ID: 1184494079

View in Genome Browser
Species Human (GRCh38)
Location 22:44827154-44827176
Sequence CAGCAGAAGCAGAGGCCGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 568
Summary {0: 1, 1: 0, 2: 3, 3: 46, 4: 518}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184494079 Original CRISPR CAGCAGAAGCAGAGGCCGGA GGG Intronic
900228281 1:1543060-1543082 AGGCAGAGGCAGAGGCGGGACGG + Intronic
900486474 1:2925065-2925087 CAGCGGAAACAGAGGTCAGAGGG + Intergenic
900500898 1:3004043-3004065 CAGCTGCAGCCGAGGCCAGAGGG - Intergenic
900538904 1:3193048-3193070 CAGCAGACACAGCGGCCAGATGG + Intronic
900538907 1:3193079-3193101 GAGCAGACGCAGCGGCCAGACGG + Intronic
900649656 1:3724501-3724523 CAGCAGAACCAGGGCCCGGGAGG + Intronic
900661566 1:3787048-3787070 GAGAGGAAGCAGAGGCGGGAAGG - Exonic
900895296 1:5479106-5479128 CAGCAGCAGCACAGGCAGGGAGG - Intergenic
900970627 1:5990872-5990894 CAGCAGAAGCAGAGATCTCAAGG - Intronic
901042545 1:6374211-6374233 CAGCCCAAACAGAGGCGGGAGGG + Intronic
901497880 1:9632484-9632506 CAGCAGAAACAGAGGGCAGCTGG - Intergenic
901837673 1:11934778-11934800 CAGTAGCAGCAGGGGCCGCATGG - Exonic
901916119 1:12502007-12502029 AAGAAGGAGCAGAGGCTGGAAGG + Intronic
902221323 1:14967649-14967671 CCGGAGGAGCAGAGGCCAGAGGG + Intronic
902700281 1:18167656-18167678 CAGCAGAAGGAAAGGGTGGACGG - Intronic
902705361 1:18200532-18200554 TGGCAGAGGCAGAGACCGGAGGG - Intronic
902744675 1:18465710-18465732 GAGCAGAAGCCAAGGCCAGAGGG + Intergenic
903232901 1:21932723-21932745 CAGCAGACGCAGAGACCCTAAGG + Intronic
903394106 1:22986075-22986097 CAGAAGAAGCAGGGGAGGGATGG + Intergenic
903585932 1:24415403-24415425 CAGCAGGAGCAAAGCCCGGAAGG + Intronic
903778124 1:25806122-25806144 CAGCACGAACAGAGGCCTGAAGG + Intronic
904028860 1:27521544-27521566 CAGCAGCAGCAGGGGCGAGAAGG - Intergenic
904355922 1:29939820-29939842 CAGCATAAGCAAAGGCCTGGAGG - Intergenic
904832549 1:33314423-33314445 CAGGAGAGGCAGGGGCAGGAGGG - Intronic
905408534 1:37753330-37753352 CAGGAGAAGCAGGGGCGCGAGGG + Intronic
905745638 1:40415032-40415054 CAGCAGACGCCCAGGCCTGAAGG - Intronic
906295749 1:44648078-44648100 CAGCAGAAACAGAGGCCAAGAGG - Intronic
906942455 1:50267411-50267433 CAGCAGGAGCAAAGGCAGGAAGG - Intergenic
907221427 1:52909826-52909848 CTGCAGATGCAGAGGGCTGACGG + Intronic
907222084 1:52914506-52914528 CAGGATAAGCTGAGGCAGGAGGG + Intronic
907247045 1:53115119-53115141 GAGCAGAAAGAGAGGCTGGAAGG - Intronic
907373590 1:54018268-54018290 AAGCAGAGGCAAAGGCAGGAGGG + Intergenic
908107185 1:60856939-60856961 CAGCAGAAGCAGCAGCAGCAGGG + Intergenic
908184562 1:61640317-61640339 CAGCACAAGCAAAGGCACGAGGG + Intergenic
908403708 1:63793922-63793944 CAGGAGAAGCAGAGACCCCAGGG + Intronic
908947427 1:69516524-69516546 CACAAGAACCAGAGGCAGGAGGG - Intergenic
909647048 1:77929434-77929456 AAGCAGAAGAAGAAGCCAGAAGG + Exonic
912903941 1:113683405-113683427 CAGAAAAAGCAGAGGTCGGTCGG + Exonic
915137170 1:153740751-153740773 CAGCAGCAGCAGTGGCTGCAGGG - Intronic
915468540 1:156112557-156112579 CACCAGAAGCAGAGGCAGGAGGG - Intronic
915515714 1:156411321-156411343 CAGCAGAAGCACAATGCGGAGGG + Intronic
915605409 1:156947266-156947288 CAGCAGAAGAGGAGTCTGGAGGG + Intronic
915679801 1:157570250-157570272 CAGTAGCAGCAGAGGCCCCATGG + Intergenic
915727092 1:158025665-158025687 GAGGAGAAGCAGAGGCCAGAGGG + Intronic
915985214 1:160457818-160457840 CTGCATAAGCAGAGGAAGGAAGG + Intergenic
917225046 1:172772592-172772614 CTCCAGAAGCAGAGACCTGAAGG - Intergenic
917228874 1:172814350-172814372 CTGCAGAAGCAGAGCCCTCATGG - Intergenic
918758363 1:188367831-188367853 CAGCAAAAGGAGGGGCAGGAAGG - Intergenic
920114465 1:203610174-203610196 ATGAAGAAGCAGAGGCCAGAGGG + Intergenic
920189126 1:204181137-204181159 CAGCAGAAGCATAGCTGGGATGG + Intergenic
920373505 1:205493977-205493999 GAGCAGAAGCAGAGGAGAGAGGG - Intergenic
921328776 1:214014872-214014894 CATCAGCAGCAGGGGCTGGACGG - Intronic
921764430 1:218953501-218953523 CAGCAGCAGCAGCAGCAGGAGGG + Intergenic
922027710 1:221767137-221767159 CAGGAGTAGGAGAGGCAGGAGGG - Intergenic
922464375 1:225836743-225836765 CAGCAGAAGCAGAGAGGAGAAGG + Intronic
923119712 1:230978802-230978824 CAGCAGCAGCAGCAGCCGGCAGG + Exonic
923314726 1:232768858-232768880 CAGTAGGAGCTGAGGCTGGAAGG - Intergenic
924669619 1:246110354-246110376 CAGCCCATGCTGAGGCCGGAAGG + Intronic
1063160174 10:3413010-3413032 CAGGAAAAGCCGAGGACGGACGG - Intergenic
1063250785 10:4271727-4271749 CAGCAGAGGCAGAGGCCCCAGGG - Intergenic
1063256886 10:4338179-4338201 CAGCTGAAGCTGGGTCCGGATGG + Intergenic
1063549094 10:7012103-7012125 CAGTTGAAGCAGAGGCTGTATGG - Intergenic
1063819538 10:9819132-9819154 CAGCTGATGCAGAGCCCAGAGGG + Intergenic
1064609251 10:17080015-17080037 GAGCAGAAGCTGAGGCAGGAAGG - Intronic
1067344530 10:45427995-45428017 CTGCAGAAGCAGAGGGGGAAGGG - Intronic
1069703480 10:70442291-70442313 CAGCAGAAGCTGGAGCCAGATGG + Intronic
1069896985 10:71686012-71686034 CAGGAGGAGGAGGGGCCGGAGGG + Intronic
1069993712 10:72329926-72329948 CAGCATGAGCAGAGGCCCGGAGG - Intergenic
1070016876 10:72542549-72542571 CAGCAGGAGCAAACGCCGTACGG + Intronic
1070804475 10:79262989-79263011 CAGCAGAAGCAGCTGACGGCTGG - Intronic
1071110613 10:82150723-82150745 CAGCAGAAGCAGATGAAAGACGG - Intronic
1071353213 10:84767417-84767439 CAGCAGATGCGGAAGCCAGAAGG + Intergenic
1071882106 10:89910894-89910916 CAGCAGCAGCAGTGGCAGCATGG + Intergenic
1073206184 10:101770661-101770683 CAGCAGAGGCAGAGGGCGAGCGG + Intronic
1073249641 10:102114023-102114045 CAGCAGGAGTAGAGGCAGCAAGG + Intronic
1074256081 10:111803873-111803895 CAGCAGAAGCAAAGGCCCAGTGG + Intergenic
1075520843 10:123142762-123142784 CAGCAGAAGCTCAGGCCCCACGG - Intergenic
1075830654 10:125408112-125408134 CTGCAGCAGCAGTGGCCGCATGG - Intergenic
1076016029 10:127028182-127028204 CGGGAGAAGCAGGGGCAGGAAGG + Intronic
1076039536 10:127232416-127232438 CAACAGAGGCAGAGTCCGGGAGG + Intronic
1076333114 10:129686146-129686168 CAGCAGAAACAGAAACTGGAGGG + Intronic
1076381866 10:130028909-130028931 CACCAGAAGCAGATGCCCAAGGG - Intergenic
1076454617 10:130581291-130581313 CAGGAGTAGCACAGGCCGAAAGG - Intergenic
1076497478 10:130906326-130906348 CAGCAAAGGCAGAGTCTGGACGG - Intergenic
1077063353 11:627117-627139 CAGCAGCAGGAGGGGCCGGGGGG + Exonic
1077461563 11:2713306-2713328 CAGCAGAGGAAGAGCCCAGAAGG - Intronic
1078530167 11:12130956-12130978 CTGGAGGAGCAGAGGCCGGAGGG + Intronic
1078550841 11:12279671-12279693 CAGCAGAGAGAGAGGCAGGAAGG - Intronic
1079511506 11:21216275-21216297 CTGCAGAGGCAGAGGCCTCATGG + Intronic
1080848056 11:36043653-36043675 CAACAGAGGCAGAGACTGGAGGG + Intronic
1081374300 11:42340539-42340561 AAACAGAAGCAGAGGTCTGAAGG - Intergenic
1081621301 11:44620478-44620500 CTGCAGAAGCAGATGCCTGCGGG - Intergenic
1081801080 11:45859766-45859788 CAGCAGCAGCAGCAGCAGGAGGG - Intronic
1082169116 11:48980905-48980927 CAACAGAATCAGATGCTGGAAGG - Intergenic
1082173325 11:49032350-49032372 CACCAGAACCAGATGCTGGAAGG + Exonic
1083607256 11:63986478-63986500 CAGCAGAAGCAGGAGCCGCTGGG + Exonic
1083795994 11:65017043-65017065 CAGCAGCAGCAAAAGCCTGATGG + Intronic
1084001989 11:66300904-66300926 GAGCAGAGGCAGAGGCCGCTGGG - Intergenic
1084103590 11:66966090-66966112 CAGCCCAAGCACAGGCAGGAAGG - Intergenic
1084433720 11:69126032-69126054 CAGCAGAGGCACAGGCTGGAGGG - Intergenic
1084453619 11:69254628-69254650 CAGCAGGGGCAAAGGCAGGAGGG + Intergenic
1085319474 11:75565168-75565190 CAGCAGTAGCAGTGGCCCCAAGG - Intronic
1086026840 11:82303928-82303950 CAGGAGAAGCAGTGGATGGAAGG - Intergenic
1086274751 11:85113143-85113165 CAGCAGCAGCAGAGTACAGAAGG + Intronic
1086692435 11:89803697-89803719 CACCAGAACCAGATGCTGGAAGG - Exonic
1086696713 11:89855721-89855743 CACCAGAACCAGATGCTGGAAGG + Intergenic
1086709445 11:89988769-89988791 CACCAGAACCAGATGCTGGAAGG - Intergenic
1086713363 11:90035962-90035984 CACCAGAACCAGATGCTGGAAGG + Exonic
1087000549 11:93415622-93415644 AAGCAGAAGTAGAGACTGGAAGG - Intronic
1087331264 11:96783483-96783505 AGGCAGAAGCACAGGCCAGATGG + Intergenic
1087535016 11:99431907-99431929 AAGCAGAAACAGGGGCTGGAGGG + Intronic
1087727771 11:101741761-101741783 CAGCTGAGGCAGAGGCCAGATGG - Intronic
1089192763 11:116666112-116666134 CACCAGAAACAGAGGCCAGGAGG + Intergenic
1089416636 11:118297576-118297598 CCGGAGAAGCAGAGGCCAGCTGG + Intergenic
1089457231 11:118632721-118632743 CAAGGGAAGCAGAGGCCCGAGGG - Intronic
1089541831 11:119193819-119193841 CAGCTGAGGCAGAGGCTGCAAGG - Exonic
1090073149 11:123561383-123561405 CAGCAGAAGGAGAGGATGAAAGG + Intronic
1090073710 11:123565660-123565682 GATCTGAAGCAGAGGCCTGATGG + Intronic
1090331483 11:125935763-125935785 CAGGAGGAGCAGGGGCCTGAAGG + Intergenic
1090346027 11:126071512-126071534 CAACTGAAGCAGAGGAAGGAAGG + Intergenic
1090386688 11:126361456-126361478 CAGCAGAAGCAAAGGCGAGGAGG - Intronic
1090474072 11:127003908-127003930 CAGCAGAACCTGGGGCCGGCCGG - Intergenic
1090831663 11:130424862-130424884 CAGCAGGAGCACAGGTGGGATGG + Intronic
1091229878 11:133981377-133981399 CAGGAGAGGGAGAGGCAGGAAGG + Intergenic
1091333981 11:134753080-134753102 CAGCAGCAGCAGAGGCCCCACGG + Intergenic
1091850591 12:3693868-3693890 CAGCTGATGCAGAGCCCAGAGGG - Intronic
1092727030 12:11496935-11496957 CAGCAGAAGCAGTGGCCGCCAGG - Intronic
1094047113 12:26179276-26179298 CAGGAGAAGGTGAGGGCGGAGGG + Intronic
1094413388 12:30191735-30191757 CAACAGAAGCAAAGGCTGCAGGG - Intergenic
1094500409 12:31016216-31016238 CAGCAGAAGCAGTGGCCGCCAGG + Intergenic
1097053468 12:56237183-56237205 CAGCAGCAGCAGCCGCCGAAAGG - Exonic
1097102385 12:56598826-56598848 CAGCAGTAGCAAAGACCGGGCGG + Intronic
1098346844 12:69514418-69514440 GAGCAGAAGCAGAGAGCAGAAGG - Intronic
1099215190 12:79844794-79844816 GAGCAGAGGAAGAGGCAGGAAGG - Intronic
1100446343 12:94663852-94663874 CAGCACAAGCAGAGGCAGAGAGG - Intergenic
1101763318 12:107676959-107676981 CATGAGAAGCAGAGGAAGGATGG - Intergenic
1101882469 12:108634748-108634770 CAGCAGAGGCAAAGGCTGGGAGG + Intergenic
1102052163 12:109870626-109870648 AAGCAGAAGGAGAGGAAGGAAGG + Intronic
1102251297 12:111389381-111389403 CAGCACATGCAGAGGCCCGCAGG + Intergenic
1102749242 12:115277802-115277824 CTGCAGAAGCAAAGGCCAGGTGG + Intergenic
1102814989 12:115858487-115858509 CAGCATAAGCAAAGGCCTGGTGG + Intergenic
1102933880 12:116881359-116881381 CAGCGGGCGCAGAGGCCGGAGGG - Exonic
1104063476 12:125287174-125287196 CCACAGAAGCAGAGGAGGGAGGG - Intronic
1104369866 12:128215089-128215111 CAACGGAAGCAGAGGTGGGAGGG + Intergenic
1104963110 12:132497561-132497583 AAGCAGGAGCTGAGGCCAGAGGG - Intronic
1105761327 13:23517508-23517530 CACCAGCAGCACAGGCTGGAGGG - Intergenic
1106462224 13:29981169-29981191 CTGCAGCTGCAGAGGCTGGATGG - Intergenic
1106670682 13:31901278-31901300 CATCAGAAGCACAGGCAGGTGGG + Intergenic
1107616255 13:42171386-42171408 AAGCAGAGGCACAGGCCAGAAGG - Intronic
1110294413 13:73846034-73846056 CACCAGATGCAGAGGCCACAAGG + Exonic
1111063816 13:83063463-83063485 CAGCAGCAGCTGAGACAGGAGGG - Intergenic
1112175854 13:97023264-97023286 CAACAGAAGCAGAGGTCAGAGGG + Intergenic
1113821974 13:113221111-113221133 CACCAGAAGCAGAGCGTGGAGGG + Intronic
1115615469 14:35090679-35090701 CAGCAAAAGCAGTGGCTAGAGGG - Intronic
1118641112 14:67793478-67793500 CAGAAGAAGCAGAAGCAAGAGGG - Intronic
1119606029 14:76018198-76018220 CAGCAAAAGCAGAGCCAAGAGGG - Intronic
1119618567 14:76114493-76114515 CAGCAGCAGCAGAAGCAGCATGG + Intergenic
1119698169 14:76730660-76730682 CAGCAGGAGCAGGAGCCGAAAGG + Intergenic
1122695144 14:103548783-103548805 CAGCAGGAGCAGAGCCCAGGGGG - Intergenic
1122741289 14:103872804-103872826 CAGCTGAAGAAGGGGCTGGAGGG + Intergenic
1122969536 14:105146920-105146942 CTGCAGAAGCAGACGGAGGAGGG - Intronic
1123155058 14:106216825-106216847 CAGCAGAAGCAGAGACACAAAGG - Intergenic
1123206509 14:106718876-106718898 CAGCAGAAGCAGAGACACAAAGG - Intergenic
1124075086 15:26436722-26436744 CAGAAGAAGCAGAGCCAGTAAGG - Intergenic
1125434326 15:39629017-39629039 CAGCAGCAGCAGCAGCCAGATGG + Intronic
1125469711 15:39990894-39990916 CAGCATAAGCAGAGGCCCCGGGG + Intronic
1125796233 15:42406062-42406084 CAGCAGAAGCTCAGGAAGGAGGG - Intronic
1126172681 15:45707460-45707482 CAGCAGAGGCAGATGCCCCAGGG - Intergenic
1127268146 15:57377254-57377276 CGGCATAAGCAGAGTCGGGAGGG - Intronic
1127383401 15:58448591-58448613 CAGCACTGGCAGAGGCCGGCAGG + Intronic
1127784447 15:62343372-62343394 CAGCAGAAGCAGCTGGCAGAAGG + Intergenic
1128498300 15:68210599-68210621 CAGGAGAAACTGAGGCCAGAGGG - Intronic
1128599038 15:68979932-68979954 CTGAAGTAGCAGAGGCCAGATGG - Intronic
1128715307 15:69903510-69903532 CAGCAGTAGCAGGGCCAGGAAGG + Intergenic
1129068429 15:72930774-72930796 CAGCAAAAGCAGTGCCAGGAGGG - Intergenic
1129683054 15:77669137-77669159 CAGCAGAGGCAGAGGCCCAGTGG - Intronic
1129705800 15:77793354-77793376 CAACAGAAGCAGGGGCAGCAAGG + Intronic
1130042537 15:80417506-80417528 GAGAAGAAGCAGAGGGGGGATGG - Intronic
1130868195 15:87949930-87949952 CAGAAGAGGCAGAGGAAGGAGGG - Intronic
1130894913 15:88162460-88162482 CAGCAGAAGGAGAGGGGAGAAGG + Intronic
1131314154 15:91318038-91318060 CTGTGGAAGCAGAGGCTGGAGGG - Intergenic
1131877470 15:96825803-96825825 AAGCAGCAGCAGAAGCAGGATGG - Intergenic
1132491072 16:231256-231278 GAGCAGGAGCAGCGGCCGAACGG + Intergenic
1132696930 16:1206154-1206176 CAGCACACGCAGCAGCCGGAAGG - Exonic
1132702470 16:1227974-1227996 AAGCACAAGCAGTGGACGGAGGG + Intronic
1133268705 16:4600172-4600194 CAGCAGCAGCAGAGGTGGCAGGG - Exonic
1134273221 16:12753453-12753475 CAGCAGCAGCAGAGAACAGAAGG + Intronic
1135180252 16:20267230-20267252 CAGGAGAAGCAGAGACCCCATGG - Intergenic
1135413880 16:22254409-22254431 CAACAGATGCAGAGGCCGAAGGG - Intronic
1135632420 16:24046605-24046627 CGGCAGAGGCAGAGGCCAGAGGG + Intronic
1135965312 16:27030391-27030413 AGGCAGAAGCAGGGGCTGGAAGG + Intergenic
1137317842 16:47346412-47346434 CAGCAGAAGCAGTAGTCAGAGGG + Intronic
1137367356 16:47872339-47872361 AAGCAGAAGCAGAAGCAGAAGGG + Intergenic
1137581436 16:49635868-49635890 CAGCCGGCGCAGAGGCCGTAGGG + Exonic
1137893441 16:52185780-52185802 CAGCAGAAGCAGTGGAAGCATGG - Intergenic
1138578403 16:57923411-57923433 CAGCAAAGGCAGAGGCCCCAGGG + Intronic
1139442736 16:66976987-66977009 CAACAGCAGCAAAGGCCTGAAGG + Intergenic
1139449143 16:67016321-67016343 CAGCAGGAGCAAAGGCCTGGAGG + Intergenic
1139712985 16:68790626-68790648 CTGCAGAGGCGGAGGCTGGAGGG - Intronic
1141274549 16:82574817-82574839 CAGCAGAAGCAGAAATCAGAGGG - Intergenic
1141509011 16:84500676-84500698 CAGCAGCAGAAGAGCCCAGAAGG + Intronic
1141570745 16:84932194-84932216 CAGCAGAGGCAGTGGCTGCAGGG + Intergenic
1141627574 16:85269321-85269343 CAGCAGCATCAGAGGCAGGCTGG + Intergenic
1141965806 16:87442181-87442203 CAGCAGAGTCTGAGGCTGGACGG + Intronic
1142333139 16:89468738-89468760 CAGCAGAAGCAGGGGCCACATGG - Intronic
1142740688 17:1930298-1930320 CTGCAGAAGCAGTGGCTGGCGGG + Intergenic
1142923039 17:3207765-3207787 CTGGAGAAGCAGTGGCAGGATGG - Intergenic
1143115879 17:4581723-4581745 GAGCAGAAGCACAGTCAGGAAGG + Intergenic
1143741353 17:8956297-8956319 CAGCAGAAGCATGGGCTAGAGGG + Intronic
1143764050 17:9126046-9126068 TTGCAGAAGCAGAGTCAGGATGG + Intronic
1144748889 17:17634569-17634591 CAGCAGATGCAAAGGCCTGGAGG + Intergenic
1144837662 17:18165476-18165498 GACCAGAAGCAGAGGCTGGCAGG - Intronic
1144838506 17:18171260-18171282 AAGGAGAAGCAAAAGCCGGAGGG - Intronic
1144849300 17:18235936-18235958 CACCAGAGTCAGAGGCCTGAGGG - Intronic
1145846333 17:28041969-28041991 CAGCAGAAGCAGCCGGCGGCGGG + Intronic
1146122456 17:30207732-30207754 CAGGAGAAACAGAGGGCTGATGG + Exonic
1146214881 17:30971176-30971198 CGGCAGAAGCTGTGGCCGCAGGG - Exonic
1146642995 17:34555276-34555298 CAGCAAAAGCCCAGCCCGGATGG - Intergenic
1147326807 17:39673593-39673615 GAGCAGCAGGAGAGCCCGGAAGG + Exonic
1147456675 17:40542321-40542343 AAGCAAAAGCAGAGGCGAGAAGG - Intergenic
1147915297 17:43882110-43882132 CAGCAGCGGCAGAGGCCTGTCGG + Intronic
1148821946 17:50364945-50364967 CAGCAGCAGCAGCAGCAGGATGG - Intergenic
1150576339 17:66434025-66434047 CAGGAGCAGCAGAGCCAGGATGG + Intronic
1151153138 17:72105034-72105056 CAGGAGAAGCGGATGGCGGATGG - Intergenic
1151268981 17:72978574-72978596 TAGCAGATGCAAAGGCCGGGAGG + Intronic
1151696692 17:75721584-75721606 CAGCAGCAGCCGAGGCTGGCCGG + Exonic
1152233028 17:79124525-79124547 CAGCAGCAGCAAGGGCTGGAAGG + Intronic
1152478625 17:80535196-80535218 CAGCACAAGCAGGCGCTGGAGGG + Intergenic
1152769750 17:82160109-82160131 GAGAAGAAGCAGAGGCTGCAGGG + Intronic
1152772555 17:82179241-82179263 CAGGAAAAGCAGAGGCACGATGG + Intronic
1153559620 18:6358825-6358847 GAGCAGAAGCACTGGCCTGAGGG + Intronic
1154140619 18:11821622-11821644 CAGCAGAAGCCGAAGCCTGAAGG + Intronic
1155043577 18:22085095-22085117 GGGCAGAAGCAAAGGCAGGAGGG + Intergenic
1155399198 18:25419704-25419726 CAGAAGCAGCAGGGGCAGGATGG - Intergenic
1155433367 18:25785609-25785631 CAGCAGAGGCAGAGGGGAGAGGG - Intergenic
1156011655 18:32503601-32503623 CAGTAGGAGCAGATGCCAGATGG - Intergenic
1156192699 18:34738108-34738130 CAGCAGAAGCAAAGGCCCTGAGG + Intronic
1157543162 18:48526747-48526769 CAGCAGAAGGAGAGGGAGAAGGG - Intergenic
1157618606 18:49002438-49002460 CAGCAGAAACAGAGGCAGCAGGG - Intergenic
1157804074 18:50645040-50645062 GAGCAGAAGGAGAGGCCTGCAGG + Intronic
1157891565 18:51423126-51423148 GAGCAGGAGCAGAGTCCAGAAGG - Intergenic
1157942005 18:51939489-51939511 CAGCATGAGCAGAGGCAGGATGG + Intergenic
1158907329 18:62026689-62026711 TAGCAGAGGCAGAGTCAGGAAGG - Intergenic
1159535367 18:69707984-69708006 CAGCACAGGCAGAGCACGGATGG + Intronic
1159874952 18:73800626-73800648 CAGCAGAGGCAGCAGCTGGACGG + Intergenic
1159971953 18:74666136-74666158 CCGCAGAAGCATAGGTTGGAGGG + Intronic
1160512602 18:79460981-79461003 CAGCAGATGCAGGGCCAGGACGG + Intronic
1161009973 19:1955294-1955316 CAGCAGCAGCAGCAGCAGGAGGG - Intronic
1161062089 19:2220245-2220267 CAGCAGCAGCAGAGTCCTGAGGG - Intronic
1161124862 19:2550165-2550187 CAGCAGAAGGAGCGGCTGGGAGG + Intronic
1161316410 19:3619568-3619590 GAGCTGAAGCAGAGGCAGGCTGG + Intronic
1161592910 19:5136758-5136780 CAGCAGAGGCAGAGCCCTGGGGG + Intronic
1161618738 19:5287154-5287176 CAGCAGAAGCAAAGGCTTGGAGG - Intronic
1161842767 19:6692967-6692989 CTGGAGAAGCAGAAGCCCGACGG - Exonic
1162066994 19:8131830-8131852 CTGCAGAAGCAGTGGCGGCACGG + Intronic
1162316938 19:9945158-9945180 CAGCAGAAAAAGAGGAAGGAAGG + Intergenic
1162933474 19:13968766-13968788 TCGCAGAAGCAGAGGTAGGAAGG - Exonic
1163205999 19:15803275-15803297 CAGCAGGATCAGAGGCCAGTGGG + Intergenic
1163260333 19:16185768-16185790 GAGCAGAAGCAGAAGGCGGCGGG + Intronic
1163350755 19:16775371-16775393 AAGCAAAAGCAGAGGCAAGAGGG + Intronic
1164608886 19:29618807-29618829 AGGCAGGAGGAGAGGCCGGAAGG + Intergenic
1164668782 19:30061463-30061485 CGGCAGGAGCAAAAGCCGGAGGG - Intergenic
1165059133 19:33196197-33196219 CAGCAGCAGCAGAGGCAGGAGGG - Intronic
1165314290 19:35045303-35045325 CAGCAGCCTCAGAGGCGGGAAGG + Intronic
1165860151 19:38905179-38905201 CTGCAGAAGCAGAGGACAGGCGG - Intronic
1166140367 19:40802158-40802180 CAGGAGAAGCAGAAGGGGGAGGG + Intronic
1166252725 19:41582500-41582522 CTGCAGAAGCAGAGCCCTCATGG - Intronic
1166991019 19:46692783-46692805 CAGCATATGCAGAGACCAGAAGG - Intronic
1167143368 19:47667446-47667468 CAGCAGAATTAGAGACAGGAGGG - Intronic
1167443681 19:49525045-49525067 CAGCAGCAGCAGCAGCAGGATGG - Intronic
1167568603 19:50272601-50272623 AAGCTGAAGCGGAGGCTGGATGG + Exonic
1167632256 19:50632426-50632448 CAGCAGCAGCAGTGGCCGCTGGG - Exonic
1168096875 19:54120987-54121009 CAGCACATGCAGAGGCCAGGAGG + Intronic
1168105567 19:54163951-54163973 AAGAAGAAGAAGAGGCCGGGGGG - Intronic
1168465528 19:56598279-56598301 CAGCAGATGCAGAGGCCAGGAGG + Intronic
925177662 2:1796704-1796726 CAGCAGGAGCAGAAGGAGGATGG - Intronic
925274763 2:2640986-2641008 GAGCAGAAGCAGAGGCAGAAGGG + Intergenic
925615506 2:5741074-5741096 CTGCGGAAGCAGAGGATGGAAGG - Intergenic
925675909 2:6360749-6360771 CAGCAGAAGCAGATGCCTGGAGG + Intergenic
925796851 2:7554868-7554890 CAGCTGAAGCACAGGCAGCATGG + Intergenic
926207468 2:10844268-10844290 CAGCAGGAGCAAAGGCCTGGAGG + Intergenic
926237570 2:11057377-11057399 CAGAAGATGCAGAGACCAGAAGG - Intergenic
926309218 2:11662329-11662351 CAGCAGAAGGAGCGGCAGAAGGG + Intronic
926390162 2:12381803-12381825 GAGAAGAATCAGAGGCCAGAAGG - Intergenic
926994087 2:18715099-18715121 CAGCAGCAACAGAGCCTGGAGGG - Intergenic
927847936 2:26480876-26480898 CAGCAGGAGCCGGGCCCGGAAGG + Exonic
930092583 2:47541987-47542009 CAGCAGCAGCAGCGGCAGCAGGG + Intronic
930096428 2:47570252-47570274 CAGCAGCAGCAGCAGCAGGAGGG + Exonic
930136315 2:47906425-47906447 CAGCAGAAGCAGCGGCGACAGGG - Intergenic
932187778 2:69713715-69713737 CAGCAGAAGCAATGGAAGGATGG - Intronic
933187128 2:79290747-79290769 CAGCAGATGGGGAAGCCGGAAGG - Intronic
933750082 2:85597628-85597650 CAACAGAAGTAGAGACCTGATGG - Intergenic
934616094 2:95772192-95772214 GAAGAGAAGCAGAGGCAGGAGGG - Intergenic
934644802 2:96052368-96052390 GAAGAGAAGCAGAGGCAGGAGGG + Intergenic
934838213 2:97608457-97608479 GAAGAGAAGCAGAGGCAGGAGGG + Intergenic
934893727 2:98093129-98093151 CAGCAGCTGCAGAGGCAAGAGGG + Exonic
935659718 2:105455805-105455827 CAGGAGAGGCAAAGGCTGGAGGG - Intergenic
935928439 2:108095758-108095780 CATCAGAAGCAGAGCTCAGAGGG + Intergenic
936996834 2:118424533-118424555 CAGACGAAGCAGAGGACTGAGGG - Intergenic
940337751 2:152546596-152546618 CAGCAGAAGCAAAGGCTGCAGGG + Intronic
940794592 2:158063538-158063560 CAGCAGTGGCAGAGGCTGCAGGG - Intronic
941638273 2:167960078-167960100 CAACAGCAGCAGATGCAGGAAGG + Intronic
943351951 2:186806302-186806324 CAGCAGGGGCAGAAGCCGCAGGG + Intergenic
943731324 2:191306292-191306314 CAGCAGATGCAAAGGTCTGAAGG + Intronic
945137061 2:206640872-206640894 CAGTACAAGCAAAGGCAGGAAGG - Intergenic
945910379 2:215642357-215642379 CAGCAGCAGCAAAGGCCATACGG - Intergenic
947324775 2:228962258-228962280 CAGCAGAGGCACAGGCCTCAGGG + Intronic
947760414 2:232599956-232599978 GTGAAGAAGCAGAGCCCGGAAGG + Intergenic
947790894 2:232868436-232868458 AAGCGGCAGCAGAGGCCGGGTGG - Intronic
948887854 2:240892923-240892945 CAACTGAGGCAGAGGCCAGAGGG - Intronic
1168773315 20:429685-429707 CTACAGAGGCAGAGGCCGTATGG + Intronic
1169393066 20:5205882-5205904 CAGCAAAGGCAGAGGCAGGGCGG + Intergenic
1170924157 20:20707739-20707761 AAGCAGAAGCTGAGGCTGGCTGG - Intronic
1170944804 20:20881600-20881622 CAGCACAAGCTCAGGCCTGAGGG + Intergenic
1170945071 20:20884155-20884177 CAGCAGATGCAAAGGCCGTGGGG + Intergenic
1171030076 20:21669185-21669207 CAGGAGAAGCAGAGAAAGGAGGG - Intergenic
1171150444 20:22822525-22822547 CAGCAGAAACACAGGCAGGTGGG + Intergenic
1171519001 20:25761323-25761345 CAGAAGAAGCAGAGGGAGGGAGG - Intergenic
1172013800 20:31861466-31861488 CAGCAGCGGCAGCGGCCGGTGGG + Exonic
1172286701 20:33745779-33745801 CAGCAGATGCAGAGGCCTTGAGG + Intronic
1172886016 20:38231288-38231310 CACCAGAAGCAGGGGCCGCCCGG + Exonic
1173040179 20:39454603-39454625 CAGCATTAGCAGAGTCCTGAAGG - Intergenic
1173333531 20:42095345-42095367 CAGCAGAAGGTGAGGTCAGAGGG - Intronic
1173499206 20:43540123-43540145 AAGCAGAGGCAGAGGCTGGCAGG - Intronic
1173541337 20:43854034-43854056 CAGCAGCCGCAGATGCAGGACGG - Intergenic
1174033179 20:47647387-47647409 CAACAGAAGGAGAAGCCAGAGGG - Intronic
1174533598 20:51233835-51233857 CAGCAAGAGCAGAGGCCTGAGGG - Intergenic
1175581542 20:60103688-60103710 CAGGAGAAGCAGGGGCCAGCTGG + Intergenic
1175709319 20:61206450-61206472 CAGCAGAAGAACAGGAAGGAAGG + Intergenic
1175930591 20:62492056-62492078 CAGCAGTAGCGGAGGCCTGGAGG + Intergenic
1179637757 21:42724303-42724325 CAGCAATAGCAGAGGCAGGCAGG + Intronic
1179993093 21:44958724-44958746 CAGCTGGAGCAGAGGCCGCCTGG - Intronic
1180010770 21:45049852-45049874 CAGCTGCAGCAGAGCCTGGATGG - Intergenic
1180054014 21:45347867-45347889 CTGCAGCAGCACAGGCTGGAGGG + Intergenic
1180172574 21:46067495-46067517 TTCCAGAAGCAGAGGCCGGATGG + Intergenic
1180192557 21:46173046-46173068 CAGCTGAAGCAGAACCCAGAGGG + Intronic
1180226758 21:46398056-46398078 CAGGAGATTCAGAGGCTGGAGGG + Exonic
1180863897 22:19104887-19104909 CAGCAGCAGCAGAGGGGAGAAGG + Intronic
1181235494 22:21445738-21445760 CGGGAGGAGCAGAGGCCGCAGGG - Exonic
1181530318 22:23513618-23513640 CAGCAGAAGCAAAGGCCCAGTGG + Intergenic
1181766172 22:25093886-25093908 AAGCAGAAGCAGAAGCAGAAGGG - Intronic
1181832322 22:25570716-25570738 CAGGAGAAGCAGAGGGGGGCCGG - Intronic
1182070922 22:27463058-27463080 CAGCAGAGGCTGAGGCAGGGAGG + Intergenic
1182315482 22:29444107-29444129 CGGCAGAACCCCAGGCCGGAGGG + Intergenic
1182460747 22:30481882-30481904 CAGCAGCAGCAGGAGCAGGAGGG + Intergenic
1183165117 22:36141647-36141669 CAGCAGAAGCTGAAGCCAGCAGG - Exonic
1183316964 22:37142180-37142202 CAGCAGGAGCAGAGGCAGAATGG + Intronic
1183706871 22:39479566-39479588 CACCAGAAGCAGAGGCTTGGAGG - Intronic
1183785162 22:40025000-40025022 CAGCAGGAGGCGAGGGCGGAGGG - Intronic
1183816016 22:40301186-40301208 CAGCAGCAGCAGAGGCAGCCAGG + Exonic
1184034496 22:41912064-41912086 CAGCAGAAGCCGCGGCTGCAGGG - Intronic
1184039694 22:41935503-41935525 CAGTAGCAGCAGAGCCCGGAAGG - Intergenic
1184100822 22:42341066-42341088 TGCCAGGAGCAGAGGCCGGAGGG + Intronic
1184149897 22:42631782-42631804 CAGCTCAAGCAGTGGCCTGAAGG + Intronic
1184345516 22:43910316-43910338 CTGCAGAAGCAGAGGGCAGGGGG - Intergenic
1184378984 22:44133208-44133230 AGGCAGAAGCAGAGGCATGAGGG + Intronic
1184494079 22:44827154-44827176 CAGCAGAAGCAGAGGCCGGAGGG + Intronic
1184693278 22:46127080-46127102 CAACAGGCGCAGAGGCCTGAAGG + Intergenic
1184729994 22:46366712-46366734 GACCAGAAGCAGTGGCCGTAGGG - Intronic
1184748859 22:46472834-46472856 GCGCAGAGGCAGAGGCCAGAGGG - Intronic
1184750196 22:46481417-46481439 CAGTTGAAGCAGAAGCTGGAAGG - Intronic
1185121407 22:48973814-48973836 CAGCAGGAGCAGAGTGGGGACGG + Intergenic
1185146679 22:49141005-49141027 CAGCAAATGCAGAGGACGGGTGG + Intergenic
1185152016 22:49169248-49169270 AAGCAGAACCAGAGGCCGCTGGG + Intergenic
949756189 3:7413509-7413531 CAGCAGAAGCAGAGGTCAAATGG - Intronic
950109936 3:10412496-10412518 CAGCAGGAGCAAAGGCCTGGGGG - Intronic
950187986 3:10957235-10957257 CAGCAGATGCAGAAGCAGGAGGG + Intergenic
950601005 3:14035470-14035492 CTGCAGAAGCAGTGGCAGAAAGG + Intronic
950634931 3:14307931-14307953 AAACAGAGGCAGAGGCCAGAAGG - Intergenic
950722187 3:14891310-14891332 CAGCAGGTGCAGAGGGCGGCTGG - Intronic
951663669 3:25098166-25098188 AAGCTGGAGCAGAGGCCTGAAGG + Intergenic
954417448 3:50400275-50400297 CAGCAGCAGCAGAGGCCCACAGG - Intronic
954420860 3:50418405-50418427 TAGCACAAGCAAAGGCAGGAAGG - Intronic
955506294 3:59636358-59636380 CAGCAGATGCAGATTCCAGATGG + Intergenic
955819557 3:62881715-62881737 CAGCAGAGGCAGAAGCAGGAAGG - Intergenic
956904300 3:73749995-73750017 CAGCTGGAGCAAAGGCCTGAGGG + Intergenic
961043911 3:123695904-123695926 CAGCAGAGGCAGGTCCCGGAAGG + Intronic
961988117 3:131158689-131158711 CAGCAGCAGCAGAGACAGAATGG - Intronic
962813120 3:138975574-138975596 CAGCTCCAGAAGAGGCCGGAAGG + Intergenic
963217929 3:142771999-142772021 CAGTAGAAACAGATGCCAGAAGG - Intronic
965520458 3:169664384-169664406 CAGCAGTGGGGGAGGCCGGAAGG - Intergenic
968084283 3:195867574-195867596 CAGCAGAGGCACAGGCAGGGGGG + Exonic
969006136 4:4021336-4021358 CAGCAGCAGCAGCAGCTGGAGGG + Intergenic
969378731 4:6780592-6780614 CAGCAGATGCAAAGGCCCTAAGG + Intergenic
969438521 4:7202815-7202837 CATCAGAAGCAGAAGCTGGGAGG - Intronic
969461388 4:7331039-7331061 TGGCAGAAGCAGAGGCCTGAGGG + Intronic
969587603 4:8103563-8103585 CAGCAGTAGCAGGGGTCTGAGGG - Intronic
969681622 4:8646345-8646367 CAGCTGAGGCCGAGGCTGGAGGG + Intergenic
969806812 4:9615954-9615976 CAGCAGCAGCAGCAGCTGGAGGG - Intergenic
969851854 4:9963715-9963737 CAGCAAAGGCAGAGGCTGGGAGG + Intronic
969892755 4:10275051-10275073 CAGCAGTAGCACAGGCCATACGG - Intergenic
972270043 4:37502306-37502328 CAGCAGTGGCAGAGGCAGCATGG + Intronic
972337035 4:38116308-38116330 GAGCAGATGCAGAGGCTGGGAGG - Intronic
972835248 4:42862573-42862595 CAGCAGCAGCAGAGTCCAGGCGG - Intergenic
973084090 4:46032571-46032593 CAACCTAAGCAGAGGCCAGATGG - Intergenic
973643991 4:52931950-52931972 CAGCTGCAGCAGAGGCCCCAGGG + Intronic
973830284 4:54752502-54752524 CAGCAGCAGCTGAAGCAGGAGGG + Intergenic
973936296 4:55850210-55850232 CAGCAGATGGAGAAGCCAGAAGG + Intergenic
976004325 4:80410491-80410513 CAGCAGAAGCAGAGATCAAAGGG + Intronic
976357572 4:84137131-84137153 GTGCAGAAGCAGAGGCAGGGTGG - Intergenic
979288183 4:118950407-118950429 AAGCAGAAGCAGAGAGCAGAAGG + Intronic
979778974 4:124625406-124625428 CAGCATAAGCAGAGGTCACATGG - Intergenic
981391550 4:144196995-144197017 CTGCAGAAGCAGAGCCCTCATGG + Intergenic
981761483 4:148200125-148200147 TGGCAGAAGCACAGGCAGGATGG + Intronic
981977655 4:150750000-150750022 CAGCAAGAGCAGAGGCCATAAGG - Intronic
982198473 4:152937549-152937571 CAGCAGCTGCAGCCGCCGGACGG + Intronic
982277810 4:153654783-153654805 CAGCAGAAGGAAAGGCAAGATGG + Intergenic
984587034 4:181576623-181576645 CAGCAGAACCACAGGAAGGAAGG + Intergenic
984763572 4:183383052-183383074 CAGCAGAATCAGAGGATGGAGGG + Intergenic
984833763 4:184000159-184000181 CAGTAGAAGCAGAGGCTGGGAGG - Intronic
985074395 4:186198686-186198708 AAGCAGAAGCAGAGACCAAATGG + Intronic
985255026 4:188061358-188061380 CTGCAGAAACAGAGGCCCGCTGG - Intergenic
985861624 5:2476030-2476052 CAGCAGAAGCAGAGGGGGTCTGG + Intergenic
986376597 5:7138118-7138140 CAGCAGAAGCTGATGCTGAAGGG - Intergenic
986703385 5:10433389-10433411 CAGAAGCAGCACAGGCTGGAAGG - Intronic
987492090 5:18594170-18594192 CTGCAGAAGCAGAGGCCTCATGG - Intergenic
988193058 5:27964168-27964190 CAGCTGAAGCAAAGTCCAGAAGG - Intergenic
990380456 5:55217717-55217739 GACAAGAAGCAGAGGCCGAAAGG + Intergenic
991333151 5:65515169-65515191 CAGCAAAAGCAGTGGCTAGAGGG - Intergenic
991561424 5:67957701-67957723 GACAAGAAGCTGAGGCCGGAGGG + Intergenic
992015537 5:72572009-72572031 GAGCAGAAGCAGATGGCAGATGG - Intergenic
993178451 5:84518560-84518582 CAGCAGTGGCAGAGGCAGCATGG + Intergenic
993522031 5:88914918-88914940 AGGCAGAAGCAGAGGAGGGAAGG - Intergenic
993659018 5:90607363-90607385 CAGCAGCAGCACAGGATGGAAGG - Intronic
996232894 5:121087949-121087971 CTGCAGAAGCAGAGCCCTCATGG - Intergenic
997710029 5:135996402-135996424 GAGCAGCAGCAGAGGCTGAAAGG - Intergenic
998080883 5:139274108-139274130 CAGCACCGGCAGAGGCCGGAGGG - Exonic
999383164 5:151136000-151136022 CTGCAGAAGCAATGGCAGGAAGG + Intronic
1000147720 5:158469456-158469478 GCACAGAAGCAGAGACCGGAAGG - Intergenic
1000435803 5:161207299-161207321 CAGCAAAAGTAGAGGCCCAATGG + Intergenic
1000734562 5:164882821-164882843 CAGAAGAAGCAAAGGAAGGAAGG - Intergenic
1001106535 5:168859157-168859179 CGGCAGAAGCAGGGGGTGGAGGG + Intronic
1001769700 5:174284299-174284321 CAGCATAAGCAAAGGCATGAAGG + Intergenic
1002292062 5:178206741-178206763 CAGAAGGAGCACAGGCTGGATGG + Exonic
1002319547 5:178366739-178366761 CAGCAGAAGCACAGGCACGGAGG - Intronic
1002590418 5:180287611-180287633 CAGCTTAGGCAGAGGCCTGAAGG - Intronic
1002787727 6:417238-417260 GAGCAGAGGCAGAGGGCAGAGGG - Intergenic
1002929548 6:1624044-1624066 CAGCGGCAGCAGGGGCCGCAGGG + Exonic
1003471968 6:6444892-6444914 CAGCAGAGGCAGAGATCGGGAGG + Intergenic
1003870388 6:10398307-10398329 CAGCAGTAGCAGCAGCAGGAAGG + Exonic
1004275814 6:14234180-14234202 CCACAGAAGCAGAGGCAGGAAGG + Intergenic
1004528153 6:16428664-16428686 CAGCACAAGCTGATGCCAGAGGG + Intronic
1005021443 6:21423213-21423235 CAGCCGAAGAAGCAGCCGGAGGG - Intergenic
1007342578 6:41200976-41200998 CAGCAGCAGCAGCAGCAGGAAGG + Exonic
1008368367 6:50707798-50707820 CAGCAGAACCGGAGACCGGGAGG - Intergenic
1008664336 6:53701243-53701265 TAGCAGAAGCAGAAGCATGAAGG - Intergenic
1008723642 6:54390062-54390084 AAGCAGAAGCATAGACCAGAGGG - Exonic
1010766190 6:79778988-79779010 CTGCAGAAGGAGAGGCCAGGTGG + Intergenic
1011290482 6:85772062-85772084 CAGCAGCAGCAGTGGCAGCACGG + Intergenic
1012417725 6:99027711-99027733 CAGCAAGAGCAAAGGCCGTAAGG + Intergenic
1012616424 6:101284132-101284154 CAGCAGAAGCAGTGGCAGAGAGG - Intergenic
1012649980 6:101740691-101740713 CACAAGAAGCAGAGGCTGGCTGG - Intronic
1013393689 6:109713284-109713306 CAGCAGCAGCAGAGGCAGCATGG + Intronic
1013564423 6:111342859-111342881 CAGCAAAATGAGAGGCTGGAAGG + Intronic
1013716390 6:112967884-112967906 CTGCAGAAGCAGAGCCCTGATGG - Intergenic
1015320392 6:131866421-131866443 CAGCAACAGCAGAGGAAGGAAGG + Intronic
1015808681 6:137140001-137140023 CACCAGAAGCAGAAGCTGCACGG - Intergenic
1016355065 6:143209636-143209658 CAGAAGGAGCAGAGCCCTGACGG + Intronic
1016455178 6:144223211-144223233 AAGATGAAGCAGAGGCCAGATGG - Intergenic
1017056507 6:150441448-150441470 CAGCAGAGGTGGAGGCAGGAAGG - Intergenic
1017730170 6:157308632-157308654 CAGCAGAAGAGGAGGCAAGACGG + Intronic
1018739283 6:166714972-166714994 AAGAAGGAGCACAGGCCGGACGG - Intronic
1019190429 6:170247644-170247666 GGGCAGCAGCAGAGGCAGGAGGG + Intergenic
1019260954 7:81779-81801 CAGCAGACACGGAGGCCGCAGGG - Intergenic
1019721317 7:2573706-2573728 CTGGAGAAGCAGAGCACGGATGG - Intronic
1019943980 7:4312209-4312231 GAGCAGAAGCAGAGGGAGGGAGG - Intergenic
1020042105 7:5012125-5012147 CAGCAGAAGCAATGGAAGGATGG - Intronic
1020474714 7:8581916-8581938 TAGCACAAGCAGAGGCAGCAGGG - Intronic
1021067721 7:16197577-16197599 AGGCAGAGGCAGAGGCAGGAAGG - Intronic
1021067882 7:16198794-16198816 AGGCAGAGGCAGAGGCAGGAAGG - Intronic
1022171705 7:27837792-27837814 CAGCAGCAGCAGATGCAGGAAGG + Intronic
1022507089 7:30914072-30914094 CATCCGAGGCAGAGGCGGGAGGG + Intronic
1022963674 7:35454076-35454098 AAGCAGAGGCAGGGGCCAGAAGG - Intergenic
1023203758 7:37725852-37725874 TAGCAGTAACAGAGGCAGGAAGG - Intronic
1024096391 7:45986180-45986202 CTGCAGAACCAGAGGCCTGGGGG + Intergenic
1024385709 7:48748955-48748977 CAGCAGGTGCAGAGCCCAGAGGG - Intergenic
1024983877 7:55179549-55179571 CAGGAGGACCAGAGGCTGGAGGG + Intronic
1025093467 7:56081180-56081202 GAGCCGGCGCAGAGGCCGGAGGG + Exonic
1026093802 7:67324396-67324418 AGGCAGAAGCAGAGGAGGGAAGG + Intergenic
1026458952 7:70596406-70596428 AGGCAGAGGCAGAGGCCGGCTGG + Intronic
1028168258 7:87564348-87564370 CAGCAGAAGCAGGGGCCAGTGGG - Intronic
1029155489 7:98514518-98514540 CACCAGCAGCTGAGGCAGGAAGG + Intergenic
1029160706 7:98549429-98549451 CAGGAGATGCAGGGGCCGGATGG - Intergenic
1029414177 7:100432719-100432741 AGGAAGAAGCAGAGGCAGGAAGG + Intronic
1030160360 7:106502159-106502181 CTGCAGAAGCAGAGTCAGGAGGG - Intergenic
1030412418 7:109198134-109198156 ATGCAGACACAGAGGCCGGAGGG + Intergenic
1031619815 7:123922714-123922736 GAGCAACAGCAGAGGCAGGAAGG - Intergenic
1031894765 7:127336444-127336466 TAGCAGAAGCAGAGGCTGGAGGG - Intergenic
1031972347 7:128073915-128073937 CCGCAGAAGGAGTGGCCAGAAGG - Intronic
1032458988 7:132095401-132095423 ATTCAGAAGCAGAGGCTGGAAGG - Intergenic
1034295196 7:149966233-149966255 CTGGAGAAACAGAGGCTGGAAGG + Intergenic
1034810867 7:154130714-154130736 CTGGAGAAACAGAGGCTGGAAGG - Intronic
1035028123 7:155839901-155839923 GAGGAGAATCAGAGGTCGGATGG + Intergenic
1035224404 7:157425491-157425513 AAGCAGAGGCAGAGGGCAGAGGG + Intergenic
1035355263 7:158272812-158272834 CGGCAGAAGGAGAGGTGGGAAGG + Intronic
1035447381 7:158952123-158952145 CAGCAGAAGAAGAGCCCAGAGGG + Intronic
1035578539 8:725049-725071 CAGCAGGTACAGAAGCCGGAGGG - Intronic
1037483297 8:19325080-19325102 CAGGACCAGCAGACGCCGGAGGG - Intronic
1037591137 8:20313135-20313157 CAGCAGAGGCAGTGGCGGCAGGG - Intergenic
1037662733 8:20941337-20941359 CAGCAGATGCAGAGGGCAGGAGG + Intergenic
1037747832 8:21661055-21661077 GAGCAGAAGGAGAGGCCGGTAGG - Intergenic
1039281611 8:35991447-35991469 CAGCAGAAGAAGTGCCCAGAGGG - Intergenic
1041515855 8:58697991-58698013 CAGCTGAAGGAGAGGCCTGTAGG + Intergenic
1041928552 8:63263675-63263697 CAGCAGAAGCAGCTGGTGGATGG + Intergenic
1042307078 8:67343524-67343546 CGGGAGAAGCGGAGGCCCGACGG - Exonic
1042407534 8:68422748-68422770 CTGCAGTAGCAGAGGCCTCATGG - Intronic
1042939735 8:74095671-74095693 CAGCAGCAGAAGAGGTAGGAGGG - Intergenic
1042976938 8:74479840-74479862 CAGCAAGAGCAGAGGCTGTAGGG + Intronic
1044251920 8:90012918-90012940 AAGCAGGAGCAAAGGCCAGAAGG + Intronic
1044720540 8:95141495-95141517 CAGCTGCAGCAGAGGCTGTAGGG - Intronic
1044726170 8:95196012-95196034 AAGTAGAAGCAGAGTCCGGGCGG - Intergenic
1045325142 8:101112362-101112384 CAGCAGGAGCGGAGGCCAGGAGG + Intergenic
1045426242 8:102068427-102068449 CAGCAGGTGCAGAGGCCGTGAGG - Intronic
1045502674 8:102755524-102755546 CAGCAGAACCACTGGCTGGAGGG - Intergenic
1045615487 8:103905416-103905438 CATCAGAAACAGAGGCCAAAAGG - Intronic
1045718320 8:105074908-105074930 CAGCAGCAGCAGCAGCGGGAGGG - Intronic
1046548444 8:115681480-115681502 CAGCAGGTGCAAAGGCCGAAAGG - Intronic
1048164787 8:132053038-132053060 CAGTACAAGCAAAGGCAGGATGG - Intronic
1048308045 8:133297186-133297208 CCGCGGAAGCCGAGGGCGGATGG + Exonic
1048455046 8:134570113-134570135 CAGCAGGTGCAGAGGCCCGGAGG - Intronic
1048876126 8:138838059-138838081 CAGCAGAAGCAGTGGCGTGGAGG + Intronic
1048926566 8:139277333-139277355 GAGAAGCAGCAGAGGCCAGATGG - Intergenic
1049057979 8:140254177-140254199 CTGCAGGAGCAGAGTCAGGAGGG - Intronic
1049445965 8:142631705-142631727 CAGGAGAAGCAGAACCGGGAGGG + Intergenic
1049507161 8:143008897-143008919 CAGCTGAGGCAGAGCCCGGAGGG - Intergenic
1049507952 8:143013827-143013849 CAGCGGCAGCAGGGGCTGGATGG + Intergenic
1049741378 8:144242697-144242719 CTTCATAGGCAGAGGCCGGAGGG + Intronic
1052196842 9:25727681-25727703 CAGCAGGAGAAGAAGCTGGAAGG - Intergenic
1055647487 9:78374886-78374908 CAGCAGAAGCAGAGACGGTGTGG + Intergenic
1056410756 9:86324290-86324312 CAGCAGCAGCAGAGCCTGGTGGG - Intronic
1056572594 9:87828699-87828721 CAGCAGTGGCAGAGGCAGCATGG - Intergenic
1056786368 9:89595182-89595204 CAGCAGGAGCAGAGGCGAGCTGG + Intergenic
1056815052 9:89795114-89795136 GAGCAGGAGCAGAGCCAGGACGG - Intergenic
1056840376 9:89994092-89994114 CAGCAGTGGCAGAGGCCAAAGGG + Intergenic
1056947756 9:91014170-91014192 CATCAGATGCAGAGACAGGAAGG + Intergenic
1058297443 9:103326890-103326912 CAGGAGAAGCAGAGGGAGCAGGG - Intergenic
1058957707 9:109964375-109964397 AGGCAGAGGCAGAGGCAGGAAGG + Intronic
1059235239 9:112755307-112755329 TGCCTGAAGCAGAGGCCGGAAGG + Intronic
1062103750 9:134741591-134741613 GTACAGAAGCAGAGGCAGGAGGG + Intronic
1062436732 9:136549660-136549682 CAGCAGAACCTGAGGCCCGGCGG - Intergenic
1062610018 9:137369427-137369449 CAGGAGGAGCAGAGGGCGGGCGG - Intronic
1062634728 9:137484833-137484855 CAGCAGCACCAGAGGCCGCCTGG + Intronic
1062640398 9:137515657-137515679 CGGCAGATGCAGAGGCCTGGTGG - Intronic
1185762267 X:2697724-2697746 CAGCAGCAGAAGAGGCCGACTGG - Intronic
1185764835 X:2716858-2716880 CAGCCTAGGCAGAGGCCTGACGG + Intronic
1185861161 X:3580957-3580979 CAGCAGAGACAGAGGAGGGAAGG + Intergenic
1186072904 X:5842106-5842128 AAGCAGAAGCAGAAACAGGAGGG + Intronic
1187256564 X:17648366-17648388 CAGCAGAAGCAGAAGTTGCAAGG + Intronic
1187285332 X:17898762-17898784 CATCACACGCAGAGGCAGGAAGG - Intergenic
1187521779 X:20020616-20020638 TAGCAGCAGCTGAGGCAGGAAGG - Intronic
1188314824 X:28660065-28660087 AAGCAGAAGCAGAGTGAGGATGG + Intronic
1188818187 X:34741150-34741172 CAGCAGAAGAAAAGGACAGATGG - Intergenic
1190390530 X:49926883-49926905 GAGCAGAAGCAGGGGCAGTAAGG + Intronic
1191865244 X:65698568-65698590 CAGCAGAAGCAGTGGGGGGCAGG - Intronic
1192190291 X:68987140-68987162 GGGCAGCAGCAGAGGCAGGATGG - Intergenic
1192291330 X:69798657-69798679 CAGCAGAAGCAGTGCCAAGAGGG + Intronic
1193736214 X:85159838-85159860 CAGCAGCAGCAGTGGCAGCATGG - Intergenic
1193777181 X:85657527-85657549 CTGCAGAAGCAGAGACCTCATGG + Intergenic
1193894684 X:87098673-87098695 CAGCAGCAGCAGTGGCAGTATGG + Intergenic
1193970044 X:88039611-88039633 CAGCAGCAGCAGTGGTGGGAAGG - Intergenic
1194346719 X:92773995-92774017 CAGCAGCAGCAAAGGCAGCATGG - Intergenic
1194542884 X:95196552-95196574 CCGCAGAAGCAGCGGCAGCATGG + Intergenic
1195544491 X:106100104-106100126 CAGCAGCAGCAGTGGCAGTATGG + Intergenic
1197131915 X:123015086-123015108 CTCCAGAAGCTGAGGCCAGAGGG + Intergenic
1198801552 X:140452791-140452813 CAGGGGTAGCAGAGGCAGGAAGG + Intergenic
1199155017 X:144536784-144536806 CTGCAGAGGCAGAGGCCCCATGG - Intergenic
1200081179 X:153577236-153577258 CAGCAGAAGCCCAGCCTGGAAGG + Intronic
1200655052 Y:5890639-5890661 CAGCAGCAGCAAAGGCAGCATGG - Intergenic