ID: 1184505157

View in Genome Browser
Species Human (GRCh38)
Location 22:44896054-44896076
Sequence CAGGCCTAGCGCTACCATGA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 57
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 55}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184505147_1184505157 26 Left 1184505147 22:44896005-44896027 CCTGCTGCTACCTGGATCCTTCC 0: 1
1: 0
2: 1
3: 26
4: 254
Right 1184505157 22:44896054-44896076 CAGGCCTAGCGCTACCATGAAGG 0: 1
1: 0
2: 0
3: 1
4: 55
1184505149_1184505157 9 Left 1184505149 22:44896022-44896044 CCTTCCTTACCTTCCAAATGTTC 0: 1
1: 0
2: 1
3: 38
4: 433
Right 1184505157 22:44896054-44896076 CAGGCCTAGCGCTACCATGAAGG 0: 1
1: 0
2: 0
3: 1
4: 55
1184505150_1184505157 5 Left 1184505150 22:44896026-44896048 CCTTACCTTCCAAATGTTCCGTG 0: 1
1: 0
2: 0
3: 7
4: 105
Right 1184505157 22:44896054-44896076 CAGGCCTAGCGCTACCATGAAGG 0: 1
1: 0
2: 0
3: 1
4: 55
1184505146_1184505157 30 Left 1184505146 22:44896001-44896023 CCAACCTGCTGCTACCTGGATCC 0: 1
1: 0
2: 1
3: 31
4: 307
Right 1184505157 22:44896054-44896076 CAGGCCTAGCGCTACCATGAAGG 0: 1
1: 0
2: 0
3: 1
4: 55
1184505152_1184505157 0 Left 1184505152 22:44896031-44896053 CCTTCCAAATGTTCCGTGGTAAC 0: 1
1: 0
2: 0
3: 2
4: 82
Right 1184505157 22:44896054-44896076 CAGGCCTAGCGCTACCATGAAGG 0: 1
1: 0
2: 0
3: 1
4: 55
1184505148_1184505157 16 Left 1184505148 22:44896015-44896037 CCTGGATCCTTCCTTACCTTCCA 0: 1
1: 0
2: 2
3: 34
4: 329
Right 1184505157 22:44896054-44896076 CAGGCCTAGCGCTACCATGAAGG 0: 1
1: 0
2: 0
3: 1
4: 55
1184505153_1184505157 -4 Left 1184505153 22:44896035-44896057 CCAAATGTTCCGTGGTAACCAGG 0: 1
1: 0
2: 1
3: 4
4: 61
Right 1184505157 22:44896054-44896076 CAGGCCTAGCGCTACCATGAAGG 0: 1
1: 0
2: 0
3: 1
4: 55

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184505157 Original CRISPR CAGGCCTAGCGCTACCATGA AGG Exonic
901104341 1:6743678-6743700 CCAGCCGAGCGCTACCAGGAGGG - Intergenic
906480497 1:46196374-46196396 CAGACCTGGCCCTACCTTGAGGG - Intronic
916142202 1:161709792-161709814 CTTGCCTAGGTCTACCATGAAGG + Intronic
1079963845 11:26956285-26956307 CAGGCCTAGTTCCATCATGAGGG - Intergenic
1081995364 11:47360166-47360188 CAGGCCTAGAGTAACCATGCAGG - Intronic
1084377118 11:68784926-68784948 AAGGTCTGGCTCTACCATGATGG - Exonic
1086009116 11:82077309-82077331 CACACCTACCGGTACCATGACGG - Intergenic
1088584795 11:111353067-111353089 TAGGCTTAGTGCTACCATGTGGG - Exonic
1091025424 11:132136928-132136950 AAGGCCTAGTGCGACTATGAAGG - Intronic
1094800058 12:34022729-34022751 CAGGCGCAGCGCTACTGTGAGGG + Exonic
1095112849 12:38317023-38317045 CAGGCGCAGCGCTACTGTGAGGG + Exonic
1095954758 12:47799641-47799663 CAGGCCCAGAGCTGCCATGGAGG - Intronic
1099105296 12:78488539-78488561 CAGAACTACCACTACCATGAAGG - Intergenic
1100807276 12:98299012-98299034 CAGTCCTAGCTCAACCAAGAAGG + Intergenic
1103554041 12:121755207-121755229 CAGGCTTAGTGGTACCAAGAAGG - Intronic
1103866001 12:124052604-124052626 CCAGCCCGGCGCTACCATGATGG + Intronic
1112356810 13:98680273-98680295 CAGGTCTAGCTCTATCATGCAGG - Intergenic
1117978620 14:61321423-61321445 CAGACCCAGCGCTACAAGGAGGG + Intronic
1118707273 14:68491802-68491824 CAGGCTTAGGCCTTCCATGAAGG - Intronic
1123756540 15:23401443-23401465 CAGGCATGGCTCCACCATGACGG - Intergenic
1137269379 16:46893580-46893602 CAGGCCTCGCACCAGCATGAGGG - Intronic
1151058709 17:71065128-71065150 CAGGCCTAGCTCTCTCATTAAGG + Intergenic
1152895556 17:82909075-82909097 CAGGCCCAGAGCTCCCTTGAAGG - Intronic
1168073490 19:53965511-53965533 CTGTCCTAGGGCTCCCATGATGG - Intronic
934679059 2:96269486-96269508 CAGGCCTGACTCTACCATGCTGG + Intronic
935213803 2:100960264-100960286 CCGGCCTCGTGCTATCATGATGG - Intronic
936078238 2:109415440-109415462 CAGGGCGAGTGCTACCATCACGG + Intronic
936373259 2:111920337-111920359 CAGGCCTGGCGCTTGCAGGAAGG - Intronic
939545357 2:143545408-143545430 CAGGCCTAACTCTGCCCTGAAGG - Intronic
941595566 2:167472500-167472522 CAGGCTAAGAGCTACCAAGATGG - Intergenic
944127332 2:196309196-196309218 CAGGCTGAGCTCTACCATGCAGG - Intronic
1172168499 20:32913990-32914012 CAGGCATAGAGCCACCATGGGGG - Intronic
1175996351 20:62813818-62813840 CAGGCCTTGGGCTTCCCTGAGGG - Exonic
1180131432 21:45829533-45829555 GTGGCCTAGCGGTACCAGGACGG + Intronic
1183382686 22:37498322-37498344 CAGGCAGAACCCTACCATGATGG - Intronic
1184505157 22:44896054-44896076 CAGGCCTAGCGCTACCATGAAGG + Exonic
955148664 3:56345332-56345354 CAGGCATAGCCCTACTCTGATGG + Intronic
961838372 3:129684441-129684463 CAGGCCTAGTGCCACCTGGAGGG - Intronic
963175904 3:142297670-142297692 AGGGCCTAGCACTACCATGGGGG - Intergenic
968562943 4:1294648-1294670 CAGGCCCTGGGCTAGCATGATGG + Intronic
971396995 4:26237838-26237860 CAATCCTAGCTCTATCATGAAGG + Intronic
986661011 5:10060248-10060270 CCAGCCAAGCTCTACCATGAAGG + Intergenic
987349144 5:17006159-17006181 CAGGCAAAGGGCTACCATGTTGG + Intergenic
993098822 5:83511472-83511494 CAGGCACAGGGCTGCCATGATGG - Intronic
996112693 5:119584070-119584092 CAGGGCTACCACCACCATGAAGG - Intronic
1001312373 5:170620480-170620502 CAGCCATTGTGCTACCATGAGGG + Intronic
1012410203 6:98947924-98947946 CCGGCCTAGCGCGACCCGGAAGG + Exonic
1020128622 7:5546959-5546981 CAGGCCCAGGGACACCATGATGG - Intronic
1024221148 7:47288210-47288232 CAGGCCTAGATCTACCATTCAGG + Intronic
1027679301 7:81199674-81199696 CATACCTACCTCTACCATGAGGG + Intergenic
1034348903 7:150404023-150404045 CGGGCCTCCCGATACCATGAGGG - Intronic
1036913690 8:12784287-12784309 CAGGCCTACCTCTAGCATGGGGG - Intergenic
1044063142 8:87664206-87664228 CTGGCCTAGAGCTGCCATTAGGG + Intergenic
1050130945 9:2411873-2411895 CAGGCCTTGTGCTAACATGTGGG - Intergenic
1052436649 9:28438076-28438098 AAGGCCTAGGGCTTTCATGATGG + Intronic
1060963794 9:127700339-127700361 CAAGCCTAGCGCCTCCATGATGG + Intronic
1186199068 X:7137981-7138003 CAGGGCTGGGGCTAGCATGAAGG + Intronic