ID: 1184493271

View in Genome Browser
Species Human (GRCh38)
Location 22:44822926-44822948
Sequence ATGTAGGCCCAGATGAATAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 97
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 87}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184493266_1184493271 29 Left 1184493266 22:44822874-44822896 CCTGTCTCCTGGATGCTGAAAGC No data
Right 1184493271 22:44822926-44822948 ATGTAGGCCCAGATGAATAGAGG 0: 1
1: 0
2: 0
3: 9
4: 87
1184493267_1184493271 22 Left 1184493267 22:44822881-44822903 CCTGGATGCTGAAAGCTTAATTG 0: 1
1: 0
2: 0
3: 11
4: 115
Right 1184493271 22:44822926-44822948 ATGTAGGCCCAGATGAATAGAGG 0: 1
1: 0
2: 0
3: 9
4: 87

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184493271 Original CRISPR ATGTAGGCCCAGATGAATAG AGG Intronic
903533684 1:24052251-24052273 CTGGAGGCCCAGGTGAAAAGAGG + Intergenic
910501007 1:87890530-87890552 ATGTAAGCCCAGATGAGTATGGG - Intergenic
910890577 1:92015175-92015197 ATGTAGTCCCAGCTACATAGAGG + Intergenic
912406763 1:109445585-109445607 ATGTAAGCCCAGATCCATATGGG + Intergenic
912661823 1:111538532-111538554 ATTTAGGACAAAATGAATAGTGG - Intronic
918656986 1:187039377-187039399 ATGTAGACAAAGAAGAATAGAGG + Intergenic
923616900 1:235545704-235545726 ATGTAGGCCCAGAGCAGCAGAGG - Intergenic
1066197297 10:33113027-33113049 ATTTAGGCCCAGATGACTCTTGG + Intergenic
1066478833 10:35775235-35775257 CTGAAGGCTCAGATGATTAGCGG - Intergenic
1068588792 10:58832286-58832308 ATGGAGGCCCACATGAAGGGTGG - Intergenic
1070587932 10:77780371-77780393 ATGTCGGCCCAGATCAAGGGTGG - Intergenic
1071746544 10:88426290-88426312 AAGTAGGCTCATGTGAATAGTGG + Intronic
1072996576 10:100250021-100250043 AAATAGGCCCAGAGGAATAAAGG - Intronic
1075337146 10:121616754-121616776 ATGATGGCGCAGATGAATGGAGG - Intergenic
1077200334 11:1303727-1303749 TTAGAGGCCCAGATGAACAGAGG + Intronic
1087536044 11:99446920-99446942 AAGTAAGCCCAGAAAAATAGGGG - Intronic
1090307113 11:125701004-125701026 AAGTAGACCCAGATAAATTGAGG - Intergenic
1091119359 11:133043876-133043898 ATGTATGCACAAATGAATAAAGG - Intronic
1092819510 12:12340157-12340179 ATCTAGGCCATGATGAATAGAGG - Intronic
1111867648 13:93789664-93789686 ATGTAGGCAGAAATGATTAGAGG + Intronic
1112779191 13:102879479-102879501 ATGTATACACAGATGAATCGAGG - Intergenic
1114283048 14:21212258-21212280 CTGTAGCCCCAGATGCTTAGGGG - Intronic
1115329980 14:32186669-32186691 ACCTAGGTCAAGATGAATAGAGG - Intergenic
1116202020 14:41808965-41808987 TTATAGTGCCAGATGAATAGAGG - Intronic
1121065536 14:90960555-90960577 ATTTATGCCCAGTTGAAAAGGGG - Intronic
1121416322 14:93781585-93781607 ATGAAGGCACAGATGTATAAGGG + Intronic
1127405275 15:58638090-58638112 AGGCAGGCACAGAAGAATAGAGG - Intronic
1128340803 15:66821388-66821410 ATGGAGGCCCAGATCAAGTGGGG - Intergenic
1134819790 16:17237680-17237702 AACTAGGCCCAGATGAATATTGG - Intronic
1139257758 16:65559346-65559368 ATGTAGTCCCAGATACCTAGAGG - Intergenic
1152401789 17:80070894-80070916 AGGCAGGCCCAGATGGACAGGGG - Intronic
1154937673 18:21077581-21077603 ATCTAGGCCCAGAGGAGAAGTGG + Intronic
1160125369 18:76166859-76166881 AAGGAGGCTCAGATGAAGAGGGG - Intergenic
1160247162 18:77168136-77168158 ATGCAGGCCCAGCTGAATCCAGG - Intergenic
1164608395 19:29616290-29616312 ATGCAGGGCCAGAGGAAAAGCGG + Intronic
931160660 2:59686724-59686746 ATGAATGAACAGATGAATAGAGG - Intergenic
943369688 2:187001916-187001938 ATGTCGGCCCAGATCAAGGGTGG - Intergenic
945322209 2:208437571-208437593 TTGTTGGCCCAGAGGAACAGTGG + Exonic
945811840 2:214558375-214558397 ATCTAAGCAGAGATGAATAGGGG - Intronic
948489104 2:238300309-238300331 ATGTAGGGCCACATGCATGGAGG + Intergenic
1169503422 20:6183579-6183601 ATGTAGGGCCAGATGATGAAGGG + Intergenic
1169804321 20:9543761-9543783 ATGCAGGGCCAGAGGAGTAGAGG - Intronic
1172551497 20:35803975-35803997 ATGTAGTCCCAGATACATGGAGG - Intronic
1173187457 20:40851571-40851593 ATGCAGGCCCCAATGAATGGCGG + Intergenic
1175455556 20:59109960-59109982 AGGAGGGCCCAGATGAATAAGGG - Intergenic
1175487058 20:59354113-59354135 CAGTCGGCCCAGAGGAATAGTGG - Intergenic
1178449167 21:32677562-32677584 ATGTAGGCACAGGTGGAAAGAGG + Intronic
1181122411 22:20680383-20680405 ATGAAGGCCCAGATGAGTGCAGG + Intergenic
1181122984 22:20684789-20684811 ATGAAGGCCCAGATGAGTGCAGG + Intergenic
1181180012 22:21060702-21060724 ATGAAGGCCCAGATGAGTGCAGG - Intronic
1182017309 22:27051639-27051661 AAGTTGGCCCAGAGGAATGGTGG + Intergenic
1183826327 22:40390697-40390719 TTGGGGGCCCAGAGGAATAGGGG + Intronic
1184493271 22:44822926-44822948 ATGTAGGCCCAGATGAATAGAGG + Intronic
1184826666 22:46957183-46957205 CTGTATGCCCAGGTGAAGAGGGG - Intronic
953746338 3:45576846-45576868 GTGTAGGCCAAGCTGAATATAGG + Intronic
953891034 3:46751626-46751648 AAGTGGGTCCACATGAATAGAGG + Intronic
956861401 3:73327446-73327468 ATGTGGGCACAGATGAGTAAGGG + Intergenic
961435182 3:126911972-126911994 AAGTAGGCCAGGATGAATTGTGG + Intronic
962868277 3:139465963-139465985 ATGTTGGCCAAGAAGACTAGAGG - Intronic
971595838 4:28527320-28527342 ATGTAGGGCCAGATCATTCGTGG - Intergenic
971776950 4:30978091-30978113 ATGTATGCCCCAATTAATAGAGG + Intronic
978546486 4:109876458-109876480 ATGGAGGCCCAGAACACTAGGGG - Intergenic
980791629 4:137628271-137628293 ATGGAGGCTCAGATGAAAAGAGG + Intergenic
981486746 4:145294886-145294908 ATGTAGGGCCAGATGATAAAGGG - Intergenic
981946290 4:150347951-150347973 AAATAGGCACAGATGACTAGAGG - Intronic
987731034 5:21773342-21773364 ATGGAGGCCCACCTGAATTGAGG - Intronic
988122724 5:26988290-26988312 ATATAGGTCCAGATGAATAATGG + Exonic
988433064 5:31142230-31142252 ATGGAGGCCCTGATGGATAAAGG - Intergenic
988502191 5:31792725-31792747 TTATAGGCCCAGATAAATAATGG - Intronic
990102523 5:52210140-52210162 TTGTAGCCTCAGATGAAAAGAGG - Intergenic
990335124 5:54764872-54764894 ATGTGGGCACAGATGCACAGAGG - Intergenic
998379906 5:141716885-141716907 ATTGAGGCCCAGAGGAAAAGTGG - Intergenic
999594978 5:153192945-153192967 CTGTGGGCACAGGTGAATAGTGG - Intergenic
1000637045 5:163656315-163656337 ATTTAGGACCAGGTCAATAGAGG + Intergenic
1004875397 6:19946173-19946195 ATGCAGGCACAGAGGCATAGAGG - Intergenic
1005478375 6:26231493-26231515 ATGAAGGCCCAGAGGTACAGGGG - Intergenic
1013990819 6:116252566-116252588 ATGAAGGCCCAGAGGAAGAATGG + Exonic
1016328808 6:142934824-142934846 ATGTAGGCCAAGACAAATGGAGG - Intronic
1017920902 6:158871001-158871023 ATTTAAGTCCAAATGAATAGTGG - Intronic
1020339193 7:7090997-7091019 ATATTGGCCCAGATGAAAATGGG + Intergenic
1024029477 7:45445976-45445998 ATGTAGGCCAAGCTAAATATGGG + Intergenic
1026132957 7:67635520-67635542 ATGGAGGCCCAGCTGAGGAGGGG - Intergenic
1032481485 7:132250683-132250705 ATGGAGGCCCAAAGGAATGGGGG + Intronic
1032669673 7:134071712-134071734 ATGTAGGCCCAGCTAACTATGGG - Intergenic
1033097222 7:138442182-138442204 ATGTTGGCCCAGATCAAGGGTGG + Intergenic
1036056914 8:5265517-5265539 ATGTAGCCCCACATTAATTGGGG + Intergenic
1038095817 8:24308677-24308699 ATGTGGGCCTAGATAAGTAGAGG - Intronic
1042905099 8:73764634-73764656 CTGTAGTCCCAGATGCCTAGGGG - Intronic
1043410884 8:79993850-79993872 ATGTAGGGTCAGATAAAGAGTGG - Intronic
1186623326 X:11264513-11264535 GTGTAGTCCCAGTTGAATTGTGG + Intronic
1188375941 X:29427970-29427992 ATGTAGGCCCAGATAACTACGGG - Intronic
1190597330 X:52062534-52062556 ATGAGGGCCCAGATGAATATCGG - Exonic
1190611494 X:52191539-52191561 ATGAGGGCCCAGATGAATATCGG + Exonic
1193899239 X:87155830-87155852 TTATAGTCCCAGAAGAATAGAGG - Intergenic
1196115147 X:111991256-111991278 ATGTAGGCCCAGAGGAAAATGGG - Intronic
1196545429 X:116959059-116959081 ATGGAGGCAAAGATGTATAGTGG - Intergenic
1199540210 X:148950236-148950258 AGGTAGGCCCAGAGGAAATGAGG + Intronic