ID: 1184499186

View in Genome Browser
Species Human (GRCh38)
Location 22:44861663-44861685
Sequence GGCCATGTGGACCAACGTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 115
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 107}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184499186_1184499190 -7 Left 1184499186 22:44861663-44861685 CCCTCACGTTGGTCCACATGGCC 0: 1
1: 0
2: 1
3: 6
4: 107
Right 1184499190 22:44861679-44861701 CATGGCCCCCTGCCACTGGCTGG 0: 1
1: 0
2: 2
3: 22
4: 256
1184499186_1184499200 30 Left 1184499186 22:44861663-44861685 CCCTCACGTTGGTCCACATGGCC 0: 1
1: 0
2: 1
3: 6
4: 107
Right 1184499200 22:44861716-44861738 GCAAGTCTCCTGTACCTTCCAGG 0: 1
1: 0
2: 1
3: 6
4: 141
1184499186_1184499197 8 Left 1184499186 22:44861663-44861685 CCCTCACGTTGGTCCACATGGCC 0: 1
1: 0
2: 1
3: 6
4: 107
Right 1184499197 22:44861694-44861716 CTGGCTGGCCACATGACCTTGGG 0: 1
1: 0
2: 5
3: 49
4: 304
1184499186_1184499196 7 Left 1184499186 22:44861663-44861685 CCCTCACGTTGGTCCACATGGCC 0: 1
1: 0
2: 1
3: 6
4: 107
Right 1184499196 22:44861693-44861715 ACTGGCTGGCCACATGACCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184499186 Original CRISPR GGCCATGTGGACCAACGTGA GGG (reversed) Intronic
900507968 1:3039105-3039127 GGCCTTGTGGACCACCCAGAAGG + Intergenic
900836057 1:5005055-5005077 GGATATATGGACCAAAGTGAGGG - Intergenic
905200751 1:36314935-36314957 ATCCATGTGGACCAAGCTGAGGG + Intronic
915488599 1:156239159-156239181 GCCCATGTCAAACAACGTGAGGG - Intronic
916437387 1:164789737-164789759 AGCCAGGTGGACCCACTTGAAGG + Intronic
918783301 1:188731360-188731382 TGCCATGTAGAACACCGTGATGG + Intergenic
923941219 1:238829574-238829596 GGCCATGTGCACCTAGGTGCTGG + Intergenic
924195842 1:241606064-241606086 GGCCATGGAAACCAACTTGAAGG + Intronic
1072614407 10:97039942-97039964 CGTCCTGTGGACCCACGTGAAGG + Intronic
1073560647 10:104493630-104493652 GGCCATCGGGCCCAATGTGATGG - Intergenic
1075677349 10:124304538-124304560 GGGGATGTGAACCAACGTGAAGG - Intergenic
1077481535 11:2817072-2817094 GGGCATGTGGACTAGGGTGAGGG - Intronic
1079160799 11:17992001-17992023 GGCAATGTGGGCCAAAGAGAAGG + Intronic
1079504326 11:21136340-21136362 GGCCATGTGGGCCATGGTAAGGG + Intronic
1080696289 11:34605772-34605794 GGCCATGTGGACCAAGGCAGTGG + Intergenic
1081983731 11:47286644-47286666 AGCCATGAGGAGCAACATGAGGG - Intronic
1090597497 11:128335287-128335309 TGCCCTGTGGGCAAACGTGAGGG + Intergenic
1091992103 12:4963858-4963880 GGCCATGTGGTCCGAGGTGGGGG + Intergenic
1092987641 12:13861855-13861877 GGCCATGTGGAGCAGTTTGAAGG - Intronic
1099351341 12:81572886-81572908 GGACATATGGATCAACTTGAAGG + Intronic
1106419763 13:29576594-29576616 GACCAAGTGGACCATCGGGATGG - Intronic
1107994255 13:45845429-45845451 GGCCATCTGAAACACCGTGATGG - Intronic
1109846716 13:68002309-68002331 GGCCATGTATAACAAAGTGATGG - Intergenic
1114895653 14:26987795-26987817 GGCCATGTGCACAAGCCTGATGG + Intergenic
1120132414 14:80823057-80823079 GGCCATGTGTGTCAACGTCAGGG - Intronic
1123991462 15:25686799-25686821 GGCCATGTGGTCCATCCTGCAGG + Intronic
1126154834 15:45556203-45556225 GGCCATGTGTATCAAAGTCAGGG - Intergenic
1128869723 15:71144878-71144900 GTCCATGTGGACCAAAGTGTAGG + Intronic
1131086549 15:89580264-89580286 TGCCTTGTGGATCAAAGTGAGGG + Intronic
1131551454 15:93360665-93360687 AGCCATATGCACAAACGTGATGG + Intergenic
1131973523 15:97917522-97917544 GGCCATGTGCACGAACATGGGGG + Intergenic
1132591843 16:729507-729529 GGCCAGCTGGACCCACATGAGGG + Exonic
1135618481 16:23932693-23932715 GGTCATGTGGACCAGAGGGATGG + Intronic
1141076380 16:81009474-81009496 GGCCTTGTAGACCATGGTGAAGG + Intronic
1142177268 16:88650974-88650996 GGCCATGTGGGCCAACGAACAGG - Exonic
1144826666 17:18109085-18109107 GGCCATGAGGCCCTAAGTGAGGG + Intronic
1146462165 17:33054951-33054973 GGCCATGTGGCCAATGGTGATGG - Intronic
1152646866 17:81473231-81473253 GGGCATCTGGCCAAACGTGAGGG + Intergenic
1152745385 17:82036407-82036429 GGACATGCTGACCAAGGTGATGG - Exonic
1160451855 18:78971789-78971811 GGCCATGTGGAACCCTGTGATGG - Intergenic
1160478019 18:79210346-79210368 GGCCATGTGGACCCACGCCTGGG + Intronic
1163759700 19:19129352-19129374 GGTCATGTGGGCCATGGTGAGGG + Intronic
1164159770 19:22618550-22618572 AGCCATGTGGACCAAAATGCAGG - Intergenic
1164458607 19:28429073-28429095 GGCTATGGGAACCAGCGTGAGGG + Intergenic
1164843995 19:31416391-31416413 GGCCATGTTGGCCAACCAGAGGG + Intergenic
1164939735 19:32243349-32243371 AGCCAGGTAGGCCAACGTGAGGG - Intergenic
1165475342 19:36027008-36027030 TGCCATGTGAACGATCGTGACGG - Exonic
1167348347 19:48960809-48960831 GGCCCTGTGCACCAAGGTGCCGG + Exonic
1167384328 19:49155276-49155298 GGCAATGTGGACAAACGTTGGGG + Exonic
1167502093 19:49854223-49854245 GGACATGAGGACCAGCGTGTGGG + Intronic
930089513 2:47521482-47521504 GGCCATGTACACCAGCGTGGAGG - Exonic
934496084 2:94800891-94800913 GGCCATGTGGATCAGTCTGAGGG + Intergenic
936404103 2:112187238-112187260 GGCCATGCGGAAGAGCGTGATGG - Exonic
940196485 2:151100651-151100673 GGCTATGAGGAACAACGAGAGGG + Intergenic
942325801 2:174776168-174776190 GGAAATGTGGACCAAAGTCAAGG - Intergenic
944875581 2:203961375-203961397 GGCCAGGTGGGCCACCATGAAGG - Exonic
945230818 2:207587639-207587661 GGCCATGTGGATGAACTTGGGGG + Intronic
949015746 2:241709361-241709383 GGCCATGCAGACCTACGAGATGG + Exonic
1169303931 20:4471827-4471849 GGCCATGTGGACCTTCTTTAAGG - Intergenic
1171455826 20:25271643-25271665 GGCCATGTGGACCAAGAAGCCGG - Intronic
1172427833 20:34867783-34867805 TGCCATGTGGAGCAATGGGAAGG - Intronic
1172630738 20:36376657-36376679 GGCCCTGTGGACCAATGTTGAGG + Intronic
1172770182 20:37377643-37377665 GGCCATGTGGACCCAGGTGATGG + Intronic
1173316670 20:41950884-41950906 GGCCTTGTGGACCACTGTGAAGG + Intergenic
1175408295 20:58749523-58749545 GGCCATCTGGAGCAAGGCGAAGG + Intergenic
1183937355 22:41270820-41270842 GGCCCTGTGGACCCACGTGCAGG - Intronic
1183951644 22:41356031-41356053 GGACATGTGGACCTTCATGAAGG + Exonic
1184499186 22:44861663-44861685 GGCCATGTGGACCAACGTGAGGG - Intronic
957966080 3:87323522-87323544 GGCCATGTGCACCCAGGAGAAGG + Intergenic
959218804 3:103487870-103487892 GGCAATGTGGATCAACCTGGAGG - Intergenic
961457164 3:127029984-127030006 GACCACCTGGACCAGCGTGAGGG + Exonic
961545292 3:127629111-127629133 GGCCATGCGGACCAATGGGGCGG + Intergenic
962712911 3:138102641-138102663 GGCCATGTGCACCCAGGAGAAGG - Intronic
964880999 3:161422813-161422835 GGTGATTTGGACCAAGGTGATGG - Intergenic
967220624 3:187245314-187245336 GGTCAGGTGGACCAAAGTTAAGG - Intronic
978254571 4:106679058-106679080 GGATATGTGGAACTACGTGAGGG - Intergenic
979268691 4:118733873-118733895 GGTCATGTGAGCCAAAGTGAGGG - Intronic
983682576 4:170370878-170370900 GGCCCTGTGGACCAAGGGCAAGG + Intergenic
985077107 4:186226722-186226744 GGCCATGTGGACCCAGATGCTGG - Intronic
992548284 5:77836886-77836908 GGTCATGTAGACCATGGTGAGGG - Intronic
998370449 5:141657396-141657418 GGCCATGTGGGCCATGGTAAGGG + Intronic
1002100428 5:176854990-176855012 GGGCAGGTGGACCAATGAGATGG + Intronic
1005315345 6:24598287-24598309 GGCCATGTGCACCCAGGAGAAGG + Intronic
1005998001 6:30943158-30943180 GGTCCTGTGGACAAACGTCAGGG - Intronic
1006105449 6:31713685-31713707 GGGCATGTGGAGGAACCTGAGGG - Intronic
1013009959 6:106110920-106110942 GGCCATGTGGCCCTATGTGATGG + Intergenic
1013538888 6:111087980-111088002 GGCCATGTGGTGCAACGGGTCGG + Exonic
1019008173 6:168821040-168821062 GGGCATCTGGAACACCGTGAGGG - Intergenic
1021435291 7:20606634-20606656 GCCCATGTGGCCCTACGTGGTGG + Intergenic
1023073397 7:36459725-36459747 GGTCATGGGGTGCAACGTGAAGG + Intergenic
1028659169 7:93248675-93248697 GGCACTGTGGAGCAGCGTGATGG + Intronic
1030682916 7:112451315-112451337 GGCCAGGTGGACCTGCGAGACGG - Intronic
1034193099 7:149225846-149225868 GAGCAGGTGCACCAACGTGAAGG - Exonic
1034380864 7:150691266-150691288 TGCCATGTGGACCAGCGAAATGG + Intronic
1034391986 7:150794099-150794121 GGGCATGTGGACTCACGGGAAGG - Intronic
1034541567 7:151761833-151761855 GGCCATGAGGACAAAGGTCAAGG - Intronic
1047327306 8:123852148-123852170 TGCTGTGTGGACCATCGTGAAGG + Exonic
1048596353 8:135870878-135870900 GGCCATGTTGACCCTCTTGAAGG - Intergenic
1049422812 8:142524409-142524431 GGCCATGAGGGCCATCCTGAAGG - Intronic
1049575465 8:143387800-143387822 GGCCATGAGGACAAACAGGAAGG - Intergenic
1051061156 9:13046641-13046663 GGCCTGGTGGACAAAAGTGAAGG + Intergenic
1053661058 9:40279490-40279512 GGCCATGTGGATCAGTCTGAGGG - Intronic
1053911436 9:42908827-42908849 GGCCATGTGGATCAGTCTGAGGG - Intergenic
1054373178 9:64425705-64425727 GGCCATGTGGATCAGTCTGAGGG - Intergenic
1054523552 9:66096794-66096816 GGCCATGTGGATCAGTCTGAGGG + Intergenic
1054680809 9:67915483-67915505 GGCCATGTGGATCAGTCTGAGGG - Intergenic
1056144935 9:83720152-83720174 GCCCATGTGGACCAAAATGGGGG - Intergenic
1057572365 9:96214385-96214407 GGCCATGAGAAGCAACGAGATGG + Intergenic
1058888650 9:109342452-109342474 GGCCATGTAGTCCAACCTCAAGG + Intergenic
1060482699 9:124026514-124026536 GGGCATGTGGAGCAAGGTGTGGG + Intronic
1061565795 9:131439002-131439024 TGCCAGGTGGACCAAAGTCATGG + Exonic
1203706763 Un_KI270742v1:56918-56940 GGCCATGTGGATCAGTCTGATGG - Intergenic
1190732449 X:53234614-53234636 GGCCATGTGGAGCAAACTGAGGG + Exonic
1190817314 X:53939731-53939753 GGCTTTGAGGACCAAAGTGAGGG + Intronic
1196304691 X:114087401-114087423 GTCCCTGTGGACCACCCTGAGGG + Intergenic