ID: 1184493729

View in Genome Browser
Species Human (GRCh38)
Location 22:44825460-44825482
Sequence CTGTAGACACAACAGAGGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 3, 3: 16, 4: 181}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184493729_1184493735 14 Left 1184493729 22:44825460-44825482 CCCAGCCTCTGTTGTGTCTACAG 0: 1
1: 0
2: 3
3: 16
4: 181
Right 1184493735 22:44825497-44825519 TCCAGAGCCTGCACGAGGGCCGG 0: 1
1: 0
2: 0
3: 22
4: 205
1184493729_1184493734 10 Left 1184493729 22:44825460-44825482 CCCAGCCTCTGTTGTGTCTACAG 0: 1
1: 0
2: 3
3: 16
4: 181
Right 1184493734 22:44825493-44825515 AAGCTCCAGAGCCTGCACGAGGG 0: 1
1: 0
2: 2
3: 6
4: 108
1184493729_1184493733 9 Left 1184493729 22:44825460-44825482 CCCAGCCTCTGTTGTGTCTACAG 0: 1
1: 0
2: 3
3: 16
4: 181
Right 1184493733 22:44825492-44825514 GAAGCTCCAGAGCCTGCACGAGG 0: 1
1: 0
2: 2
3: 12
4: 183

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184493729 Original CRISPR CTGTAGACACAACAGAGGCT GGG (reversed) Intronic
901881240 1:12194997-12195019 CTGTAAACACAATGGAGGCAAGG - Intronic
904684855 1:32252502-32252524 CTGTAGACAGGAGAAAGGCTGGG - Intronic
905918715 1:41704501-41704523 CTGTAGCCACCACAGGGACTGGG - Intronic
907604705 1:55805033-55805055 CTCTAGTCTCAACAGAGTCTGGG + Intergenic
914522343 1:148428913-148428935 CTGTAGAAACAAAAGAGGACGGG + Intergenic
914720628 1:150285851-150285873 CTGTAGTCCCAGCTGAGGCTGGG + Intronic
914783114 1:150803786-150803808 ATGGAGAGAAAACAGAGGCTAGG - Intronic
917371231 1:174296318-174296340 CTGGAGACAAAAGAGATGCTGGG + Intronic
918138543 1:181700244-181700266 CTGTGGACTCAACAGGGGTTTGG - Intronic
919806048 1:201381648-201381670 CGGCAGGCACAACAGATGCTGGG - Exonic
920199671 1:204251839-204251861 CTGGAGGCACTGCAGAGGCTGGG + Intronic
920512594 1:206562024-206562046 CTGTAGACCCAAGAAAGCCTAGG - Intronic
921338344 1:214110223-214110245 CTGTAGAGAAAACTGAGGCAAGG + Intergenic
922453613 1:225756434-225756456 CTGTTGTCACAACACAGGCCTGG + Intergenic
924728535 1:246691876-246691898 CTGAAGACACAACAGAGACAGGG - Intergenic
924802802 1:247339864-247339886 CAGGACACACAACAGAGTCTGGG - Intergenic
1064998555 10:21317143-21317165 CTAAATACACAACAGAGGCCGGG - Intergenic
1070304219 10:75228845-75228867 ATGAAGACACACCAGAGGCCAGG - Intronic
1071994235 10:91131101-91131123 CTGCAAACACACTAGAGGCTGGG + Intergenic
1074026287 10:109639331-109639353 CTTAAGACACAATATAGGCTTGG + Intergenic
1076680324 10:132168366-132168388 TTTCAGAAACAACAGAGGCTTGG + Exonic
1076917326 10:133430782-133430804 CCGTGGACACAAAGGAGGCTGGG + Intergenic
1076937423 10:133575541-133575563 CCGTGGACACAAAGGAGGCTGGG + Intergenic
1077336873 11:2009266-2009288 CTGTAGGGTCAGCAGAGGCTGGG - Intergenic
1078436154 11:11327613-11327635 CTGCAGACCCAGCAGTGGCTTGG + Intronic
1080754402 11:35182264-35182286 CTGTTCACACAACAAAGGGTAGG - Intronic
1081589841 11:44414363-44414385 CTGTAGTCTCATCAGAAGCTTGG + Intergenic
1081685763 11:45041992-45042014 CTGTAGCCAGCACAGAGCCTGGG - Intergenic
1084996258 11:72982111-72982133 CAGAAGTCACAACAGAAGCTAGG + Intronic
1086896907 11:92323671-92323693 CTGTCGATAGAACAAAGGCTGGG - Intergenic
1088171913 11:107007953-107007975 CTGTAGACACAACAGTTATTTGG - Intronic
1090917206 11:131176079-131176101 CTTTAGACTCAACAGAAGTTTGG - Intergenic
1202819857 11_KI270721v1_random:64448-64470 CTGTAGGGTCAGCAGAGGCTGGG - Intergenic
1096355666 12:50938554-50938576 CTGTAGAGTCCACAGGGGCTGGG - Intergenic
1098933982 12:76455692-76455714 CTATACAGACAAAAGAGGCTAGG + Intronic
1104729441 12:131096990-131097012 CTGCAGCCACAGCAGAGGCGTGG - Intronic
1107282817 13:38755945-38755967 ATGTAGACACAGCTGTGGCTTGG - Intronic
1107998981 13:45889369-45889391 CTGGAATGACAACAGAGGCTCGG + Intergenic
1109579592 13:64310078-64310100 GTTTAGACACAACAGACCCTTGG + Intergenic
1110290711 13:73803708-73803730 CTGGAGACACAAAGAAGGCTAGG + Intronic
1111527567 13:89492215-89492237 ATGTAGACACAACACCAGCTGGG - Intergenic
1113625460 13:111793064-111793086 CTGCAGGTACAAGAGAGGCTGGG - Intergenic
1118010927 14:61609738-61609760 CTGGAGACACAGCAGAGGGAAGG - Intronic
1119430577 14:74565682-74565704 CTGTAGACACAGTTGGGGCTGGG + Intronic
1121728915 14:96172834-96172856 CAGCAGACACACCAGAGGCATGG + Intergenic
1127945196 15:63744445-63744467 CTCTAGACCCACCTGAGGCTTGG - Intronic
1128222389 15:65978557-65978579 CTGGAGACACTGCTGAGGCTCGG - Intronic
1128712846 15:69885038-69885060 CTGCTGACACAAGAGAGGATGGG - Intergenic
1128740921 15:70083187-70083209 ATGGAGACCCAACAGAGACTTGG + Intronic
1129343343 15:74900600-74900622 CTGCAGACACAAGAAAGGCCTGG + Exonic
1130666444 15:85873659-85873681 CTGCAGACACAATACAGGCAGGG + Intergenic
1132616230 16:842304-842326 CTGGAGACACAACACAGCCCTGG - Intergenic
1133644652 16:7753223-7753245 CTGTAGAAATACCATAGGCTGGG + Intergenic
1137907858 16:52342609-52342631 CTGAAGACAGGACAGATGCTGGG + Intergenic
1138291916 16:55855100-55855122 CTGTGGGCACCACAGAGCCTTGG + Intronic
1138314484 16:56057146-56057168 CTGTAGATGCAACAGAGACATGG + Intergenic
1139290042 16:65849718-65849740 CTCTAGACACAAGAGAGGCTGGG - Intergenic
1139376156 16:66498012-66498034 CTGTAAAGACCACTGAGGCTAGG + Intronic
1140906047 16:79410055-79410077 CTGTAACCACAGCAGAGTCTTGG + Intergenic
1142585084 17:967172-967194 GTGTGGACACAACTCAGGCTTGG + Intronic
1143027299 17:3948471-3948493 CTTAAGACAGAAGAGAGGCTGGG - Intronic
1146562111 17:33879161-33879183 CTGTAAAGACTACTGAGGCTAGG + Intronic
1146626967 17:34442264-34442286 CTGCAAACCCTACAGAGGCTTGG + Intergenic
1147367110 17:39966254-39966276 CTGCAGACCCAACAGACACTGGG + Exonic
1149651451 17:58278873-58278895 CTGTGGACACAAGGGAGGCAGGG + Intronic
1149774026 17:59343345-59343367 CTGTAGACACTACTGGGGGTGGG + Intronic
1149871526 17:60186347-60186369 CTGCAGACTTTACAGAGGCTAGG + Intronic
1150648210 17:66993001-66993023 CTGTAGACACAGCGCACGCTAGG - Intronic
1150723997 17:67636762-67636784 CTGTAAACACACCAGGGACTGGG + Intronic
1150752237 17:67875550-67875572 CTGTAGAGCCAACAGAAGTTGGG + Intronic
1152770859 17:82168008-82168030 CTTTAGACACAACAGAAGGAAGG - Intronic
1154369231 18:13743530-13743552 CTGTAGACACAGGAAAAGCTGGG + Intronic
1155459359 18:26059590-26059612 CTGTAGTCTCAACAGAGAGTTGG - Intronic
1156201350 18:34835640-34835662 CTGTACACAGTACTGAGGCTAGG + Intronic
1160852683 19:1200691-1200713 CAGTAGGATCAACAGAGGCTGGG - Intronic
1163520821 19:17790620-17790642 CTGGGGACACAAATGAGGCTGGG + Intergenic
1163524147 19:17810193-17810215 CTGAAAACACAAAAGTGGCTAGG + Intronic
1165341066 19:35212523-35212545 CTTGAGAATCAACAGAGGCTGGG + Intergenic
1166408237 19:42539120-42539142 TTCTAGACACATCTGAGGCTTGG - Intronic
1166636657 19:44457145-44457167 GTGAAGACACAAAAGAGACTGGG + Intergenic
1166893632 19:46009590-46009612 CTGGGGAAACAACAGAGGCTCGG - Intronic
925513993 2:4659136-4659158 CTACACACACAACAGAGGGTGGG - Intergenic
926715421 2:15920202-15920224 CAGTAAACAAAACAGAGACTAGG + Intergenic
926782291 2:16484461-16484483 CTATAAACACATCTGAGGCTGGG - Intergenic
927770569 2:25857323-25857345 ATCTAGACACAAGAGAGTCTAGG + Intronic
929555188 2:42921485-42921507 CTGGGGACAGGACAGAGGCTTGG + Intergenic
929588036 2:43128196-43128218 ATGTAGCCACAACATAGGGTTGG + Intergenic
929596210 2:43177969-43177991 CTGTAGACCCAACAGTGGATAGG + Intergenic
929884574 2:45867042-45867064 CTGCTGAAACAACAGAGGCCTGG - Intronic
931278764 2:60768475-60768497 CAGTAGCCACAACAGAAGGTGGG - Exonic
932726336 2:74182893-74182915 CTGTAGTCCCAGCTGAGGCTGGG + Intergenic
933977314 2:87521929-87521951 CTGGAGACAAAACAGTGGATGGG + Intergenic
936316508 2:111428876-111428898 CTGGAGACAAAACAGTGGATGGG - Intergenic
937615915 2:123922138-123922160 CTGTACACATAACAGAGACTTGG + Intergenic
937763074 2:125628600-125628622 ATGAAGACACAACTGAGACTGGG - Intergenic
938954257 2:136283495-136283517 CTGTGGACAAAGCAGGGGCTGGG - Intergenic
939635849 2:144581920-144581942 CTGCAGCCCCAACAGAGGCTTGG + Intergenic
940517139 2:154697425-154697447 CTGCAGGCTCAACTGAGGCTCGG + Intergenic
945042406 2:205753157-205753179 CTGTAATCACAAGAGAGGCTGGG - Intronic
948069548 2:235109208-235109230 CCCTAGACACCACAGATGCTAGG + Intergenic
1169202660 20:3720348-3720370 CTGGACACACAACTGAGGCAAGG - Intergenic
1173011356 20:39185857-39185879 ATATAGACAAAACAGAGCCTGGG + Intergenic
1176064489 20:63187607-63187629 CTGGAGAGACTGCAGAGGCTGGG - Intergenic
1177854681 21:26387466-26387488 CTGTAGCCACTGCAGAGGATGGG + Intergenic
1178480866 21:32978399-32978421 CTGGAAACAAAACAGGGGCTCGG + Intergenic
1180856612 22:19050290-19050312 CAGCAGAAACAACAGAGGCTGGG + Intronic
1181426698 22:22848577-22848599 CTGCAGCCAGAAGAGAGGCTGGG + Intronic
1182077586 22:27505512-27505534 CAGAAGAGAAAACAGAGGCTTGG - Intergenic
1182854504 22:33505269-33505291 CTGTAGCCTCTGCAGAGGCTGGG + Intronic
1184493729 22:44825460-44825482 CTGTAGACACAACAGAGGCTGGG - Intronic
1184583561 22:45432955-45432977 GCCTTGACACAACAGAGGCTCGG + Intergenic
1185109070 22:48890726-48890748 CGTGAGAGACAACAGAGGCTGGG - Intergenic
949384700 3:3488226-3488248 ATGTAGATACAGCAGAGACTGGG + Intergenic
949499886 3:4669603-4669625 CTGTAGATAGAGCAGAGGTTAGG - Intronic
949772254 3:7592122-7592144 CTGCATACACAACAGTGGCTAGG - Intronic
950726863 3:14922405-14922427 CTGCAGATACGAGAGAGGCTGGG + Exonic
951844451 3:27070541-27070563 CTTTAAACACAACAGAGGAGGGG + Intergenic
952883931 3:38001540-38001562 CTCTACACATACCAGAGGCTGGG + Exonic
958457468 3:94349386-94349408 CTGTAGAGGCAAGGGAGGCTAGG + Intergenic
958573971 3:95923585-95923607 CTGTAGACAGAACAGCAGCATGG + Intergenic
961820299 3:129572500-129572522 ATGAAGACCCAAGAGAGGCTTGG + Intronic
963093326 3:141507860-141507882 CTGTAGCCACAAGAGAGGCTGGG + Intronic
969488182 4:7484000-7484022 CTGTAGATACAGGAGAGCCTGGG - Intronic
970170473 4:13284307-13284329 CTGTAGCCACCTCAGGGGCTTGG - Intergenic
971656107 4:29347331-29347353 GTCAAGACACAACAGATGCTGGG + Intergenic
979351669 4:119650703-119650725 CTGAAGCCAGAGCAGAGGCTTGG + Intergenic
983108771 4:163723112-163723134 CTGTAAAGACCACTGAGGCTAGG - Intronic
987460009 5:18197962-18197984 CTGTAAAGACAACAGGGCCTTGG - Intergenic
987902830 5:24035785-24035807 CTCTGGAAACAACAGATGCTGGG - Intronic
988942124 5:36157319-36157341 ATGAAGAAACAACAGAAGCTGGG - Intronic
989953754 5:50332128-50332150 ATGTAAACACCACGGAGGCTAGG + Intergenic
995718965 5:115109492-115109514 CTGTAGACACTACACACCCTTGG + Intergenic
996658048 5:125965328-125965350 ATGTGCACACAAGAGAGGCTAGG + Intergenic
997033007 5:130153707-130153729 ATTTTGACCCAACAGAGGCTTGG - Intronic
997283429 5:132662539-132662561 CTGTAGAAACAACAGAGGGTCGG + Intergenic
1001084850 5:168693107-168693129 CTGGGGACACAACAGTGACTGGG + Intronic
1001301985 5:170540257-170540279 CTGTAGAGACAGCAGCTGCTAGG + Intronic
1001782119 5:174378608-174378630 CTGAAGACTCAACTGAGGCGTGG + Intergenic
1002545983 5:179945552-179945574 CTGGTGAGAAAACAGAGGCTGGG + Intronic
1003502286 6:6712536-6712558 CTCTGCACACAGCAGAGGCTTGG + Intergenic
1004622415 6:17342694-17342716 CTGTAAAAACAACAGAGGCAAGG + Intergenic
1005101680 6:22178945-22178967 CTGTAAACACCATCGAGGCTAGG - Intergenic
1005259640 6:24044438-24044460 CTGTAGAAACAACTTTGGCTTGG + Intergenic
1005398094 6:25404459-25404481 CTTTAAACATAATAGAGGCTGGG + Intronic
1006576694 6:35051660-35051682 CTGTAGACACCAATGAGGGTTGG - Intronic
1006884297 6:37367821-37367843 CTGCAGACAAAACTGAGGCATGG + Intronic
1007078995 6:39085465-39085487 CTGTAGACACCAGGAAGGCTGGG + Intronic
1007667125 6:43521177-43521199 CCGTTGACTCAACAGAGACTGGG - Exonic
1010456658 6:76064060-76064082 CTGTATCCACAACAGTGGGTGGG - Intronic
1010869060 6:81016151-81016173 CTGTACAGACCACAGAGGCTAGG - Intergenic
1010901742 6:81435396-81435418 CTGTAAAGACCACAGAGGCTAGG + Intergenic
1014471376 6:121819136-121819158 CTGAAGACACACCTGAGACTGGG - Intergenic
1015262600 6:131255622-131255644 CTGTAGACAGAGCACAGGCCTGG + Intronic
1017527102 6:155251043-155251065 ATGCAGACTGAACAGAGGCTGGG + Intronic
1018679987 6:166256522-166256544 CAGTTGAAACAACTGAGGCTTGG - Intergenic
1021074750 7:16288548-16288570 CTGAAAACACAATACAGGCTGGG + Intronic
1023091441 7:36621201-36621223 CTATAGTCACAACAAAGGCGAGG + Intronic
1023883531 7:44335049-44335071 CTGTAGCCTCCACAGAAGCTTGG + Intergenic
1024158874 7:46653959-46653981 CTCTTGAAACTACAGAGGCTGGG + Intergenic
1024301029 7:47887830-47887852 CTGTAGAGGCAAGAGGGGCTGGG + Intronic
1028650076 7:93141268-93141290 CTCTAGATAGAAAAGAGGCTAGG - Intronic
1030492040 7:110249448-110249470 CTGTAGGCACCACTGAAGCTTGG - Intergenic
1032326751 7:130936162-130936184 CAGTAGAAAGAACACAGGCTTGG + Intergenic
1033274933 7:139964639-139964661 TAGTAGACACAGCAGAGGCTAGG + Intronic
1034900050 7:154902552-154902574 CTGAAGACCCAACAGAGCCTTGG + Intergenic
1035563472 8:626388-626410 CTGCAGACCCGGCAGAGGCTAGG - Intronic
1035740848 8:1927296-1927318 CTGTAGGCAGGACAGGGGCTTGG + Intronic
1035925793 8:3726227-3726249 CTGTAAACCCATGAGAGGCTGGG + Intronic
1036636737 8:10556037-10556059 CTGTAACCAAAACACAGGCTCGG + Intergenic
1037993553 8:23337506-23337528 CTCTACACACAACAGAGGCAGGG + Intronic
1038239557 8:25796158-25796180 CTGTAGAGACAGCACAGGATAGG - Intergenic
1038412072 8:27366724-27366746 GAGCACACACAACAGAGGCTAGG + Intronic
1038915561 8:32017821-32017843 CTGTAAACACAAAAAAGACTAGG - Intronic
1042270114 8:66946071-66946093 CTCGAAAAACAACAGAGGCTGGG + Intergenic
1042891578 8:73617771-73617793 ATGAAGCTACAACAGAGGCTGGG + Intronic
1045950465 8:107845949-107845971 CTGGAGTCACATCAGAGGTTTGG + Intergenic
1047363968 8:124195438-124195460 CAGTGGACAGAACAGAGGCTGGG - Intergenic
1049732359 8:144185210-144185232 CTGCAGAAACCACAGAGGCCAGG - Intronic
1050319714 9:4439064-4439086 TTGAAGAGACAACAGATGCTAGG - Intergenic
1051126101 9:13807555-13807577 CTGTGGACAGAACATAAGCTTGG - Intergenic
1051205278 9:14682094-14682116 CTGTAAAGACCACAGATGCTAGG + Intronic
1052749537 9:32475245-32475267 CTGAACACAAAACTGAGGCTGGG - Intronic
1057264001 9:93602093-93602115 CTGAAGAAACAACCCAGGCTGGG - Intronic
1057447847 9:95130700-95130722 CTGTGGAGAGAACAGTGGCTCGG - Intronic
1057706401 9:97398168-97398190 CTGTGGTCTCAACCGAGGCTGGG - Intergenic
1061387732 9:130300347-130300369 CTGTAGACACAGCAGTGGGCAGG + Intronic
1061753179 9:132794772-132794794 TTGTAGACAGAACATGGGCTTGG + Intronic
1062357180 9:136170517-136170539 CTGTAGACCCAGCAGGGGCAGGG + Intergenic
1062547770 9:137071289-137071311 CTGGAAACACAGCAGAGGCAGGG - Intergenic
1186092819 X:6068016-6068038 CGGTAGACACAAAGGAGTCTGGG - Intronic
1186238044 X:7534961-7534983 GGGTAGACACAACATGGGCTGGG - Intergenic
1192043797 X:67650808-67650830 CAGTAGTCACAACACAGCCTGGG - Intronic
1192879185 X:75264777-75264799 CTGTAGAGACCATCGAGGCTGGG - Intergenic
1194774304 X:97944098-97944120 CTCTAGACTCCACACAGGCTGGG - Intergenic
1196559200 X:117125754-117125776 ATGTAGACATACCTGAGGCTGGG - Intergenic
1198532511 X:137560211-137560233 CTGTAGTGTCAGCAGAGGCTAGG - Intergenic
1199191888 X:144980693-144980715 CTCTAGACCCAAGTGAGGCTTGG + Intergenic
1199676770 X:150196015-150196037 CTCTAGACACCCCAGAGGCTTGG - Intergenic
1199927375 X:152481113-152481135 CAGAAGACACACCTGAGGCTCGG + Intergenic
1200036005 X:153330899-153330921 CTGTAGCTACAAGAGAAGCTGGG + Intergenic
1200542492 Y:4477088-4477110 CTCTAGACACAACGGTGGCCTGG - Intergenic