ID: 1184498557

View in Genome Browser
Species Human (GRCh38)
Location 22:44858216-44858238
Sequence CTGTGCAAGGCTCAGTGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 363
Summary {0: 1, 1: 0, 2: 4, 3: 25, 4: 333}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184498551_1184498557 -4 Left 1184498551 22:44858197-44858219 CCGGTGGTCACCAGCAACTCTGT 0: 1
1: 1
2: 1
3: 15
4: 203
Right 1184498557 22:44858216-44858238 CTGTGCAAGGCTCAGTGGGAGGG 0: 1
1: 0
2: 4
3: 25
4: 333
1184498550_1184498557 -3 Left 1184498550 22:44858196-44858218 CCCGGTGGTCACCAGCAACTCTG No data
Right 1184498557 22:44858216-44858238 CTGTGCAAGGCTCAGTGGGAGGG 0: 1
1: 0
2: 4
3: 25
4: 333
1184498547_1184498557 22 Left 1184498547 22:44858171-44858193 CCTGGCAGTGGGTGTTTGTAGAG 0: 1
1: 0
2: 0
3: 18
4: 161
Right 1184498557 22:44858216-44858238 CTGTGCAAGGCTCAGTGGGAGGG 0: 1
1: 0
2: 4
3: 25
4: 333

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184498557 Original CRISPR CTGTGCAAGGCTCAGTGGGA GGG Intronic
900493058 1:2962348-2962370 CTCTGCAAGCTTCTGTGGGATGG + Intergenic
902658170 1:17883728-17883750 GTGTGCCAGGCCCAGTGTGAAGG - Intergenic
902875510 1:19338494-19338516 TTGTACTAGGCACAGTGGGAAGG + Intergenic
903305152 1:22408098-22408120 AGGTTCAAGGCTCAGAGGGAGGG + Intergenic
903793758 1:25912803-25912825 CTGTGCCAGGCACATTGGGAGGG - Intergenic
904838024 1:33351621-33351643 CTGTGCAAAGCACTGTGGGAAGG - Intronic
905268045 1:36768572-36768594 TGCTGCAAGTCTCAGTGGGAAGG + Intergenic
905479485 1:38251318-38251340 ATGTGCCAGGCTCTGTGTGAGGG + Intergenic
906243887 1:44259596-44259618 CTGTGGGAGGCTGAGTGGGGAGG + Intronic
906986313 1:50687070-50687092 CTTTGGAAGGCTCAGGTGGACGG - Intronic
907039568 1:51246329-51246351 CTTTGGAAGGCCAAGTGGGAAGG + Intronic
908432733 1:64074509-64074531 CTGTGCAAGGCACAGAGGGAGGG + Intronic
910430283 1:87153224-87153246 CTGTGCAGGGCTAGGTGTGAGGG + Intronic
910766892 1:90791113-90791135 CTGTGCATGGCTCCCTGGAATGG + Intergenic
910897719 1:92085782-92085804 CTTTGGAAGGCTGAGGGGGATGG + Intronic
912528428 1:110302669-110302691 ATGTGCAGGGGTCTGTGGGATGG + Intergenic
912775441 1:112503923-112503945 CTGAGGAAGGCAGAGTGGGAGGG + Intronic
913958105 1:143321326-143321348 CTGTGCTAGGGCCAGTGTGAGGG + Intergenic
914052420 1:144146701-144146723 CTGTGCTAGGGCCAGTGTGAGGG + Intergenic
914126777 1:144819840-144819862 CTGTGCTAGGGCCAGTGTGAGGG - Intergenic
917737385 1:177933196-177933218 CTGAGGTAGGCTCTGTGGGAGGG - Exonic
920335971 1:205245350-205245372 CTCTGGAAGGTCCAGTGGGAGGG + Intronic
920363199 1:205433538-205433560 CTATGCAAAGCCCTGTGGGAGGG - Intronic
920400889 1:205675766-205675788 CTGGGCAGGGCTCAGGTGGAGGG - Intronic
924539017 1:244963412-244963434 CTGTGGGAGGCTGAGTTGGATGG + Intergenic
1063485961 10:6421239-6421261 CTTTGGAAGGCTAAGGGGGAAGG + Intergenic
1065191593 10:23215635-23215657 CTGTACTCGACTCAGTGGGAAGG - Intronic
1066759570 10:38739252-38739274 CTGTGCTAGGGCCAGTGTGAGGG - Intergenic
1066962051 10:42233509-42233531 CTGTGCTAGGGCCAGTGTGAGGG + Intergenic
1067085609 10:43236779-43236801 CTGTGAAGGGCTCCGAGGGAGGG - Intronic
1067554578 10:47259640-47259662 CTGGGCAGGGCTCAGGGGGACGG + Intergenic
1067789592 10:49277739-49277761 CTGGGCAAGGCTGAGGGGGTGGG - Intergenic
1067841875 10:49687702-49687724 CTGAGGAAGGCTCATTGCGAAGG + Intronic
1068438367 10:57019568-57019590 TTGTGGAAGGGGCAGTGGGAGGG - Intergenic
1068718859 10:60219547-60219569 GTGTTAAAGGATCAGTGGGAAGG + Intronic
1068726083 10:60305013-60305035 CTGTGGCAGGCACAGTGGGTGGG + Intronic
1069729446 10:70601404-70601426 CTGTTAAGGGCTCAGTGGGAGGG - Intronic
1071537209 10:86443776-86443798 CTTTGGAAGGCTGAGTTGGAAGG + Intronic
1072663735 10:97379514-97379536 CAGTGCAGGGCTCAGCAGGAGGG - Intronic
1072783692 10:98266821-98266843 TTGTGGAAGGCTTTGTGGGAGGG - Intronic
1072813526 10:98482525-98482547 CTCTCAAGGGCTCAGTGGGATGG - Intronic
1073028576 10:100506854-100506876 CTGTGCAAGGCCGAGCGGGGAGG + Intronic
1075320721 10:121489834-121489856 GTGTGGAAGTCTCAGGGGGAGGG - Intronic
1075713280 10:124542104-124542126 CGGTCCCAGGCACAGTGGGAAGG - Intronic
1076691252 10:132224822-132224844 CTGTGCAGGGCTGAGGGGTACGG + Intronic
1078425221 11:11244291-11244313 GTGTGCAGGGCTGAGTGGGCGGG - Intergenic
1079997017 11:27305381-27305403 CTGTGCAACCCTCAGTGGAGAGG - Intergenic
1080210689 11:29781474-29781496 GGGTGCCAGGCTCTGTGGGATGG + Intergenic
1080819414 11:35791052-35791074 CTGGGCCAGGGACAGTGGGAGGG - Intronic
1081332516 11:41821909-41821931 CAGTGCAAAGCTGAGTGGAATGG - Intergenic
1083214266 11:61208562-61208584 CTGTCCAAGGCTGGGTGCGATGG + Intronic
1083217150 11:61227391-61227413 CTGTCCAAGGCTGGGTGCGATGG + Intronic
1083220032 11:61246217-61246239 CTGTCCAAGGCTGGGTGCGATGG + Intronic
1083636247 11:64122528-64122550 CTGGGCTGGGCTCAGAGGGAGGG - Intronic
1083738876 11:64697296-64697318 CTGTGCAGGGCTCAGGGGACTGG - Intronic
1084007988 11:66333321-66333343 CTGCACGGGGCTCAGTGGGAGGG + Exonic
1085602600 11:77868757-77868779 CTGTGTAAGAACCAGTGGGAAGG - Intronic
1086555194 11:88102044-88102066 CTGTGCCAGGCACAGAGTGAGGG + Intergenic
1088089913 11:106025395-106025417 CTTTGCAAGGCTGAGGTGGAAGG - Intergenic
1088222054 11:107579943-107579965 CTGTGGAAGGCTGAGGGGGGAGG - Intergenic
1090893681 11:130950364-130950386 GTGGGCAGGGCTCAGTTGGAAGG - Intergenic
1091729102 12:2866609-2866631 CTGTGCTGAGCACAGTGGGAGGG - Intronic
1092159011 12:6305262-6305284 CTGTGCAGGGCTCAGAGGCTTGG - Intergenic
1092203748 12:6603271-6603293 CTGGGCAAGGATAGGTGGGAAGG + Intronic
1092972831 12:13714534-13714556 CTCAGCAAGACTCTGTGGGATGG - Intronic
1094284159 12:28773665-28773687 CTGTGCAAAGCTCTCTGGCAAGG + Intergenic
1094689393 12:32754331-32754353 TTTTGAAAGGCTGAGTGGGAAGG + Intronic
1096030543 12:48410207-48410229 GTGAGCAAGGCTCTGTGGCATGG + Intergenic
1096667475 12:53175648-53175670 CTGTGCAAGTCCCTGGGGGAGGG - Intronic
1098112450 12:67137473-67137495 CTGGGCAGGACTTAGTGGGATGG + Intergenic
1102195676 12:111023609-111023631 CTTTGAAAGGCTCAGCGGGGAGG + Intergenic
1102556232 12:113728369-113728391 CTGCACAGGGCTCAGTGTGAAGG + Intergenic
1102583942 12:113910222-113910244 CGGTGAAAGGCTCAGGGAGAGGG - Intronic
1103174524 12:118850990-118851012 CTCTGCAAGGCTGAGGTGGAAGG - Intergenic
1103698806 12:122836723-122836745 CTCTGCAAGGACAAGTGGGACGG - Intronic
1104834162 12:131776614-131776636 CTGTGAAAGGCAAAGTGGTAAGG - Intronic
1104969759 12:132525917-132525939 TTGTGCAGGGCACAGTGGGCAGG - Intronic
1105420586 13:20248410-20248432 CTCTGTAAGGAGCAGTGGGATGG + Intergenic
1106118600 13:26838573-26838595 CTGTGACACCCTCAGTGGGAGGG + Intergenic
1107169450 13:37322589-37322611 CTGTGCCAGTCTCTGTGGGAGGG + Intergenic
1107373558 13:39777951-39777973 CTGTGCAAAGCCCAGTGCCATGG + Intronic
1108266092 13:48710303-48710325 CTGGGCAGGGCAAAGTGGGATGG + Exonic
1108879028 13:55086691-55086713 CTGTGCTAGGCTCAGAGCAAAGG + Intergenic
1109320763 13:60807095-60807117 CTCTGCCAGTCTCTGTGGGAGGG - Intergenic
1110228720 13:73146531-73146553 ATGGGCAAGGCTCTGTGGTAGGG + Intergenic
1111028244 13:82562836-82562858 CTTTGGAAGGCTGAGTGGGGTGG + Intergenic
1113582708 13:111440199-111440221 GTGTGCAGGCGTCAGTGGGATGG - Intergenic
1114479679 14:23024937-23024959 CTGCACAAGGCTGAGGGGGAAGG + Intronic
1116448481 14:45038958-45038980 CTGTGCAACCCTCAGTGGAGGGG + Intronic
1119347783 14:73940691-73940713 CTGTGCCAGGCACAGTGTTAAGG - Intronic
1119974933 14:79015026-79015048 CTGAGCAAATCTCAGAGGGAAGG - Intronic
1122217362 14:100213133-100213155 GTGTGAAGAGCTCAGTGGGAGGG - Intergenic
1122322126 14:100861504-100861526 CTGAGCAAGGCTCTGTGTGTAGG + Intergenic
1122782908 14:104151111-104151133 CAGAGCAAAGCTCACTGGGAGGG - Intronic
1123135251 14:106021920-106021942 CTGTGAAAGACTCAGTGAGGAGG - Intergenic
1123164622 14:106314635-106314657 CTGTGAAAGACTCAGTGAGGAGG - Intergenic
1202930305 14_KI270725v1_random:28839-28861 CTGTGCTAGGGCCAGTGTGAGGG - Intergenic
1123422078 15:20142678-20142700 CTGTGCTAGGGCCAGTGTGAGGG + Intergenic
1123443003 15:20303956-20303978 CTGTGCTAGGGCCAGTGTGAGGG - Intergenic
1123531306 15:21149218-21149240 CTGTGCTAGGGCCAGTGTGAGGG + Intergenic
1123585796 15:21759790-21759812 CTGTGAAAGACTCAGTGAGGAGG - Intergenic
1123622438 15:22202378-22202400 CTGTGAAAGACTCAGTGAGGAGG - Intergenic
1125732168 15:41899086-41899108 TTTTGGAAGACTCAGTGGGACGG + Exonic
1126143775 15:45457697-45457719 CTGTGGAAGGCTCAGACGCAAGG + Intergenic
1126369165 15:47927405-47927427 CTGTGGAAGGCTCAGAGGCAGGG - Intergenic
1126778254 15:52117989-52118011 CTGGGGAAGGCACAGTGGGTGGG - Exonic
1126866359 15:52941462-52941484 CTGGGCAAGCCTCAGCTGGAAGG - Intergenic
1128093374 15:64934075-64934097 CTTTGCAAACCTCAGTAGGAGGG + Intronic
1129613087 15:77075789-77075811 CTGTGGAAGGTTTAGTAGGAGGG - Intronic
1129909966 15:79219155-79219177 CTGTGAAAGTCTCAGTGACAGGG - Intergenic
1130031353 15:80317419-80317441 CTGTTCATGACTCAGTGTGATGG - Intergenic
1130212943 15:81942949-81942971 CTGAGCAAGGCACAGTGAGGAGG + Intergenic
1130704171 15:86216882-86216904 CTGTTCAAGGAACAGTGAGATGG - Intronic
1131401596 15:92129631-92129653 CTGTGCAAGGCATAGTGGGAAGG + Intronic
1131416796 15:92266949-92266971 CTGTGCAAGTCTCAGTGGCCTGG - Intergenic
1132684908 16:1158259-1158281 CGTTGCAGGGCTCAGGGGGAGGG + Intronic
1132778350 16:1609555-1609577 CTGTGCAAGGCACTGTTGTAAGG - Intronic
1133020319 16:2964186-2964208 GAGAGCTAGGCTCAGTGGGAGGG + Exonic
1133332408 16:4982611-4982633 CTGTGAAGGGCACAGTGGCATGG + Intronic
1133613354 16:7453713-7453735 CTGTGCATTGCTCAGAGGCAAGG - Intronic
1134249767 16:12566115-12566137 CTGTCCAAGGCTCAGAGGGCAGG + Intronic
1134376573 16:13681181-13681203 CTGTGGAAGGCTCAGGTTGATGG + Intergenic
1134809402 16:17154441-17154463 CTGTTCAAGTCTCAGTGTGTGGG - Intronic
1136773723 16:32860420-32860442 CTGTGCTAGGGCCAGTGTGAGGG - Intergenic
1136896889 16:34001099-34001121 CTGTGCTAGGGCCAGTGTGAGGG + Intergenic
1137044168 16:35640978-35641000 GGGTGCAGGGCTGAGTGGGAGGG + Intergenic
1138016053 16:53429739-53429761 TTGGGCAGGGCTCAGTGGGAAGG + Intergenic
1138271151 16:55696736-55696758 CTGTGGAAGGCTGAGGTGGAAGG + Intronic
1139488157 16:67271038-67271060 CTTGGCCAGGCTCGGTGGGAAGG - Exonic
1141465208 16:84201080-84201102 TTGTGCATGGCACAGAGGGAAGG - Intergenic
1141747849 16:85938088-85938110 CTCTGTATGGTTCAGTGGGAGGG + Intergenic
1142072457 16:88098739-88098761 CTGTGCATGGCTCAGGAAGAAGG - Intronic
1203076141 16_KI270728v1_random:1122531-1122553 CTGTGCTAGGGCCAGTGTGAGGG - Intergenic
1143769913 17:9162042-9162064 CTGAGCAATGCTCATGGGGAGGG + Intronic
1143776135 17:9200122-9200144 CTGAGCAGGGCTCCCTGGGAAGG - Intronic
1144328739 17:14206072-14206094 TTGTGCCAGGCTCTGGGGGATGG + Intronic
1144938481 17:18919120-18919142 CTGTGGAAGGCTAAGGTGGAAGG + Intronic
1145903694 17:28505148-28505170 CAGTGCAAGGGTCAGGGAGATGG + Intronic
1146486614 17:33248257-33248279 CTGTTCAAGGAACAGTGAGAAGG + Intronic
1146804801 17:35856650-35856672 CAGTGAGAGGGTCAGTGGGAAGG - Intronic
1147024695 17:37570727-37570749 CTGTCCAAGGCTGAGGGGCATGG + Exonic
1147219306 17:38919245-38919267 CTGTGTAGGGACCAGTGGGATGG + Exonic
1147962792 17:44177971-44177993 CTGTGCTAGGCTCTCTGGGGTGG + Intronic
1148325679 17:46782203-46782225 CTGTGCCAGCCTCAAAGGGAAGG + Intronic
1148457473 17:47818732-47818754 TTGTGCAAGGCTCACTTGCAGGG + Intronic
1150129964 17:62663765-62663787 CAGTGCAAGGGGCAGGGGGAAGG + Intronic
1150333343 17:64312066-64312088 GTGTGCAAAGCACTGTGGGAAGG + Intergenic
1151426741 17:74035600-74035622 ATGAGCAAGGCACAGTGGGCAGG + Intergenic
1152145298 17:78564720-78564742 CTGTGCTAGGCTCAGTTCTAAGG + Intronic
1152740717 17:82017174-82017196 CTGTGGCAGGGTCAGTGGGCTGG + Intronic
1154176531 18:12089452-12089474 CTGTGCTAGGGCCAGTGTGAGGG - Intergenic
1157376942 18:47175970-47175992 CTGTGCAGGGCCCAGGGGGTTGG - Intronic
1157798888 18:50602452-50602474 CTGAGCTAGGCTCAGGGGGCAGG - Intronic
1161379842 19:3959087-3959109 CTGCGCTAGGCGCAGTGGGGTGG - Exonic
1162111800 19:8403661-8403683 CCGTGCAGAGCTCACTGGGAGGG - Exonic
1162538484 19:11278426-11278448 CTGGGCAAGGCTGAGTGTGGTGG + Intergenic
1162604648 19:11697335-11697357 CTGTGGAAGGCTGAGGGGGGAGG - Intergenic
1163197493 19:15733269-15733291 GGGGGCAAGGCTCTGTGGGAGGG + Intergenic
1164804847 19:31108823-31108845 CTGGACAAGACTGAGTGGGATGG + Intergenic
1164904499 19:31955969-31955991 CTGTAAATGGATCAGTGGGAAGG - Intergenic
1165775472 19:38402043-38402065 CTTTGGAAGGCTGAGAGGGAAGG + Intergenic
1165900387 19:39166924-39166946 CTGTGCAGTGCCCAGAGGGAAGG + Intronic
1166315587 19:41987842-41987864 CTGTGAAAAGCTTAGAGGGATGG + Intronic
1167515856 19:49922832-49922854 CTGTGTCAGGCCCAGAGGGAGGG - Intronic
1202691818 1_KI270712v1_random:99125-99147 CTGTGCTAGGGCCAGTGTGAGGG + Intergenic
925051188 2:816834-816856 CTCTGCTAGGTTCATTGGGATGG - Intergenic
925425578 2:3746684-3746706 CTGTGCAATCCTCAGTGTCAAGG - Intronic
925865003 2:8219806-8219828 CTGGGCAAGGCACAGTGCCAGGG - Intergenic
926212776 2:10883451-10883473 GTGTGCAAGAGTAAGTGGGAAGG + Intergenic
927097327 2:19757490-19757512 CAGTGCCAGGCTAAGTGGAAGGG + Intergenic
927475452 2:23411085-23411107 CTGTGCCAGGCACAGTGGCATGG + Intronic
928507770 2:31971617-31971639 CTTTGCAAGGCTGAGGTGGAAGG - Intronic
929305783 2:40359969-40359991 CTGTGCAAGAGTCTGTGGTAGGG + Intronic
931434760 2:62236609-62236631 CTTTGGAAGGCTCAGGGAGACGG - Intergenic
931705466 2:64943054-64943076 CTGTGCAAGGCTCAGGGGATAGG - Intergenic
931842398 2:66168152-66168174 CTGTGAAAGGCTCATTGAGAAGG + Intergenic
931977340 2:67657143-67657165 CCGTGGAAGGTTCAGTTGGAAGG + Intergenic
933954572 2:87354831-87354853 CTGTGCTAGGGCCAGTGTGAGGG - Intergenic
934238767 2:90251051-90251073 CTGTGCTAGGGTCAGTGTGAGGG - Intergenic
934274429 2:91565659-91565681 CTGTGCTAGGGTCAGTGTGAGGG + Intergenic
934322887 2:91983590-91983612 CTGTGCTAGGGCCAGTGTGAGGG - Intergenic
934461194 2:94214382-94214404 CTGTGCTAGGGCCAGTGTGAGGG - Intergenic
934750200 2:96789090-96789112 CTGTGCTAGGCATAGTGGGAGGG + Intronic
934919626 2:98332313-98332335 CTGTGCTGGGAACAGTGGGAAGG - Intronic
935467818 2:103420188-103420210 CAGTTCATGGCTTAGTGGGAAGG + Intergenic
935728897 2:106048437-106048459 CTTTGCGAGGCTGAGTGGGGTGG - Intergenic
938953796 2:136280622-136280644 CTGTGCCAGGCATTGTGGGAGGG + Intergenic
939857811 2:147381613-147381635 CTGTGGAGGACCCAGTGGGATGG - Intergenic
942244408 2:173993777-173993799 CTGTATGAGGCTCACTGGGATGG - Intergenic
943318913 2:186423058-186423080 CAGGGCAAGGCTTAGTTGGATGG + Intergenic
944528935 2:200649079-200649101 CTGGTCAGAGCTCAGTGGGAGGG - Intronic
946076512 2:217078001-217078023 TTGGGCAAGGTTCAGTGGGATGG + Intergenic
946089441 2:217207795-217207817 CTCTGCAAGCTTCAGTGGAACGG + Intergenic
947061349 2:226170102-226170124 CTGTGCTATGATCAGTGGGCTGG - Intergenic
948111440 2:235459154-235459176 CTGTGCTGGGCTCAGTGCCAGGG + Intergenic
948133012 2:235614667-235614689 GTGTGCCAGGCTCAGGGGCAGGG + Intronic
948274191 2:236695540-236695562 CTGTGGATGGCTCAGAGGTAAGG - Intergenic
1168736058 20:137799-137821 CTGTGGAATGCACAGTGGCATGG - Intergenic
1168832009 20:851136-851158 CTGTGCTAGGCAGAGTGGGAAGG + Intronic
1169379850 20:5096859-5096881 CTGTGCTAGGCTTTGTGGGAGGG + Intronic
1169433216 20:5558699-5558721 CTGTGCAAAGCTCATTGCAATGG + Exonic
1169773056 20:9222334-9222356 CTTTGAAAGGCTAAGTTGGAAGG - Intronic
1170793414 20:19526138-19526160 CTCTTCATGGCTCAGTGGGTAGG - Intronic
1171480924 20:25455123-25455145 ATTTGGAAGGCTCAGTGGGTGGG - Intronic
1172145527 20:32755200-32755222 CTGTGCCAGGCACTGTGGTAAGG - Intergenic
1173568284 20:44057761-44057783 CTGTGCTGGGCTCAGCAGGATGG + Intronic
1175837941 20:62008345-62008367 CTGTGCTGGCGTCAGTGGGATGG - Intronic
1175895594 20:62334378-62334400 CTGTGCAGGGCTAGGTAGGATGG - Intronic
1175898942 20:62352447-62352469 CTGTGGGAGCCTCAGTGGCAAGG - Intronic
1176196069 20:63836754-63836776 CTGTGCAAGGCTGGTAGGGAGGG - Intergenic
1176341179 21:5697385-5697407 CTGTACCAGGCACTGTGGGAAGG + Intergenic
1176473433 21:7129538-7129560 CTGTACCAGGCACTGTGGGAAGG + Intergenic
1176503648 21:7627071-7627093 CTGTACCAGGCACTGTGGGAAGG - Intergenic
1176592317 21:8657421-8657443 CTGTGCTAGGGCCAGTGTGAGGG - Intergenic
1176866350 21:14056941-14056963 CTATGCTAGGGTCAGTGCGAGGG + Intergenic
1178643821 21:34368004-34368026 CTGTGAGAGGCTCAGTTGAATGG - Intronic
1180275168 22:10634550-10634572 CTGTGCTAGGGCCAGTGTGAGGG - Intergenic
1180549643 22:16529484-16529506 CTGTGCTAGGGCCAGTGTGAGGG - Intergenic
1180833830 22:18919909-18919931 CTGTGCAGGGCTGGGAGGGAGGG + Intronic
1181355038 22:22292327-22292349 CTGTGCTAGGGCCAGTGTGAGGG + Intergenic
1181493088 22:23272991-23273013 CGGTGCAAGGGTGAGTGGGGAGG - Intronic
1181726786 22:24816966-24816988 TTGTGCCAGTCACAGTGGGATGG + Intronic
1182864092 22:33586820-33586842 CTGTGAAAGGAGCAGAGGGAGGG - Intronic
1182984418 22:34702977-34702999 TTGGGTCAGGCTCAGTGGGATGG - Intergenic
1183268179 22:36843859-36843881 CTGTGCTAGGCGCTGTGAGAAGG - Intergenic
1183369240 22:37423158-37423180 CTGTTCGAGGCACTGTGGGAGGG + Intronic
1184498557 22:44858216-44858238 CTGTGCAAGGCTCAGTGGGAGGG + Intronic
1184578557 22:45395612-45395634 CTTTGCAAGGCTGAGGAGGATGG + Intronic
1184851556 22:47124262-47124284 ATGTGCAGGGTTCAGAGGGAAGG + Intronic
1185234985 22:49706918-49706940 CCGTGCAAGGCTCTGCGGAAGGG + Intergenic
1203240444 22_KI270733v1_random:11849-11871 CTGTACCAGGCACTGTGGGAAGG + Intergenic
1203283916 22_KI270734v1_random:145207-145229 CTGTGCAGGGCTGGGAGGGAGGG + Intergenic
950821022 3:15758650-15758672 CTTTGGAAGGCTGAGAGGGAAGG - Intronic
950987408 3:17389687-17389709 TTGAGCAGGGCTCAGTAGGATGG - Intronic
955370385 3:58346290-58346312 GTGTGCAAGGTGCAGTGGAAAGG + Intronic
958428362 3:94006904-94006926 CTGTGCTAAGCTCAGTGCTAGGG + Intronic
958742901 3:98096193-98096215 GTGAGCAAGGCTCTGTGGGCAGG + Intergenic
959641671 3:108644837-108644859 CTGTGCCAGGCACAGTGCAAAGG + Intronic
961023838 3:123534127-123534149 CTTTGCAGGGCTCAGTGGTTTGG - Intronic
961891075 3:130130698-130130720 ATCTGCGAGGCTCAGTGGGCTGG - Intergenic
962907332 3:139816519-139816541 GTGTGCAGGGCTAAATGGGAAGG - Intergenic
963250223 3:143095951-143095973 CTGTGCAGCCCTCAGTGGAAAGG - Intergenic
963258344 3:143168924-143168946 CAGGGCAAGGCTGGGTGGGATGG + Intergenic
963288671 3:143464472-143464494 CTGTGCACCGATCAGTGGGCAGG - Intronic
963735236 3:149011447-149011469 CTGTGCAGGACTGAGTGGAATGG - Intronic
964881499 3:161428356-161428378 CTGTGGAAGGCTGAGGTGGAAGG - Intergenic
965242312 3:166217669-166217691 CTGTGGAAGGCTGAGGTGGAAGG - Intergenic
966473606 3:180319813-180319835 CTGGGCAAGGAGGAGTGGGAAGG + Intergenic
967380835 3:188855896-188855918 CTCTGTATGGCTCAGTGGCAAGG - Intronic
967814546 3:193787979-193788001 ATGTGCAAGCATCAGTGGCAGGG + Intergenic
967978166 3:195046808-195046830 CTGGGAAAGGCACAGTGGGGTGG + Intergenic
968841239 4:3007433-3007455 ATGTGCAAGACACAGTGGAAGGG - Intronic
969313430 4:6367515-6367537 CTAAGCAAGTCTCAGTGGGGTGG - Intronic
969691081 4:8704655-8704677 CTCTGCAAGGCACAAGGGGAGGG - Intergenic
971241264 4:24891044-24891066 ATGAGCAAGGCGCAGTGAGAGGG - Intronic
971244357 4:24914646-24914668 TTGAGCAAGGCTCAGCTGGATGG - Intronic
974931728 4:68367686-68367708 CTTTGGGAGGCTCAGTGGGGTGG + Intergenic
976904979 4:90226216-90226238 CTGAGCAAGGCTCAGCTGGCTGG - Intronic
977666886 4:99653187-99653209 CAGTGCCAGGCCCAGTGGGTGGG + Exonic
988662501 5:33287308-33287330 ATGTGCAAGGCACTGTGGGGAGG + Intergenic
989431676 5:41362382-41362404 CTGTGCAAGGCTAGGTGAGTTGG + Intronic
993250741 5:85519001-85519023 CTTTGCGAGGCCCAGTGAGACGG + Intergenic
993260574 5:85653991-85654013 CTGTGTAAGGATCAGTTGCAGGG - Intergenic
993260889 5:85656479-85656501 CTGTGTAAGGATCAGTTGCAGGG - Intergenic
993467891 5:88269908-88269930 CTGTGCAAGCTTCTTTGGGATGG - Intergenic
993579977 5:89648702-89648724 CTTCGCAAGGCTGAGTGGGGTGG + Intergenic
994336763 5:98576377-98576399 CTGTACCAGGCACTGTGGGAAGG + Intergenic
995665428 5:114536412-114536434 ATGAGCAAGGCTCAGTGGGAAGG + Intergenic
996441537 5:123496810-123496832 CTTTGGAAGGCTGAGTTGGAAGG - Intergenic
996923543 5:128796713-128796735 GTGTGAAAGGCTCAGTGGAGGGG - Intronic
996942329 5:129023075-129023097 CAGTGAAAGGCTCAGGGGAAAGG + Intronic
999371375 5:151057189-151057211 CTCTGCAAGGCCCAGTGTGTGGG - Intronic
999453689 5:151697535-151697557 CTCTCCAGGGCTCTGTGGGAAGG + Intergenic
999517883 5:152319192-152319214 CAGTACAAGGCTCAGTGTCAGGG - Intergenic
1000071127 5:157742023-157742045 CTGTGATAGGCTGGGTGGGAAGG + Intergenic
1000684221 5:164226931-164226953 CTGTGCTAGCCACAGTGTGAGGG + Intergenic
1000764801 5:165273838-165273860 TTGGGCAGGGCTCAGTGGGATGG + Intergenic
1004427745 6:15517585-15517607 CTGTCCCAGGCACAGTGGGATGG + Intronic
1006010275 6:31037262-31037284 GTATGCAAGGCTCAGTGAGCTGG - Intergenic
1007989228 6:46237996-46238018 TTGGGCCAGGCTCAGGGGGAAGG - Intronic
1009706300 6:67256605-67256627 CTGTGAGAGGGGCAGTGGGAGGG - Intergenic
1009915389 6:69988958-69988980 CTGTGCAAAGCCCAGAAGGATGG - Intronic
1010014223 6:71085797-71085819 CTGTGCAGGGCTGGGTGGAAAGG + Intergenic
1012179121 6:96128879-96128901 CTTTGAAAGGCTGAGTAGGAAGG + Intronic
1015386653 6:132632454-132632476 CTGTACCAGGCTCTGTGGCAGGG + Intergenic
1015488572 6:133799907-133799929 CTCTGCAATTCCCAGTGGGAGGG - Intergenic
1015628203 6:135204049-135204071 CTCTGCATGGCACAGGGGGATGG - Intronic
1015751464 6:136564193-136564215 CTTTCCAGGACTCAGTGGGAAGG + Intronic
1016796937 6:148128206-148128228 CTGGGCAGGACACAGTGGGATGG + Intergenic
1017713217 6:157188283-157188305 CAGTGCAGGGCTCACAGGGACGG + Intronic
1017841185 6:158224238-158224260 CTCTACAAGGCTCAGCGTGAAGG - Intergenic
1018996937 6:168717195-168717217 CTGTGCAATGCCCAGAGGGGTGG + Intergenic
1019016615 6:168884962-168884984 CTGTGCATGGCTCATTAGGCCGG + Intergenic
1019121145 6:169805032-169805054 CTGTGGAGAGCTCAGTGGTATGG - Intergenic
1019440268 7:1042421-1042443 CTGTACAAGACTCAGTTGGTGGG - Intronic
1019587274 7:1812482-1812504 CGGTGCCAGGTGCAGTGGGAGGG + Intergenic
1019688547 7:2396434-2396456 CTCTGCAAGGAGCGGTGGGACGG - Intergenic
1020266336 7:6562797-6562819 CTGTGGGAGGCTTAGTGGGGTGG - Intergenic
1021569189 7:22047144-22047166 CTCTGCAAGGCACAGGGTGAGGG + Intergenic
1022509792 7:30927784-30927806 GTGTGCAAGTCTCAAGGGGAGGG - Intergenic
1022801437 7:33780807-33780829 GTGTGCCAGGCACAGTGGTAAGG + Intergenic
1023061149 7:36328421-36328443 CTCTTCCAGGCTCAGTAGGAAGG + Intronic
1023482560 7:40649959-40649981 CTGAGCATGGCTTAGTTGGATGG + Intronic
1024710894 7:52013244-52013266 CTGTTCAGGGATCAGTGAGAAGG + Intergenic
1025224807 7:57148650-57148672 CTGTGCAAAGCTCATTGCAATGG + Intergenic
1026979047 7:74515987-74516009 CTGTGCCATGCTCAGGGTGATGG - Intronic
1033641776 7:143268611-143268633 CTGTTCAAGGTTGAGTGGGCAGG + Intronic
1034013323 7:147554617-147554639 CTGTCCAAGCCTCAAGGGGAGGG - Intronic
1034200003 7:149278426-149278448 CTGGGCAGGGCTAAGTGGGCTGG - Exonic
1034901307 7:154909657-154909679 CTGTGGAAGGCTGTCTGGGAGGG - Intergenic
1035705763 8:1673213-1673235 CTCTGCAAGGCTGAGGGGGTAGG - Intronic
1035928752 8:3758249-3758271 CTGTGCAAGGCTGAGTGTGATGG - Intronic
1036406900 8:8463154-8463176 CTGTTCAAGGAACAGTGGGGAGG - Intergenic
1037987796 8:23300403-23300425 CTGTGCAGAGCTCAGAGGCAGGG - Intronic
1040417461 8:47207782-47207804 CTGAGCCAGGCTCAGGGAGAAGG - Intergenic
1044420979 8:91995542-91995564 CTTTGGAAGGCTCAGGAGGAAGG + Intronic
1045333708 8:101179818-101179840 CTGTGCGAGGATCATTTGGAAGG - Intronic
1045678972 8:104638830-104638852 CTGTGTAAGGCTCAATGGCAAGG + Intronic
1045793884 8:106020186-106020208 CTTTGGGAGGCTGAGTGGGAAGG + Intergenic
1047628512 8:126680917-126680939 CTGTGCCAGGGTCTGTGGCATGG - Intergenic
1047740415 8:127802156-127802178 CTTTGGAAAGCTGAGTGGGATGG - Intergenic
1048254703 8:132896883-132896905 ATGTGCAAAGCCCAGTGGGTCGG + Intronic
1048965925 8:139614461-139614483 CTGTGCATGGCTGATTGGGAGGG - Intronic
1049709024 8:144055430-144055452 CTGTGCCAGGCAGGGTGGGAGGG - Intronic
1050459314 9:5863626-5863648 CTATGTAAGGATCAGAGGGAAGG + Intergenic
1051935746 9:22440700-22440722 CAGTGCAAGGACCAGTGGGTCGG - Intergenic
1053158613 9:35797510-35797532 CAGGGCAAGTCTCAGTGGGCGGG + Intronic
1053287805 9:36861112-36861134 AAATGCAGGGCTCAGTGGGAGGG + Intronic
1053691688 9:40590059-40590081 CTGTGCTAGGGCCAGTGTGAGGG - Intergenic
1054273113 9:63047426-63047448 CTGTGCTAGGGCCAGTGTGAGGG + Intergenic
1054302945 9:63391025-63391047 CTGTGCTAGGGCCAGTGTGAGGG - Intergenic
1054401726 9:64717541-64717563 CTGTGCTAGGGCCAGTGTGAGGG - Intergenic
1054435329 9:65201850-65201872 CTGTGCTAGGGCCAGTGTGAGGG - Intergenic
1054495061 9:65819831-65819853 CTGTGCTAGGGCCAGTGTGAGGG + Intergenic
1056083691 9:83123620-83123642 AAGAGCACGGCTCAGTGGGAAGG - Intergenic
1057200644 9:93137934-93137956 CCAGGCAGGGCTCAGTGGGAGGG + Intergenic
1057271938 9:93656375-93656397 CTATGCAGGGCCCAGTGGGGAGG + Intronic
1057804595 9:98211269-98211291 CTGTGCCAGGCACCCTGGGAAGG - Intronic
1058286477 9:103186545-103186567 ATGTAAAAGGCTTAGTGGGAGGG + Intergenic
1058916180 9:109568256-109568278 CTGTGCAGAGCCCAGTGGGGTGG + Intergenic
1059139166 9:111835787-111835809 CTGGGGAAGGCCCAGTGGGCAGG - Intergenic
1059598236 9:115746496-115746518 CAATGCTAGGCACAGTGGGAAGG - Intergenic
1060090060 9:120734812-120734834 CTGTGCTGGGCTCAATGGGAAGG + Intergenic
1061257735 9:129462364-129462386 ATGTGCAAGGCTCTGTGTGGAGG - Intergenic
1061415685 9:130445622-130445644 CTGGGCTGGGCTCTGTGGGAGGG + Intronic
1061641579 9:131961724-131961746 CTGTGCTACCCTAAGTGGGAAGG - Intronic
1061807225 9:133143254-133143276 CTGTGGAAGGCTCAGGGGTATGG - Intronic
1062359753 9:136182136-136182158 CTGTGCAGGGCGCAGGGAGAAGG - Intergenic
1203421888 Un_GL000195v1:608-630 CTGTACCAGGCACTGTGGGAAGG - Intergenic
1203622371 Un_KI270749v1:136268-136290 CTGTGCTAGGGCCAGTGTGAGGG - Intergenic
1185930008 X:4192118-4192140 CTTGGCAAGGCTCAGAGTGAGGG - Intergenic
1187034588 X:15524560-15524582 GTGGGCAAGGCTCTTTGGGAAGG + Intronic
1188663568 X:32790863-32790885 TTGTGCAATGCTCAGGTGGAAGG - Intronic
1189133132 X:38521033-38521055 TTGAGCAAGACTCAGTGGAATGG - Intronic
1191181164 X:57565278-57565300 GTGAGCAAGGCTCCGTGGGCTGG - Intergenic
1195639126 X:107154797-107154819 GTCAGCACGGCTCAGTGGGAAGG + Intronic
1197322030 X:125044342-125044364 CTTTGCAAGGCTGAGGTGGAAGG + Intergenic
1198221592 X:134607566-134607588 CTGTGCAAGAACCAGTGGGAAGG + Intronic
1199595155 X:149501248-149501270 TTGTGCTAGGCTCTGTGGAAGGG + Intronic
1200708793 Y:6465534-6465556 CTCTGCAAGGCTCAGGATGAAGG - Intergenic
1201025319 Y:9699175-9699197 CTCTGCAAGGCTCAGGATGAAGG + Intergenic
1201190381 Y:11438768-11438790 CTGTGCTAGGGCCAGTGTGAGGG - Intergenic
1202583228 Y:26403119-26403141 CTGTGCTAGGGCCAGTGTGAGGG + Intergenic