATTCCACAGATGGGG + Intergenic
1122080079 14:99261041-99261063 TTCACCCGATTCCAAAGAACGGG + Intronic
1122287918 14:100663352-100663374 TTGTCCCCATTTCACAGATGAGG + Intergenic
1123988253 15:25664078-25664100 TTAGCCCCATTCCACAGCAGAGG - Intergenic
1124664204 15:31578180-31578202 TTTCCTGCATTCCAAAAAAGAGG - Intronic
1124823881 15:33074233-33074255 TTGTCTCCATTTCAAAGATGTGG - Intronic
1124930613 15:34115748-34115770 TATTCTCCATTCTAAAGGAGAGG - Intergenic
1124940222 15:34210676-34210698 TTGTCCCCATTTTACAGAAGGGG - Intergenic
1125604238 15:40930980-40931002 TTATTCCCTTTCCAAAGGAGCGG - Intronic
1126012319 15:44314836-44314858 TTTTCCCCATTTCACAAATGAGG - Intronic
1127238323 15:57081405-57081427 TTATTCCCATTCCACAGATGAGG - Intronic
1127387537 15:58478595-58478617 TTATCCCCATTTCATAGAGGAGG + Intronic
1127415635 15:58754661-58754683 TTTTCCCCATTGTAAAGATTAGG - Intergenic
1127474354 15:59318794-59318816 TTATCCCCATTTTAAAGATGAGG + Intronic
1127626005 15:60780993-60781015 TTATCCCCATTTCACAGATGGGG + Intronic
1128236443 15:66070733-66070755 TTATTCCCATTCCACAGATGAGG - Intronic
1128248775 15:66150734-66150756 ATTTCCCCATTTGAAAAAAGAGG - Intronic
1128325085 15:66719108-66719130 TTCTCCCCATTTCATAGAGGAGG + Intronic
1128775840 15:70319696-70319718 TCTTCCCCATTTCACAGATGAGG + Intergenic
1129324719 15:74794035-74794057 TTACCCCCATTTCACAGAAGCGG - Intronic
1129331083 15:74827610-74827632 TTATCCCCATTTTACAGAAGAGG + Intronic
1129674133 15:77623218-77623240 TTTTCCACAGGCCAAGGAAGAGG + Intronic
1129895237 15:79100308-79100330 TTTTTCCCAATCAAAAGATGAGG - Intergenic
1130011393 15:80155402-80155424 TTGTCCCCATTCTACAGATGAGG + Intronic
1130628165 15:85537753-85537775 TTTCCCCCATTTCACAGATGAGG - Intronic
1130834362 15:87634775-87634797 TTTTCCCCATTCGTAAAATGGGG + Intergenic
1130878865 15:88037862-88037884 TTTTCCCCATTTTAAAGACGGGG + Intronic
1131550082 15:93349783-93349805 TTTTCCCCATTTTACAGATGAGG - Intergenic
1132020051 15:98353108-98353130 CTATCCCCATTTCACAGAAGAGG - Intergenic
1132136442 15:99345123-99345145 TTTTCCCCATTATACAGATGAGG + Intronic
1132271418 15:100529396-100529418 TTTTCTCAATTCCTAGGAAGCGG - Intronic
1132724101 16:1331439-1331461 TTGTCCCCATTTTACAGAAGAGG + Intergenic
1132791366 16:1690933-1690955 TTATCCCCATTCTACAGATGAGG + Intronic
1133692756 16:8232493-8232515 TTGTCCCCATTTCTAAGATGAGG + Intergenic
1133699353 16:8294737-8294759 ATTTCCCCATTTGACAGAAGGGG + Intergenic
1133790014 16:9002335-9002357 TCATCCCCATTCCACAGATGAGG - Intergenic
1133907119 16:10032598-10032620 TTATCCCCATTTCACAGACGAGG + Intronic
1134435093 16:14249251-14249273 CTTTCTCCATTCCAAATAACTGG - Intronic
1134589310 16:15439296-15439318 TTATCCCCATTTCACAGATGAGG - Intronic
1134756711 16:16673637-16673659 TTATCCCCATTTCACAGATGAGG - Intergenic
1134989357 16:18685526-18685548 TTATCCCCATTTCACAGATGAGG + Intergenic
1135460575 16:22638851-22638873 TTTTCCCCTCCCCAAAAAAGTGG - Intergenic
1135966358 16:27039000-27039022 TTTTCCCCATGAGATAGAAGGGG + Intergenic
1136055056 16:27682335-27682357 TTGTCCCCATTTCACAGACGAGG + Intronic
1136058849 16:27710858-27710880 TTATTCCCATTTTAAAGAAGAGG + Intronic
1136475506 16:30510727-30510749 TTCTACCCATTGCAAAGATGAGG - Intronic
1136576355 16:31127569-31127591 CTGTCCCCATTCCAGAGAAGAGG - Intronic
1137475024 16:48800225-48800247 TTATCCCCATTTAACAGAAGAGG - Intergenic
1137753950 16:50886886-50886908 TTTTCCCCATTTTACAGATGTGG + Intergenic
1137822584 16:51460100-51460122 TTTTTCCCCTCCCAAAGAGGTGG + Intergenic
1137912629 16:52393653-52393675 TTATGCCCATTTCAAAGATGAGG - Intergenic
1138124818 16:54430106-54430128 TTGTCCCCATTCTACAGAGGAGG + Intergenic
1138188784 16:54997661-54997683 TTATCCCCATTGCACAGATGGGG + Intergenic
1138222859 16:55267689-55267711 ATTTCCCCTTTCCAAAAAATGGG - Intergenic
1140033220 16:71354661-71354683 TTTGACCCATTCCAAAGATAGGG - Intergenic
1141425523 16:83942205-83942227 TTTTCCACTGTCCAGAGAAGCGG - Intronic
1141631613 16:85291123-85291145 TTATCCCCATTTTACAGAAGGGG + Intergenic
1141751301 16:85960246-85960268 TTATCCCCATTACACAGATGGGG - Intergenic
1141764540 16:86049800-86049822 TTATGCCCATTACACAGAAGAGG - Intergenic
1141790455 16:86230878-86230900 TTTTCCCCATTCTACAGATGAGG + Intergenic
1141908794 16:87044708-87044730 TTATTCCCATTTCACAGAAGAGG + Intergenic
1141936424 16:87242061-87242083 TGATCCCCATTTCACAGAAGGGG + Intronic
1142867632 17:2800274-2800296 TTCTCCCCATTTCAGAGATGAGG - Intronic
1143105116 17:4525763-4525785 TTATCCCCATTTTAAAGATGAGG - Intronic
1143969668 17:10786369-10786391 ATGTTCCCATTCCATAGAAGAGG + Intergenic
1144396410 17:14848006-14848028 TTTTTTCCATTCTATAGAAGAGG - Intergenic
1144665719 17:17100962-17100984 TTCTCCCCATTCTACAGATGAGG - Intronic
1144755698 17:17679393-17679415 TTATCCCCATTCTACAGATGAGG + Intergenic
1144966410 17:19079338-19079360 TTATCCCCGTTCCACAGAAGGGG - Intergenic
1144981508 17:19172719-19172741 TTATCCCCGTTCCACAGAAGGGG + Intergenic
1144986716 17:19205520-19205542 TTATCCCCGTTCCACAGAAGGGG - Intergenic
1145198135 17:20914155-20914177 TTTCCCCCATTTTAAAGATGAGG + Intergenic
1145260665 17:21352580-21352602 TTGTTCCCATTTCACAGAAGGGG + Intergenic
1145836200 17:27956108-27956130 ATTTCCCCATTGCACAGATGAGG + Intergenic
1146644208 17:34566065-34566087 TTATCTCCATTTCACAGAAGAGG - Intergenic
1147263590 17:39222645-39222667 TTCTCCCCATGCCAGAGAATGGG - Intronic
1147554126 17:41465601-41465623 TTGTCCCCATTTTACAGAAGAGG + Intronic
1147587043 17:41658755-41658777 TTTTCCCCATTTTACAGAAAAGG + Intergenic
1148142677 17:45339485-45339507 GTTTTCCCATTCTACAGAAGAGG - Intergenic
1148160429 17:45446889-45446911 TTTTCCCCATTTTACAGATGAGG - Intronic
1148851678 17:50558700-50558722 TTTTCCCCTCTGCAAAGAAGGGG + Intergenic
1149472786 17:56932604-56932626 TTTTCTCCCTTTCACAGAAGAGG - Intergenic
1150391717 17:64793768-64793790 TTTTCCCCATTTTACAGATGAGG - Intergenic
1150574211 17:66415780-66415802 TTATCCCCATTTCACAGATGAGG - Intronic
1151095570 17:71493660-71493682 TTTTCCCCATTTTATAGATGAGG - Intergenic
1151267542 17:72968378-72968400 TTTTCTCCATTCCTAAGACCAGG + Intronic
1151998392 17:77628081-77628103 TTCTCCCCATTCCAAAGAGATGG + Intergenic
1152096032 17:78272108-78272130 TTCTCTCCACCCCAAAGAAGGGG + Intergenic
1152162565 17:78677976-78677998 TTATCCCCATTTCACAGATGAGG - Intronic
1152383294 17:79953483-79953505 ATTACCCCATTGTAAAGAAGAGG + Intronic
1203192650 17_KI270729v1_random:204427-204449 TTTTCCCCATTTTACAGAGGAGG + Intergenic
1203202017 17_KI270730v1_random:3862-3884 TTTTCCCCATTTTACAGAGGAGG + Intergenic
1153078576 18:1194005-1194027 ATTTCCCCATTTTACAGAAGAGG + Intergenic
1153581846 18:6581913-6581935 TTGTCCCCAGTCCTCAGAAGTGG - Intronic
1153722903 18:7924987-7925009 TTTTCTCCATTTCCAAGATGGGG - Intronic
1153908838 18:9688451-9688473 ATTTCCCCATTTCATAGAGGTGG - Intergenic
1155229483 18:23758579-23758601 TTTTCCCCATGCTAGAGAAGAGG + Intronic
1155307599 18:24493820-24493842 TCTTCCCCATCCCCTAGAAGGGG + Intergenic
1155968886 18:32062131-32062153 TTATCTCCATTTCACAGAAGGGG + Intronic
1156455070 18:37288477-37288499 TGTTCCCCATTCTACAGATGAGG + Intronic
1157905753 18:51568490-51568512 TTATCCCCCTTCCCAATAAGTGG - Intergenic
1158273366 18:55740390-55740412 TTTTCTCCATTTCACAGATGAGG - Intergenic
1158993175 18:62890895-62890917 TTTTCCCCATTTGAGAGAATGGG - Intronic
1159831280 18:73280785-73280807 ATTTCCCCTTTGCAAAGAATGGG - Intergenic
1160670421 19:359970-359992 TTGTCCCCATTCCACAGACGTGG - Intergenic
1160965356 19:1744897-1744919 TTATCCCCATTCCACAGATGGGG + Intergenic
1161838083 19:6661312-6661334 TTCTCTCCACCCCAAAGAAGGGG + Intronic
1162156943 19:8684630-8684652 TTATCCCCATTCTGTAGAAGAGG - Intergenic
1162852360 19:13440638-13440660 TTATTCCCATTCCACAGATGAGG + Intronic
1163284046 19:16335289-16335311 TTACCCCCATTTCAAAGAAGAGG - Intergenic
1163930239 19:20383124-20383146 CTTTTCCCATTTAAAAGAAGTGG - Intergenic
1164346919 19:27275668-27275690 TATTCCCGTTTCCAACGAAGGGG - Intergenic
1164567639 19:29339348-29339370 ATGCCCCCATGCCAAAGAAGAGG + Intergenic
1165927248 19:39334743-39334765 TTCTCCCCATTTCACAGATGAGG + Intronic
1168321935 19:55515999-55516021 TTATCCCCATTTTACAGAAGGGG - Intronic
925509256 2:4606632-4606654 TTTTTCCCATTTTAAAAAAGAGG + Intergenic
925591618 2:5515503-5515525 TTCTCACCACTCCAAGGAAGTGG - Intergenic
925641550 2:5990202-5990224 TTATCCCCATTCCACAAATGAGG + Intergenic
926410272 2:12595632-12595654 TTGTCCCCATGCCATAGAAAAGG + Intergenic
926923325 2:17961068-17961090 TTTTCCCTGTGCCTAAGAAGTGG + Intronic
928170555 2:29000398-29000420 GTGTCCCCATTCCACAGAGGAGG - Intronic
928422676 2:31151124-31151146 TTTACCCCTTTCTAAAGATGAGG - Intronic
928598960 2:32885029-32885051 TTATCCCCATTTTACAGAAGAGG - Intergenic
929378818 2:41324562-41324584 TTTTCCCCATTCCTTAAAACTGG + Intergenic
929439950 2:41957606-41957628 TTATCCCCATTCTATAGATGAGG + Intergenic
929631428 2:43466745-43466767 TTTTCCCCATTCAAGACATGAGG + Intronic
930064535 2:47317577-47317599 TTATCCCCATTTCATAGATGAGG - Intergenic
930664434 2:54088222-54088244 TTTTCCCCATTCCTCAGAAGAGG + Intronic
930866016 2:56122510-56122532 TTTTCTCCATTTTACAGAAGAGG - Intergenic
931224186 2:60315515-60315537 TTATCCCCATTTCATAGATGAGG + Intergenic
932411830 2:71552122-71552144 TTATCCCCATTTCACAGATGAGG + Intronic
932478792 2:72025672-72025694 TTATCCCCATTCCACAGATGAGG - Intergenic
932548775 2:72744501-72744523 TTTTCCCCCTTTCAAAGGAAAGG + Intronic
932800697 2:74740130-74740152 TTATCCCCATTTCACAGATGAGG + Intergenic
933707290 2:85301327-85301349 TTACCCCCATTCCAGAGATGAGG - Intronic
933739655 2:85523543-85523565 TGATCCCCATTTCACAGAAGAGG + Intergenic
934568493 2:95353551-95353573 TTATCCCCATTCTACAGATGAGG - Intronic
934617769 2:95785518-95785540 TCATCCCCATTCAAGAGAAGAGG + Intergenic
934643124 2:96039041-96039063 TCATCCCCATTCAAGAGAAGAGG - Intronic
934681513 2:96287132-96287154 TTATCCGCATGCCAAAGATGGGG - Exonic
935441485 2:103102995-103103017 TTTTCCCCCTTTCAAAAAACCGG - Intergenic
935555067 2:104501026-104501048 TCTTCCCTTTACCAAAGAAGTGG + Intergenic
935585307 2:104795594-104795616 GTTTCATCATTTCAAAGAAGTGG - Intergenic
935669197 2:105541032-105541054 GCTTCACCATTGCAAAGAAGTGG - Intergenic
935687982 2:105701550-105701572 TTTTCACCATTACATAGATGAGG - Intergenic
937319095 2:120950151-120950173 TGATCCCCATTCCACAGATGAGG + Intronic
937640036 2:124201853-124201875 TTTTCCACATTCCATAGTAATGG + Intronic
938031693 2:128000017-128000039 TTTTCCCCAGTAGAAGGAAGAGG + Intronic
938566726 2:132525309-132525331 TTATCCCCATTTCACAGATGAGG - Intronic
938596097 2:132788537-132788559 TTCTCCCCATTTCACAGAAGAGG - Intronic
939557789 2:143697536-143697558 TTTTCCAGATTCCTGAGAAGTGG + Intronic
939726604 2:145728191-145728213 TTATCCACACTTCAAAGAAGTGG + Intergenic
939996477 2:148925509-148925531 TTTTCCTCATTGTACAGAAGAGG + Intronic
940006664 2:149014593-149014615 TTTTCCCCATTTCATATATGAGG - Intronic
940185221 2:150977290-150977312 ATTTCTCCATTTCACAGAAGAGG - Intergenic
940912738 2:159223406-159223428 CTTTGCCCATTCTAAAGATGAGG + Intronic
941009526 2:160283842-160283864 TTATCCCCATTTTAAAGATGAGG + Intronic
941372280 2:164680446-164680468 TTTTCCCCATTCATAACATGGGG + Intronic
941757659 2:169205413-169205435 TTCTTCCATTTCCAAAGAAGAGG - Intronic
942311211 2:174658659-174658681 TTTTACCCATTTCAAGGAAATGG - Intronic
942414385 2:175743444-175743466 TTATCCCCATTTCATAGATGAGG - Intergenic
942826187 2:180179781-180179803 TTTTCCCCATTTCACAGTTGTGG - Intergenic
943060165 2:183034867-183034889 TTTTCCCCATTTTACAGATGAGG + Intronic
943309768 2:186311016-186311038 CTTTCCCCTTTCAAAAGCAGAGG - Intergenic
943409668 2:187531640-187531662 TTTTTCCCATTGCAGAGATGAGG - Intronic
943663237 2:190581303-190581325 TTTTTTCCATTCCAAATAATGGG - Intergenic
943767841 2:191680816-191680838 TTATTCCCATTTCACAGAAGAGG - Intronic
944201090 2:197108232-197108254 TTATCTCCATTTCAAAGATGAGG - Intronic
944869360 2:203894233-203894255 TTTTTCCCATTTTAAAGATGAGG - Intergenic
945325594 2:208478856-208478878 TTGTCCCCATTTCACAGATGAGG - Intronic
946459408 2:219855870-219855892 TTATCTCCATTTCACAGAAGGGG - Intergenic
946775919 2:223140932-223140954 TTTACCCCCTTACTAAGAAGGGG - Intronic
947914286 2:233821691-233821713 GTCTCCCTATTCCACAGAAGAGG - Intronic
948146350 2:235710962-235710984 TTATCCCCATTTCACAGATGAGG + Intronic
948149692 2:235735297-235735319 ATTTTCCCATTCCAAAAAAAGGG - Intronic
948466643 2:238155340-238155362 TTATCCCCATTGCACAGATGAGG - Intergenic
948604183 2:239124256-239124278 TTTTCACCATCCCTAAGAAGAGG + Intronic
948928083 2:241112302-241112324 TTTTCCCCTTTCCAAGTAGGCGG + Exonic
1168814199 20:725489-725511 TTTTCCCCACTCTCAACAAGGGG - Intergenic
1168823254 20:791589-791611 TTGTCCTCATTGCAAACAAGAGG + Intergenic
1168922224 20:1549575-1549597 TATACCCCATGGCAAAGAAGAGG - Intronic
1169193854 20:3673245-3673267 TTATCCCCATTTTACAGAAGAGG + Intronic
1169600865 20:7259195-7259217 ATTACCCCATTCCAAAGACTTGG - Intergenic
1169660551 20:7973885-7973907 TTATCCCCATTGCAAATATGAGG + Intergenic
1170046651 20:12092383-12092405 TTTTCTCCATGTCAAAGAATTGG + Intergenic
1170184564 20:13573715-13573737 TTTTCACCACTTCAAATAAGAGG - Intronic
1170949977 20:20927608-20927630 TCTTCTCAATTTCAAAGAAGAGG + Intergenic
1171046833 20:21816630-21816652 TTATCCCCATTTCACAGATGAGG - Intergenic
1171169146 20:23000083-23000105 TTATCCCCATTTTATAGAAGAGG - Intergenic
1172216169 20:33237396-33237418 TCCACCACATTCCAAAGAAGAGG - Intronic
1172853746 20:37985143-37985165 GTTTCCCCATTCCAAAAATGGGG + Intronic
1173070525 20:39760274-39760296 TTATCCCCATTTTACAGAAGAGG - Intergenic
1173200713 20:40952947-40952969 TTTTCCCCATGTCACAGATGAGG - Intergenic
1173552065 20:43939269-43939291 TTATCCCCATTTCACAGAGGAGG - Intronic
1173660525 20:44730117-44730139 TTATCCCCATTTTAAAGAAGGGG - Intergenic
1173685980 20:44923887-44923909 TATTCCCCATTTCACAGATGGGG - Intronic
1173705401 20:45106749-45106771 TTTTCCCCATTTCACACATGAGG - Intergenic
1173927517 20:46791982-46792004 CATTCCCCATTCCATAGTAGAGG + Intergenic
1173954137 20:47017772-47017794 TTATTCCCATTTCACAGAAGAGG + Intronic
1174193598 20:48757465-48757487 TTTTCCTCTTTCCTAAAAAGGGG - Intronic
1174771359 20:53303750-53303772 TTTTCTCCATTTCACAGATGGGG - Intronic
1174806262 20:53606826-53606848 TTTTCCCCATTTTACAGATGGGG + Intronic
1174922227 20:54716373-54716395 TTTTCCCCAGTTCAATAAAGAGG + Intergenic
1176701782 21:10061761-10061783 TTTTCCCCAGTCCCTAGAAATGG - Intergenic
1176911738 21:14573754-14573776 TCTCCTCCATTCCAAAGATGAGG + Intronic
1178046691 21:28702878-28702900 TATTCCCAATACCAAAGATGTGG + Intergenic
1178416917 21:32412169-32412191 TTATCGCCATTCCACAGAAGAGG - Intronic
1178583699 21:33856093-33856115 TTATCCCCATTTCACAGACGAGG - Intronic
1178704067 21:34858450-34858472 TTATCCCCATTTTACAGAAGAGG + Intronic
1178810601 21:35877916-35877938 TTTTCCCCACTCTATAGATGAGG + Intronic
1179029262 21:37705622-37705644 TTTTCCCCATTCTGAAAAATGGG - Intronic
1179080382 21:38165422-38165444 TTTTGCACATTACAAAGAAAGGG - Intronic
1181759743 22:25049954-25049976 TTATCCCCATTCTACAGATGAGG - Intronic
1181901191 22:26157273-26157295 TTATCCCCATTTCACAGATGAGG - Intergenic
1181959204 22:26610791-26610813 TTCTCCCCATTTCAAAGATGGGG + Intronic
1181960462 22:26618625-26618647 TTATGCCCATTTCACAGAAGAGG + Intergenic
1182106037 22:27690249-27690271 TCTCCCCCATTTCAAAGAAATGG - Intergenic
1182463872 22:30502312-30502334 TTATGCCCATTACACAGAAGAGG + Intronic
1182472362 22:30556276-30556298 TCGTCCCCATTTCACAGAAGAGG - Intronic
1182628060 22:31662843-31662865 TTATCCCCATTTTAAAGATGAGG + Intergenic
1182807205 22:33083120-33083142 ATTTCCCCATTCATAAGAAAAGG - Intergenic
1182897363 22:33869711-33869733 TTCTCCCCATTTCAGAGATGAGG + Intronic
1183139199 22:35920169-35920191 TTTTCCCCATTTTACAGCAGTGG - Intronic
1183154459 22:36064518-36064540 TTATCCCCATTTTACAGAAGAGG + Intergenic
1183198548 22:36370123-36370145 TTTTCCTCATTCCACAGATAAGG + Intronic
1183278130 22:36914093-36914115 TGCTCCCCATTCCACAGATGAGG - Intronic
1183377382 22:37473078-37473100 TTATCCCCATTCTATAGATGGGG - Intronic
1183426616 22:37743093-37743115 TTTTCCCCATTAGAAAGATGCGG + Intronic
1184152828 22:42648593-42648615 TTTGCCCCATTTCACAGATGGGG - Intronic
1184355327 22:43975713-43975735 TCTTACCCATTACAAAGAAGTGG + Intronic
1184492745 22:44819786-44819808 TTTTCCCCATTCCAAAGAAGAGG + Intronic
1184870849 22:47237690-47237712 TTGTCCCCATTTCACAGATGGGG + Intergenic
1184915374 22:47565274-47565296 TTTTCTCCATTCCACAGATTAGG - Intergenic
949415657 3:3811148-3811170 TTATCCCCATTTTAAAGATGTGG + Intronic
949722052 3:7000761-7000783 TTTTCCCCATTCCAAAGTAATGG - Intronic
950129401 3:10531701-10531723 TTATCCTCATTTCACAGAAGAGG - Intronic
950365048 3:12477152-12477174 TTCTCCCCATTTTAAAGATGAGG - Intergenic
950498442 3:13348483-13348505 ACTTCCCCATTACCAAGAAGAGG - Intronic
950792968 3:15487984-15488006 TTATCCCCATTGCATAGATGAGG + Intronic
950930668 3:16785638-16785660 TTTTCCCCATTTTATAGATGAGG + Intergenic
951026676 3:17838532-17838554 TTATCCCCATTCTACAGTAGAGG - Intronic
951086062 3:18514439-18514461 TTATCACCATTCTACAGAAGAGG + Intergenic
951344293 3:21527986-21528008 TTTTGCCCATTTCAAAGATGAGG + Intronic
951879734 3:27468693-27468715 TTATCCCCATTCTACAGATGAGG - Intronic
952010170 3:28891619-28891641 TTATCCCCATTTCATAGACGAGG + Intergenic
952291151 3:32017218-32017240 TTTTTCCCATTTTAAAGATGAGG + Intronic
952352572 3:32554519-32554541 GTTTCCCCATTTGTAAGAAGAGG - Intronic
952968162 3:38633663-38633685 TTTGCCCCATTCCACACAACAGG + Intronic
953217113 3:40930095-40930117 TGTTCCCCATTCCTCAGAAGTGG + Intergenic
953456118 3:43043580-43043602 TTGTTCCCATTTCAAAGATGAGG - Intronic
953489902 3:43340742-43340764 TTTTCCCCATTCTATAGGGGTGG + Intronic
954077735 3:48193659-48193681 TTTTCCCCACTCCATGGAAGTGG + Intergenic
954322601 3:49842255-49842277 CTTCCCCCATTCCAAGGAATGGG - Intronic
955000838 3:54926294-54926316 TTATCCCCATTTGAAAGATGAGG + Intronic
955083785 3:55682322-55682344 TTTTCCCCTTTGCCAAGAAAAGG + Intronic
955123744 3:56088448-56088470 TCATCCCAAATCCAAAGAAGGGG + Intronic
955391082 3:58522774-58522796 TTTTCCCCATTGCAAACTGGGGG - Intronic
955620432 3:60857464-60857486 TTATCCCCATTTTAAAGATGAGG - Intronic
955679753 3:61488010-61488032 TTTCCCCCATGTCATAGAAGAGG - Intergenic
955798067 3:62658524-62658546 TTATCCCCATTTCACAGATGAGG - Intronic
956356921 3:68404116-68404138 TTTTCCCCATTTTACAGATGAGG + Intronic
956641817 3:71422893-71422915 TTTTCTCCATATGAAAGAAGGGG - Intronic
956712552 3:72051144-72051166 TTTTCCCCATTTCACAGATGGGG - Intergenic
957936335 3:86948764-86948786 CTTTCCCATTTCGAAAGAAGAGG + Intronic
958005433 3:87803888-87803910 TTATCCCCATTTTACAGAAGAGG + Intergenic
958433368 3:94068131-94068153 TTTTCCCCATTTTACAGACGAGG - Intronic
959366620 3:105467987-105468009 TTTGCCCCATGAAAAAGAAGTGG + Intronic
959940888 3:112079813-112079835 TTTTCCTCATTTTATAGAAGAGG + Intronic
960037922 3:113120362-113120384 TTTTCCCCATTCTATAGGTGAGG + Intergenic
960053610 3:113260755-113260777 TTTTCACCATTCAATAGAATAGG + Intronic
960843117 3:121980141-121980163 TTTTCCAACTTCCACAGAAGGGG - Intergenic
961078126 3:124000668-124000690 CTGTCCCCATTCCATAGATGGGG + Intergenic
961204325 3:125068813-125068835 TTTTCCCCATTTTATAGAAGAGG - Intergenic
961305392 3:125956108-125956130 CTGTCCCCATTCCATAGATGGGG - Intergenic
961373825 3:126449451-126449473 CTTTCCCCATTTCACAGAAGGGG + Intronic
961744560 3:129056095-129056117 TTTTCCCCATTCTGCAGATGAGG + Intergenic
962164001 3:133029867-133029889 TGTTCCCCATTCATATGAAGGGG - Intergenic
962444677 3:135453973-135453995 TTATCCCCATTGCACAGATGGGG + Intergenic
964203927 3:154149106-154149128 TTTTCCCCATTTCACAGATGGGG - Intronic
964725165 3:159806804-159806826 TTTTCCCCTTTTCACAGAGGAGG + Intronic
965976501 3:174630485-174630507 TTTTCCCCATTCAAAAAAACAGG + Intronic
966056953 3:175705205-175705227 TTATCCTCATTTCACAGAAGAGG + Intronic
966802207 3:183774832-183774854 TTTTCCTCATACCTAAGCAGTGG + Intronic
967029786 3:185595098-185595120 TTTTCCCCATTTTACAGATGAGG + Intronic
967268048 3:187708800-187708822 TTTTCCCCATTTGACATAAGAGG + Intronic
967288783 3:187899055-187899077 TTATCCCCATTTTACAGAAGAGG - Intergenic
967345277 3:188448274-188448296 TTATCTCCATTACAAAGACGGGG - Intronic
967355206 3:188561567-188561589 TTTGCCACATTCCAAATAATTGG - Intronic
967878088 3:194280350-194280372 TTTTCTCCATTCTGAAGATGGGG - Intergenic
969084229 4:4643473-4643495 GTTTCCCCATTTCACAGATGAGG + Intergenic
969279914 4:6162793-6162815 TGTTCCCCATTCCAAAGCCTGGG + Intronic
969339666 4:6532239-6532261 TCATCCCCAGTCCATAGAAGGGG + Intronic
970218463 4:13783643-13783665 TTATCCCCATTCTACAGATGAGG + Intergenic
971045087 4:22797382-22797404 TTATCCCCATTTCACAGATGAGG + Intergenic
971268027 4:25111826-25111848 TTATCCCCATTTCACAGATGAGG + Intergenic
971565492 4:28133886-28133908 CTTTCCCCATCCAAAAGAAATGG + Intergenic
971839259 4:31812309-31812331 TTATCCCTATTTCAAAGAAGAGG - Intergenic
972214387 4:36878889-36878911 TTATCCCCATTTCACAGATGAGG - Intergenic
972795317 4:42411722-42411744 TTTTCCCCATTTAAAAAATGCGG - Exonic
973008299 4:45041891-45041913 TTTTCTGCATTCCACAGAGGAGG - Intergenic
973798823 4:54456082-54456104 TTTTCCCCATTTTACAGATGAGG - Intergenic
974353560 4:60782545-60782567 TTTTTCCCATTTTAAAGATGAGG - Intergenic
974652108 4:64767442-64767464 TTTTCATCTTTCCAAAGAAGAGG - Intergenic
975423829 4:74202770-74202792 TTTCTCTAATTCCAAAGAAGAGG + Intronic
976076310 4:81303081-81303103 AGTTGCCCATTCCAAAGAAGAGG + Intergenic
976143113 4:82013688-82013710 TTATCCCCATTTTAAAGATGAGG + Intronic
976184602 4:82431027-82431049 TCCTCCCCATTCCACACAAGAGG - Intronic
977558643 4:98510164-98510186 TTTTCCTCTTTCCTAAAAAGGGG - Intronic
977704396 4:100054881-100054903 GTTTCCCCATTTTACAGAAGAGG - Intergenic
978151866 4:105445763-105445785 GTTTCCTCATTCCCAGGAAGAGG - Intronic
978289023 4:107115737-107115759 TTTTCACCAGTCCAAGGAATAGG - Intronic
978538312 4:109786719-109786741 TTTTCCACATTTTATAGAAGAGG - Intronic
978594270 4:110359888-110359910 TTTTCCCCATTTTACAGATGAGG + Intergenic
978624727 4:110671860-110671882 TTATCCCCATTGCACAGATGAGG - Intergenic
980137408 4:128871982-128872004 GATTCCGGATTCCAAAGAAGGGG + Exonic
980373944 4:131918026-131918048 TTTTCCCCAGTCCCTAGAAATGG - Intergenic
982304949 4:153921404-153921426 TTATCCCCATTCTACAGATGAGG + Intergenic
982518072 4:156377619-156377641 TTTCCGCCATTTGAAAGAAGTGG + Intergenic
984503773 4:180591361-180591383 TTTTGCAGATGCCAAAGAAGTGG + Intergenic
984989033 4:185360539-185360561 TTTTCCCCTTTTCAATGGAGAGG + Intronic
985208268 4:187564307-187564329 TTTTCCACATACCAAATGAGAGG + Intergenic
986363863 5:7009647-7009669 TTATCCCCATTTTAAAGAAAAGG + Intergenic
986686860 5:10282450-10282472 TTTTAGCCATTCCACAGAAGTGG + Intronic
986834066 5:11614867-11614889 TTGTCCCCACTCCAGAGATGTGG - Intronic
987741573 5:21915683-21915705 TTTTCCCCATCCCAAGTAAGGGG - Intronic
988990497 5:36665695-36665717 TTTTTCACATTCCACAGAGGAGG + Intronic
989271392 5:39537675-39537697 TTCTCCCCATTTGAAAGATGAGG + Intergenic
989643523 5:43604980-43605002 TATTCCCCATTTTAAAGATGAGG + Intronic
990496682 5:56355013-56355035 TTATCCCCATTTTAAAGATGAGG + Intergenic
990695670 5:58413764-58413786 TTTTTCCCATTTTAAAGATGAGG - Intergenic
990756385 5:59075615-59075637 TGTACCCAATTCCAAATAAGTGG - Intronic
990802656 5:59622584-59622606 TTTTCTCCACTCAAAACAAGAGG + Intronic
990984864 5:61631971-61631993 ATTTGCCCTTTCCTAAGAAGAGG - Intergenic
991032545 5:62097702-62097724 TTTTCCCCATTTTACAGATGAGG + Intergenic
991384271 5:66067681-66067703 TTTTCCCCATTCAAATAAACTGG - Intronic
991395348 5:66198911-66198933 TTTCCCCTATTCCCAAGCAGAGG + Intergenic
991410435 5:66340220-66340242 TTTTTCCCATTTCAAATAATAGG - Intergenic
991698992 5:69299619-69299641 TTATCCCCATTTTAGAGAAGAGG - Intronic
992089184 5:73302897-73302919 TTATCCCCATTTTACAGAAGAGG + Intergenic
992490269 5:77235920-77235942 TTATCCCCATTTAAAAGATGAGG + Intronic
993019709 5:82576967-82576989 TTATCCCTATTCTAAAGATGAGG - Intergenic
993995785 5:94720929-94720951 TTTTCTCCACTCTACAGAAGAGG + Intronic
994154266 5:96485292-96485314 CTTTCCACACTTCAAAGAAGAGG - Intergenic
995314669 5:110754867-110754889 TTTTCTCCATTTCATAGATGAGG - Intronic
995407345 5:111813883-111813905 TATTCCAGATTCCAAAGATGTGG + Intronic
995964737 5:117891150-117891172 TTATCCCCATTTCAGAGATGAGG + Intergenic
996340477 5:122433295-122433317 TTATCCCCATTTCATAGATGAGG + Intronic
996403154 5:123084766-123084788 TCTTCAACAGTCCAAAGAAGAGG - Intergenic
996494205 5:124134495-124134517 TTTTCCCCATTTAACAGAGGTGG - Intergenic
997718570 5:136060202-136060224 ATTGTCCCATTCCACAGAAGAGG - Intronic
998096446 5:139398199-139398221 GTTTCCTCATTTCAAAGATGGGG + Intronic
998466780 5:142352869-142352891 TTATTCCCATTTCAGAGAAGAGG + Intergenic
998483364 5:142481150-142481172 TTTTCCTCATACCATAGATGAGG + Intergenic
998545177 5:143021640-143021662 TTATCCCCATTTTACAGAAGAGG - Intronic
998557726 5:143141970-143141992 TTTTTCCCTTTGCAAAGAAAAGG + Intronic
999028219 5:148259677-148259699 GCTTCCCCAACCCAAAGAAGTGG - Intergenic
999148128 5:149409191-149409213 TTATCCCCACTCCACAGATGAGG + Intergenic
999196226 5:149783423-149783445 TTTTCTCCATTTCACAGATGAGG - Intronic
999242239 5:150134591-150134613 TTTTCCCCATGTTACAGAAGAGG - Intronic
999679742 5:154045681-154045703 TTTTGCCCATTTTAAAGATGAGG + Intronic
999754311 5:154653259-154653281 TTTTCCCCATTTTACAGATGAGG + Intergenic
1000326476 5:160176093-160176115 CTTTCCCCACTCCAAAACAGAGG + Intergenic
1000696803 5:164396249-164396271 TTTTCCCCATTTTAAAGATAAGG - Intergenic
1000849268 5:166319890-166319912 TTTTTTCCTTTCCAAACAAGTGG - Intergenic
1001079700 5:168658569-168658591 TTTTCCCCTTTGCATAGGAGAGG + Intergenic
1001245040 5:170099736-170099758 TTGTCCCCATTTCATAGATGAGG - Intergenic
1001550060 5:172596198-172596220 TTCTCCCCATTCTACAGATGGGG + Intergenic
1001558953 5:172656829-172656851 TTATCCCCATCCTAAAGATGAGG - Intronic
1001599477 5:172919638-172919660 TTATCCCCATTCTACAGATGAGG - Intronic
1001825066 5:174737846-174737868 TTTTCCCCCTTACAAAGAGCAGG + Intergenic
1002089355 5:176795265-176795287 TTATCCCCATTCCACAGAGCGGG - Intergenic
1002327595 5:178420214-178420236 TTCCCCCCATTTCATAGAAGAGG - Intronic
1003342120 6:5231608-5231630 TTTTCCCTGTTGCAGAGAAGTGG + Intronic
1003384864 6:5657920-5657942 TATTCCCCATGTCACAGAAGAGG - Intronic
1003570574 6:7253894-7253916 ATTTCACCATTCCTAAGAAAGGG + Intergenic
1004739287 6:18441764-18441786 TTATCCCCATTTCACAGATGAGG - Intronic
1005479563 6:26242299-26242321 TTTTCACCATACCGAAGAAGTGG + Intergenic
1005840415 6:29741629-29741651 GTTTCCCCATTTCATAGATGAGG + Intergenic
1006023151 6:31129672-31129694 TTAGCCCCATTTCACAGAAGAGG - Intronic
1006168729 6:32081107-32081129 TTTCCCCCATTCCAAACACCTGG - Intronic
1006947208 6:37792636-37792658 TTTTGCCCATTACATAGATGAGG + Intergenic
1007294892 6:40814190-40814212 ATTTCTCCCATCCAAAGAAGAGG - Intergenic
1007368351 6:41409787-41409809 TCTTTCCCATTCCACAGAAGAGG + Intergenic
1007769770 6:44183432-44183454 TTATCCACATTCTAAAGAGGAGG - Intronic
1007940229 6:45773706-45773728 TTTTCCCCAGCCCAAAGCTGTGG - Intergenic
1008591932 6:53002594-53002616 CTTTACCCATTTCAGAGAAGGGG + Exonic
1008897169 6:56569359-56569381 TTTCCCCCATTCCAAATTTGTGG - Intronic
1009861195 6:69334865-69334887 TTTTCCCCATTTAACAGATGAGG - Intronic
1010033996 6:71300697-71300719 TTTTCCCCATTTTACAGATGAGG + Intronic
1010087783 6:71940771-71940793 GTTTCCCCATTCCACAGAGAAGG + Intronic
1010485083 6:76401241-76401263 TTTTTCCCATTCTACAAAAGAGG - Intergenic
1011036733 6:82985285-82985307 TTTTCCCCACTCCAAGGTAATGG + Intronic
1011265672 6:85515686-85515708 TTTTCCCCAACCCAAAAAATAGG + Intronic
1011424922 6:87216754-87216776 TTTTCCCCATTTTAAAGGTGAGG + Intronic
1011686940 6:89830874-89830896 TTTTCCCCATTTTACAGATGAGG - Intronic
1011719759 6:90143431-90143453 TTTTCCTTATTCCACAGATGAGG - Intronic
1012395713 6:98794897-98794919 TCATCCCCATTTCAAAGATGGGG - Intergenic
1014694809 6:124606826-124606848 TCTTGCTCCTTCCAAAGAAGGGG + Intronic
1016389072 6:143557291-143557313 TTTGCCCCATTTCACAGATGGGG + Intronic
1016800644 6:148165480-148165502 TTTTCCTCATTCGAAAGCAAAGG - Intergenic
1016975470 6:149803284-149803306 TTCTCCCCATTCTATAGAATAGG + Intronic
1017093525 6:150782783-150782805 TGTTCCTCATTCCAAGGCAGTGG - Intronic
1017242299 6:152183781-152183803 TTATCCCCATTCCAGAGACAAGG + Intronic
1018317860 6:162575122-162575144 TTTTCTCCATGGCATAGAAGAGG - Intronic
1018806669 6:167267226-167267248 TTTTCTCCATTCTATAGGAGAGG + Intergenic
1019900105 7:4013835-4013857 CCTTCCTCATTTCAAAGAAGGGG + Intronic
1020369875 7:7420189-7420211 TTTTCCAAATTCTAGAGAAGAGG - Intronic
1020480661 7:8656419-8656441 TTATCCCCATTACAGAGAAGAGG + Intronic
1021752578 7:23818311-23818333 TTTTCCCCAGTTGAAAAAAGTGG + Intronic
1021786880 7:24160987-24161009 TTATCCCCATTCTAAGGAAGCGG - Intergenic
1022036259 7:26537617-26537639 TTATCCCCATTTCACAGAGGTGG - Intronic
1022367101 7:29732091-29732113 TTTCCCCAATTCCTAAGAATTGG - Intergenic
1022468028 7:30664424-30664446 TTTTCCCCATTACATAGACATGG - Intronic
1022472797 7:30692079-30692101 TTATCCCCATTTTAAAGATGAGG - Intronic
1022487808 7:30793945-30793967 TTATCCCCATTTCACAGATGAGG + Intronic
1022499646 7:30874430-30874452 GTTTCTCCATTCCTAAGAGGAGG + Intronic
1022570883 7:31453211-31453233 TCATCCCCATTTCATAGAAGAGG + Intergenic
1022603371 7:31783510-31783532 TTTTTCCAATTCCAATTAAGAGG + Intronic
1022929072 7:35091780-35091802 TTTTCCCAATTCCTAAGAATTGG + Intergenic
1024618782 7:51139173-51139195 TTTTCCCCATTTTAAAGATGGGG - Intronic
1026283522 7:68943305-68943327 TTTTCCCCATTTTACAGATGAGG + Intergenic
1027422296 7:78028884-78028906 TTATCCCCATTTCAAAGATCAGG + Intronic
1027445454 7:78268507-78268529 GTGTCCCCATTACATAGAAGAGG + Intronic
1029725513 7:102401137-102401159 TTTTCCCCATTTTATAGATGAGG + Intronic
1029825177 7:103185371-103185393 TTTTCCCAGTTCCTAAGAATTGG + Intergenic
1029842419 7:103380086-103380108 TTTTAACCATTCAAATGAAGTGG + Intronic
1029930970 7:104370574-104370596 TTATCCCCATTTTAAAGATGAGG + Intronic
1030560832 7:111083656-111083678 CTTTCCCCTTTTCACAGAAGAGG - Intronic
1032175604 7:129622331-129622353 TTTTCCCCATTTGAAAAATGAGG + Intronic
1032347512 7:131130481-131130503 TTACCCCCATTTCACAGAAGTGG + Intronic
1032483101 7:132262456-132262478 TTTTCCCCTTTCCATGGAGGGGG + Intronic
1032519377 7:132532147-132532169 TTTTACCCATTCCAACAAACTGG + Intronic
1032642283 7:133783033-133783055 TTTTCCCCATTTTAAAGATGAGG - Intronic
1034042446 7:147893819-147893841 TTTTCCACATGTAAAAGAAGAGG + Intronic
1036523170 8:9511221-9511243 TTTTTCCCATTTCATAGATGAGG - Intergenic
1037295924 8:17400311-17400333 TTATCCCCATTTCACAGATGAGG + Intronic
1037670669 8:21012695-21012717 TTATCCCCATGTCACAGAAGAGG - Intergenic
1038703929 8:29876698-29876720 TTTTCCCATTTGCAAAGAGGAGG - Intergenic
1039598680 8:38814669-38814691 TATTCCCTATTCCACAGAACAGG + Intronic
1041131598 8:54707869-54707891 TTATCACCATTTCACAGAAGAGG + Intergenic
1042131080 8:65587268-65587290 TTTTCCCCAAGCCCAGGAAGTGG - Intergenic
1042186888 8:66145304-66145326 ATTTCGTAATTCCAAAGAAGAGG + Intronic
1042538781 8:69886461-69886483 TTTACCACATAGCAAAGAAGTGG + Intergenic
1042858624 8:73293029-73293051 TTTTCCCTATTTCAACCAAGAGG + Intronic
1043071295 8:75639209-75639231 TTTTACCCATCCAAAAGAATGGG + Intergenic
1043528742 8:81126408-81126430 TTATACCCATTCCAATTAAGCGG + Intergenic
1043871235 8:85435446-85435468 TTTTCTCCATTTCAAAGATGAGG + Intronic
1044407240 8:91842132-91842154 TTATCCCCATTTCACAGATGGGG - Intergenic
1044649178 8:94476297-94476319 TGTGTCCCAGTCCAAAGAAGAGG - Intergenic
1045559802 8:103249996-103250018 TTATTCTCATTCCAAAGATGAGG - Intergenic
1046223008 8:111239853-111239875 TTCTCCCAATTCACAAGAAGTGG + Intergenic
1046243334 8:111527068-111527090 TTATCCCAATTCCTAAGATGAGG + Intergenic
1046618716 8:116505001-116505023 TTTTTCACATTCCACAGATGAGG - Intergenic
1046966418 8:120171958-120171980 ATTTCCCCATTGAAAAGAACAGG - Intronic
1047056885 8:121174752-121174774 TTATCCCCACTTCACAGAAGAGG - Intergenic
1047076318 8:121408052-121408074 TTTTCCCCATTTGACAGATGGGG - Intergenic
1047932945 8:129748934-129748956 TTTTCACCATTTCATAGATGTGG - Intronic
1047969938 8:130075947-130075969 TTTTCCCCATTTTACAGATGAGG + Intronic
1048028361 8:130607632-130607654 TTATCCCCATTTCACAGATGTGG + Intergenic
1048291918 8:133187652-133187674 TTATCCCCATTCGACAGATGAGG - Intergenic
1048998984 8:139812838-139812860 TTTCCCCCATTCCATAGTTGAGG - Intronic
1050760970 9:9070529-9070551 TTTTGCCCATTTGAAAAAAGGGG + Intronic
1051147941 9:14048930-14048952 TTTCTCCCATTCCAAACAATGGG + Intergenic
1051538757 9:18190868-18190890 TCTTTGCCATTCCAGAGAAGTGG + Intergenic
1051636143 9:19182595-19182617 TTCTCCCCATTCTAATTAAGTGG - Intergenic
1051803019 9:20958105-20958127 TTTTCTCCATTTTACAGAAGTGG - Intronic
1052142990 9:25010856-25010878 TTTCCCCCAGTCCAAGTAAGAGG + Intergenic
1052403291 9:28027645-28027667 TTTTCCCCATTTTAAAGAAACGG - Intronic
1055002039 9:71462482-71462504 TTATCCCCATATCACAGAAGAGG + Intergenic
1055874880 9:80930218-80930240 TTTTCCCTATTCAAAAAAAATGG + Intergenic
1056096700 9:83261892-83261914 TTTTCCCCATTTTACAGATGAGG - Intronic
1056616619 9:88173181-88173203 TTATCCCCATTGTAAAGATGAGG + Intergenic
1057409739 9:94807558-94807580 TTTTTTCCATTGCAAAGAAAAGG + Intronic
1058176520 9:101741482-101741504 TCATCCCCATTCTAAAGAAAAGG + Intergenic
1058642533 9:107101358-107101380 TTGTCCCCATTTTAAAGAGGAGG - Intergenic
1058792498 9:108464310-108464332 TTTTCTCCATTTCACAGAGGAGG + Intergenic
1059342127 9:113603222-113603244 TTCTGTCCATTCCAAGGAAGGGG + Intergenic
1059683257 9:116606802-116606824 TTTTTCCCATTCCACAGAAAAGG + Intronic
1059715387 9:116908335-116908357 TTTTCCCCATTTTACAGATGAGG - Intronic
1060048266 9:120358402-120358424 TTATCCCCATTTCACAGATGAGG + Intergenic
1060347498 9:122829485-122829507 GTTTCACCATTTTAAAGAAGCGG + Intergenic
1060667567 9:125441395-125441417 TTGTCCCCATTTTATAGAAGAGG - Intronic
1060849722 9:126864266-126864288 TTATCCCCATTCTACAGACGAGG - Intronic
1061080040 9:128364603-128364625 TTATCCCCATTTCACAGATGAGG + Intergenic
1061421535 9:130475399-130475421 TTTTCCCCATTTTACAGATGAGG + Intronic
1061446427 9:130640749-130640771 ATCTCCCCATTTCACAGAAGAGG + Intergenic
1061653805 9:132072293-132072315 TTATCCCCATTCTACAGATGAGG + Intronic
1061872531 9:133528473-133528495 TTCTCCCCATTTTACAGAAGAGG + Intronic
1062095048 9:134698799-134698821 TGTTCCCACTTCTAAAGAAGGGG + Intronic
1062385833 9:136311194-136311216 TTATCCCCATTTCACAGATGGGG + Intergenic
1062421577 9:136484897-136484919 GTTTGCCCTTTCCAAAGAGGGGG + Exonic
1202786798 9_KI270719v1_random:31849-31871 TTTTCCCCAGTCCCTAGAAATGG - Intergenic
1185834612 X:3333512-3333534 ATGTCCCCTTTACAAAGAAGAGG + Intronic
1186560025 X:10601767-10601789 TCTTCCCCATTCCCAATAATTGG - Intronic
1187235395 X:17462644-17462666 TTATCCCCATTTCACAGATGAGG + Intronic
1187529466 X:20083322-20083344 TTTTGGCCATTCCACAGAAAAGG + Intronic
1187975005 X:24696151-24696173 TTATCCCCATTTCACAGATGTGG + Intronic
1187988802 X:24847033-24847055 TCTTCCCATTTCCAAAGCAGTGG - Intronic
1188047287 X:25440694-25440716 TTTTCCCCATTCCAAAATTTTGG + Intergenic
1188617544 X:32176964-32176986 TTTTCCCATTTCAAAAGAAATGG + Intronic
1189738255 X:44093117-44093139 TTTTCCCCATTTTATAGAAGAGG - Intergenic
1190517166 X:51235794-51235816 GATTCCCCATTGCAAAGAAAAGG + Intergenic
1190790197 X:53692413-53692435 TTATCCCCATTTTACAGAAGAGG - Intergenic
1191662728 X:63667635-63667657 TTTTCCCCAGTCTAAAGGATGGG + Intronic
1191663623 X:63675520-63675542 TTTTCCCCATTTTACAGATGAGG - Intronic
1192101975 X:68274249-68274271 TTTTCCCCATTTCACAAATGAGG - Intronic
1192439393 X:71163658-71163680 TTATCCCCATTTTACAGAAGAGG + Intronic
1193216434 X:78869800-78869822 CTATCCCCATTTCAAAGATGAGG - Intergenic
1194421654 X:93682173-93682195 TTATCCCCATTCTACAGATGAGG - Intronic
1194449018 X:94019216-94019238 TTTTTCCCATTCCAAATTTGAGG + Intergenic
1194660152 X:96621961-96621983 TTTTCCCTGTCCCAAAGAAAAGG - Intergenic
1194752944 X:97704925-97704947 TTCTCCTCATGCCAAAGAAGCGG - Intergenic
1195091452 X:101463537-101463559 TTATCCTCATTTTAAAGAAGTGG + Intronic
1195230869 X:102845507-102845529 TTATCCCCATTTTACAGAAGGGG - Intergenic
1195234590 X:102883996-102884018 TTATCCCCATTATACAGAAGGGG - Intergenic
1195293341 X:103450158-103450180 TTCTCCCCATTCTACAGAGGGGG - Intergenic
1195389912 X:104350889-104350911 TTATCCCCATTTCAAAGATGAGG - Intergenic
1195503960 X:105635645-105635667 TTTTCCCGATTTTAAAGATGAGG + Intronic
1196251772 X:113469086-113469108 TTTTCCCCAGTCCAATGATATGG - Intergenic
1197871768 X:131068414-131068436 TGTTCCCCATTCCCAAGCAAAGG + Intronic
1198632292 X:138654127-138654149 TTTTCCCCATTTTAAAGATGAGG - Intronic
1199191872 X:144980556-144980578 TTTTCCCCTTTCCAAAGGCAGGG - Intergenic
1199538021 X:148925700-148925722 TTATCCCCATTACACAGATGAGG - Intronic