ID: 1184499384

View in Genome Browser
Species Human (GRCh38)
Location 22:44862557-44862579
Sequence GCTGCCATCAGGGGACTCGG AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 166}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184499384 Original CRISPR GCTGCCATCAGGGGACTCGG AGG (reversed) Exonic