ID: 1184498329

View in Genome Browser
Species Human (GRCh38)
Location 22:44856755-44856777
Sequence TCGGTGATCTTCAGCCTCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 123
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 116}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184498329 Original CRISPR TCGGTGATCTTCAGCCTCCC AGG (reversed) Intronic
900543694 1:3216881-3216903 TCTGTCTTCCTCAGCCTCCCAGG + Intronic
906963232 1:50432167-50432189 TCTGGGATCTTGAGCATCCCAGG - Intergenic
907010664 1:50959998-50960020 TCGGTAACCTTCAGGCGCCCCGG + Exonic
910983607 1:92982835-92982857 CAGGTGATCCTCAGCCTCCCTGG - Intergenic
914318163 1:146533599-146533621 TCGGTTTACTGCAGCCTCCCGGG + Intergenic
918152752 1:181812470-181812492 TGGGTGGTCTTCAGTCTCCGAGG - Intergenic
921301323 1:213753973-213753995 TCGGTGTTCTCCGCCCTCCCAGG - Intergenic
921993809 1:221395929-221395951 GGGGAGATCTTCTGCCTCCCGGG - Intergenic
923577725 1:235175028-235175050 ACTGTAATCTTCAGCCTCCTGGG - Intronic
1063019147 10:2108607-2108629 AAAGTGATCTTCAGCCTCCTTGG + Intergenic
1063054145 10:2484752-2484774 TCTGTGGGATTCAGCCTCCCTGG + Intergenic
1065387445 10:25147665-25147687 TCACTGATCTTCTTCCTCCCAGG + Intergenic
1065642079 10:27793595-27793617 TCTAAGATCTTCAGCCTCCTAGG - Intergenic
1065962365 10:30743977-30743999 TTGGTGATCTACATCCACCCTGG - Intergenic
1066557038 10:36625484-36625506 TCAGTGATCTTCACCATGCCTGG + Intergenic
1071001934 10:80841072-80841094 TTGCTGTTCTGCAGCCTCCCTGG - Intergenic
1072829002 10:98638062-98638084 TCACTGAACCTCAGCCTCCCAGG - Intronic
1075579633 10:123607235-123607257 TCGGTGATCAGCAGCACCCCTGG - Intergenic
1077376604 11:2208195-2208217 TCCTTGCTCTTCAGCCTCCCTGG + Intergenic
1079391310 11:20024290-20024312 TCTGTGATCTTGAGGCTCCGGGG + Intronic
1082776643 11:57250195-57250217 TGAGTGATCTTCAGGGTCCCAGG - Intergenic
1082848481 11:57744821-57744843 TCGGTACTCCTCAGCCTCACAGG + Exonic
1085378350 11:76088629-76088651 TCAGTGATGTTCAGCTTTCCTGG - Intronic
1098140997 12:67450302-67450324 TGTGTGGTCTTCAGCCTTCCAGG - Intergenic
1102427009 12:112851723-112851745 TCTGTTCTCTTCAGCTTCCCAGG + Intronic
1104354917 12:128076935-128076957 TGGGTGTTCTGCAACCTCCCGGG - Intergenic
1104755692 12:131267985-131268007 TGGGTGTCTTTCAGCCTCCCTGG + Intergenic
1105420988 13:20252218-20252240 CCTGTGATGTTCATCCTCCCTGG + Intergenic
1106074078 13:26442222-26442244 ACATTGCTCTTCAGCCTCCCAGG - Intergenic
1108721882 13:53140593-53140615 TCTGTTATTTTCAGCCACCCAGG - Intergenic
1119787530 14:77324576-77324598 GTGGTGACCCTCAGCCTCCCAGG - Intronic
1125834906 15:42740629-42740651 ACTGTAATCTTCTGCCTCCCAGG + Exonic
1126100189 15:45114071-45114093 CCGCCGATCCTCAGCCTCCCCGG + Exonic
1128725995 15:69989073-69989095 TAGGTGAGCTAAAGCCTCCCCGG + Intergenic
1129346337 15:74922308-74922330 TCACTGAACTTCCGCCTCCCGGG - Intronic
1131087074 15:89585802-89585824 TCGTTGAAATTCAGCCTCCTTGG - Exonic
1132831587 16:1930747-1930769 TCCCTGAGCCTCAGCCTCCCAGG + Intergenic
1132845872 16:2000551-2000573 AGGGTGCTCTTCAACCTCCCAGG + Intronic
1135548462 16:23380818-23380840 TCAGTGAGTTTCAGCCGCCCGGG - Exonic
1137750959 16:50860720-50860742 TCCTTGGTTTTCAGCCTCCCTGG - Intergenic
1138444758 16:57056523-57056545 CAGGTGATCCTCAGCCTCCCAGG + Intronic
1140114211 16:72027501-72027523 GCGGTCATCATCAGTCTCCCAGG - Intronic
1142013181 16:87727489-87727511 TCTGTGGTCTTCAGTTTCCCTGG - Intronic
1142581915 17:948598-948620 TGGCTGATCTTCAGTCGCCCGGG - Intronic
1142596039 17:1030504-1030526 TGTGTCACCTTCAGCCTCCCTGG - Intronic
1142855552 17:2727502-2727524 TTGGTGATTTTCATCCTTCCAGG - Intergenic
1143992039 17:10973900-10973922 TCGGTGGTATTCAGCAGCCCTGG - Intergenic
1145894573 17:28446726-28446748 CAGATGATCCTCAGCCTCCCAGG + Intergenic
1150487905 17:65556673-65556695 TGGTTGATCTTGAGCCTCTCAGG - Intronic
1150651047 17:67010386-67010408 TCTGTGTTCTTCTGCCTCCTTGG + Intronic
1155931072 18:31709305-31709327 TCCTTCCTCTTCAGCCTCCCAGG + Intergenic
1158806141 18:60975671-60975693 TAGGTAATCTGCAGCCTCACTGG - Intergenic
1162962368 19:14135895-14135917 ACGGAGATCTTCAGCCACCGTGG - Intronic
1163438885 19:17311596-17311618 TCTGTGAGCTTCAGCCACCCTGG + Intronic
1165361063 19:35337382-35337404 GCGGTGAACTTCAGCCTCTGAGG - Intronic
1165488625 19:36110628-36110650 TCTCTGATCTTCAGATTCCCAGG - Intergenic
1167272542 19:48513947-48513969 TCTGTGCCCTTCAGCCACCCGGG - Intergenic
926814347 2:16785582-16785604 TGGATCATCTTCTGCCTCCCTGG - Intergenic
926917656 2:17908753-17908775 TCGCTGTTCTGCAGCCTCCACGG - Intronic
936247621 2:110842355-110842377 TCCATGATCTTGAGCCTCTCTGG - Intronic
940291777 2:152084312-152084334 ACTGTACTCTTCAGCCTCCCTGG - Intronic
942427538 2:175875968-175875990 TCACTGAGCTTCAACCTCCCAGG + Intergenic
944261680 2:197685126-197685148 TCGCTGAACCTCTGCCTCCCAGG + Intergenic
945188578 2:207164646-207164668 TCGGTGCCCTTCAGCATCCTGGG + Intronic
945994519 2:216424848-216424870 ACGGTGATCTTGAGACTCTCTGG + Intronic
948386185 2:237582375-237582397 TTGGTGACCTTAAGCCACCCAGG + Intronic
1169194696 20:3676896-3676918 GCGGTCCTCTTCAGCCTCCAGGG + Intronic
1172757541 20:37297360-37297382 TGGCAGATCTTCATCCTCCCAGG - Exonic
1175762199 20:61568821-61568843 TGCGTGAGCTGCAGCCTCCCAGG - Intronic
1175945805 20:62558180-62558202 GCGGTGTTCTGCAGCATCCCAGG - Intronic
1177602153 21:23329764-23329786 ACTGTGATTATCAGCCTCCCAGG - Intergenic
1178695999 21:34792978-34793000 TGGGTGGTCTCCATCCTCCCAGG - Intronic
1179163744 21:38918816-38918838 TCTGTGATCACCAGCCACCCTGG - Intergenic
1180149957 21:45942372-45942394 TCTGTGCTCTCCAGCCACCCTGG - Exonic
1180742151 22:18061260-18061282 TGGGTGGGGTTCAGCCTCCCAGG + Intergenic
1183546475 22:38456728-38456750 TCGGTGATGGCCAGACTCCCAGG - Intergenic
1184498329 22:44856755-44856777 TCGGTGATCTTCAGCCTCCCAGG - Intronic
950054184 3:10011841-10011863 TGGATGTTTTTCAGCCTCCCTGG - Intergenic
950797926 3:15525681-15525703 TCCCTTATCTTCACCCTCCCAGG - Intergenic
962114035 3:132483023-132483045 CCTCTGATCTTCAGCCTCCCAGG + Intronic
963929092 3:150983271-150983293 TCTCTGAACTTCAGTCTCCCAGG + Intergenic
964287028 3:155129232-155129254 TCTGTGATCCTCAGCCTCTGAGG - Intronic
964848371 3:161068212-161068234 TCTCTGATCCTCAGTCTCCCTGG - Intronic
965330108 3:167362387-167362409 GCTGTCATCATCAGCCTCCCTGG + Intronic
968479676 4:827538-827560 TGGGGTCTCTTCAGCCTCCCTGG + Intergenic
969411614 4:7032065-7032087 ACGATGCTCTGCAGCCTCCCTGG - Exonic
969653194 4:8479955-8479977 ACAGTGAGCCTCAGCCTCCCGGG + Intronic
970614460 4:17754966-17754988 TGGGTTAGCTTCAGCCTCCCTGG + Intronic
971294682 4:25377597-25377619 TCGGTGTTCTTGGGCCCCCCGGG - Intronic
978779199 4:112532250-112532272 TCTGTGTCCTCCAGCCTCCCAGG - Intergenic
982729851 4:158944378-158944400 ACGGTGAACCTCAGCCCCCCAGG + Intronic
989043070 5:37249119-37249141 TCCGCGACCTTCCGCCTCCCGGG - Intronic
995910936 5:117185501-117185523 TCTGTGATCTTCATCCCCCATGG + Intergenic
997711440 5:136008220-136008242 TCTGTGCTCTTCAGCCACTCTGG - Intergenic
999304333 5:150509917-150509939 TAGCTGAGCTTCAGCCTCCTGGG - Intronic
999980868 5:156956738-156956760 TCTGAGATCTACAGCCTGCCTGG - Intronic
1005526578 6:26657356-26657378 TGCGTTATCTTCAGCCTCACAGG + Intronic
1010209401 6:73351360-73351382 ACGGTCTTCCTCAGCCTCCCAGG + Intergenic
1011012994 6:82723023-82723045 TCTGGGATCTTCTGTCTCCCTGG - Intergenic
1013658270 6:112268189-112268211 TGACTGATCTTCAGGCTCCCAGG + Intergenic
1014688679 6:124534224-124534246 TCAGTGAACTTCTGCCTTCCAGG + Intronic
1014925339 6:127264442-127264464 TCGGGCAACTTCCGCCTCCCAGG + Intergenic
1015882198 6:137880803-137880825 GCGGTTTTCCTCAGCCTCCCTGG + Intronic
1016764925 6:147781885-147781907 GTGGTGGTCCTCAGCCTCCCAGG + Intergenic
1021691883 7:23238668-23238690 GCAGTGAACCTCAGCCTCCCGGG + Intronic
1021827454 7:24569806-24569828 ACGGTGATCTTCAGGCAGCCAGG + Intergenic
1022113993 7:27247159-27247181 TGGGGCATCTGCAGCCTCCCTGG - Intronic
1026446811 7:70492002-70492024 GTGGTGTTCTTCAGCCTTCCTGG + Intronic
1035397529 7:158544986-158545008 AAGGTGATCTGCATCCTCCCAGG + Intronic
1035446294 7:158945229-158945251 TCCTTGGTCTCCAGCCTCCCTGG - Intronic
1035831110 8:2695269-2695291 TTGGTGATCTTTGGCGTCCCTGG + Intergenic
1039907643 8:41798207-41798229 TTGGAGAGCTCCAGCCTCCCCGG - Intronic
1044819411 8:96145576-96145598 CCGGTGCTCTTCGGCCGCCCCGG + Intronic
1047255648 8:123211656-123211678 ATGGTGGACTTCAGCCTCCCCGG - Intergenic
1048810836 8:138284565-138284587 TCACTGTTCTCCAGCCTCCCTGG + Intronic
1048852518 8:138658418-138658440 TGGCTGATCTTCATCCTCTCTGG - Intronic
1049086326 8:140481083-140481105 TCGGCTCTCTGCAGCCTCCCAGG - Intergenic
1049291201 8:141803235-141803257 TCAGTGGTTTTGAGCCTCCCAGG - Intergenic
1062236950 9:135514914-135514936 TCAGACATCTTCAGCTTCCCAGG + Intergenic
1186612605 X:11152930-11152952 TAGTTGTTCTTCAGGCTCCCAGG + Intronic
1191039652 X:56066235-56066257 TGGGTGTTCTTCAGTCTCCTAGG + Intergenic
1191873919 X:65774933-65774955 CAAGTGATCCTCAGCCTCCCAGG + Intergenic
1191979373 X:66909173-66909195 ACTGTGATTTTCAGCCTCTCTGG + Intergenic