ID: 1184505243

View in Genome Browser
Species Human (GRCh38)
Location 22:44896839-44896861
Sequence TTTCTGTCACTTATGAAACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 385
Summary {0: 1, 1: 0, 2: 1, 3: 25, 4: 358}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184505241_1184505243 10 Left 1184505241 22:44896806-44896828 CCATTTCTTTGACTTTGTATACA 0: 1
1: 0
2: 1
3: 46
4: 489
Right 1184505243 22:44896839-44896861 TTTCTGTCACTTATGAAACAGGG 0: 1
1: 0
2: 1
3: 25
4: 358
1184505240_1184505243 25 Left 1184505240 22:44896791-44896813 CCAGTTTTGTAATGACCATTTCT 0: 1
1: 0
2: 1
3: 24
4: 296
Right 1184505243 22:44896839-44896861 TTTCTGTCACTTATGAAACAGGG 0: 1
1: 0
2: 1
3: 25
4: 358

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184505243 Original CRISPR TTTCTGTCACTTATGAAACA GGG Intronic
902883254 1:19386781-19386803 TTTCTGTGAGTTATGAGGCAGGG - Intronic
904630697 1:31840076-31840098 TCTCTCTCTCTTTTGAAACAGGG + Intergenic
905639405 1:39578191-39578213 TTCCTGGCACTTATGGAAGAAGG - Intergenic
905830126 1:41059152-41059174 TCTGTATCACTTATGCAACAGGG - Intronic
905983116 1:42249976-42249998 TTTCTTGCATTTATGATACACGG - Intronic
907291451 1:53415515-53415537 TGTCTGACACCTATGAAGCAGGG + Intergenic
909214491 1:72868881-72868903 TTACTGTCTCTTATGAATTAAGG - Intergenic
909405690 1:75286718-75286740 TTTTTTTCATTTATGAAACTTGG + Intronic
910311023 1:85824798-85824820 TTTCTGTAACGTATGAAAATAGG - Intronic
911692999 1:100856688-100856710 TTTCTGTCACTATTGTAACTGGG + Intergenic
911930407 1:103895647-103895669 TTTCTGTCTTTTATCAAAAATGG + Intergenic
913182883 1:116339614-116339636 TTTTTGACACTTTTGAAAAATGG + Intergenic
913250397 1:116908618-116908640 TTTCTTTCATTTTTGAGACAGGG - Intergenic
914957997 1:152181880-152181902 CTCTTGTCACTTATGAGACAAGG - Intergenic
915055064 1:153121659-153121681 TTTTTTTTAATTATGAAACAAGG - Intergenic
916865021 1:168847421-168847443 TTTCTTTCACTTATGAATGTAGG - Intergenic
917113233 1:171574381-171574403 TTTCTGCCATTTAAGAAACTAGG + Intronic
917344676 1:174016987-174017009 TTTCTAACACTTATTCAACAAGG + Intronic
917385999 1:174474913-174474935 TTTCTGTCATCTATAAAGCAGGG + Intronic
918167055 1:181960308-181960330 TCTCCTTCACTTATGAAGCACGG + Intergenic
918640468 1:186834840-186834862 TTTCTGGCTCTTATTAAACCTGG + Intronic
920363279 1:205434195-205434217 TTTCTCTCTCTTTTGAGACAGGG + Intronic
921356751 1:214291735-214291757 TTTGTGTCAGTCATGAGACAGGG - Intronic
921628973 1:217410980-217411002 TCTCTCTCACTTATGAGTCAGGG - Intergenic
922335000 1:224611980-224612002 GTTCTGTAACTAATAAAACAAGG + Intronic
922358978 1:224803685-224803707 TTTGTGTCACTTCTTCAACAAGG - Intergenic
923088425 1:230719839-230719861 TTTCAGGTACTTATGAAAAATGG + Intergenic
923399736 1:233604744-233604766 TTTCTTTCTTTTTTGAAACAGGG + Intergenic
924689398 1:246331258-246331280 GTTTTGCCACTTATGAAAAAGGG + Intronic
924743562 1:246812441-246812463 TTTCTTTCCTTTTTGAAACAAGG - Intergenic
1062997802 10:1883224-1883246 TTACTGTCATTTTTGAAACAGGG + Intergenic
1063648870 10:7913430-7913452 TTTCTATTACTTATGAGAAAAGG - Intronic
1063776095 10:9266792-9266814 TTTCTTTGAATTATGAAAGAAGG + Intergenic
1063977574 10:11429625-11429647 TTTCAGTCTCTGGTGAAACAGGG + Intergenic
1064180810 10:13112941-13112963 TTTCTGTCATTTTTCAAACTAGG + Intronic
1064899700 10:20281064-20281086 TTTCTGTCACTTAGCAAAAGTGG + Exonic
1064915195 10:20448905-20448927 TCTCTGGCACTTCTGAAAAATGG - Intergenic
1065781199 10:29169588-29169610 TTTCTGTCACTTATCTGAGAAGG + Intergenic
1066459087 10:35597614-35597636 TTTCACTCAGTTGTGAAACAGGG - Intergenic
1066515160 10:36150788-36150810 TTTCTGACACTTATTAAATCAGG - Intergenic
1067518063 10:46971667-46971689 TTTCTGTTACTTATCTATCAGGG + Intronic
1067644185 10:48080161-48080183 TTTCTGTTACTTATCTATCAGGG - Intergenic
1067892381 10:50148115-50148137 TCTCTCTCACTTTTGAGACAGGG - Intergenic
1067970817 10:50968425-50968447 TTTCTGTCTCCTAGGAAAGAGGG - Intergenic
1068458497 10:57293127-57293149 TTTCTGTAACTTCTGAGGCAAGG - Intergenic
1068479036 10:57565280-57565302 ATTCTGTCATTTGTGAAACATGG - Intergenic
1068824061 10:61413130-61413152 TTTCTTTCACCCATGAAATAGGG - Intronic
1068843049 10:61637741-61637763 ATTCAGTCATTTGTGAAACATGG - Intergenic
1071431437 10:85610087-85610109 TTTCTGGCTCTTAAGAAATATGG + Intronic
1072763374 10:98076800-98076822 TTTCTGGCACTCATGGAAGATGG + Intergenic
1075022548 10:118962287-118962309 TTTCTGTCACTTAAGCCACATGG - Intergenic
1075129855 10:119728232-119728254 TGGCTGTTACTTCTGAAACATGG - Intronic
1079266221 11:18935487-18935509 TTTCTGTACCTAATTAAACATGG - Intronic
1079268369 11:18957718-18957740 TTTCTGTACCTAATTAAACATGG - Intergenic
1079439080 11:20491245-20491267 TTTCTGTCACCGTTGGAACATGG + Intronic
1080041703 11:27766080-27766102 TTTCTGTCTCTTTTTAAAAAGGG + Intergenic
1080261548 11:30354582-30354604 TTTCTGTCACTTTTGACCAAAGG + Intergenic
1080327063 11:31087891-31087913 GTTCTGTTAATTATGAAACAGGG + Intronic
1081261626 11:40968883-40968905 ATTCTGTAGCTTATGGAACAAGG + Intronic
1082017637 11:47503614-47503636 TTTTTCTCTCTTATGAAACTTGG - Intronic
1084706331 11:70818035-70818057 TCTTTGTCAATTATAAAACAAGG - Intronic
1085574800 11:77592630-77592652 TTTTTGTCACTGATAAAATAGGG - Intronic
1086297402 11:85385854-85385876 ATTGTGTCTCTTCTGAAACAGGG - Intronic
1086473001 11:87137050-87137072 TTTCTGTCAGTTATTAGAGAAGG + Intronic
1087329372 11:96760573-96760595 TTTTCCTCACTTATGAAAAAGGG + Intergenic
1087571546 11:99933304-99933326 TTTATGTCACTTATTAAATATGG + Intronic
1087738579 11:101861952-101861974 TTTCTTTTTCTTATGAGACAGGG - Intronic
1090146539 11:124329494-124329516 TTTCTGACACTTAAGTAAAATGG - Intergenic
1090161442 11:124499497-124499519 TTTTTGTTACTAATGAAATAGGG + Intergenic
1090497758 11:127231281-127231303 TTTCTCTGACTTATAAAACTGGG + Intergenic
1093407238 12:18819397-18819419 TTTCTGCCACTTATGAGAAAAGG - Intergenic
1093848007 12:23998178-23998200 TTTCTGTCATTCTTAAAACATGG - Intergenic
1095369796 12:41453332-41453354 TTTTAATCACTTATGAGACAAGG + Intronic
1095782889 12:46079504-46079526 TTTATGGAATTTATGAAACAAGG + Intergenic
1095830093 12:46576275-46576297 TCTCTGTCACTTATCAAAAGAGG + Intergenic
1095966745 12:47872920-47872942 TTTGTGTCACTTGTAAAACAGGG - Intronic
1100573442 12:95864892-95864914 TTCCTGTCTTTTAAGAAACAGGG - Intronic
1100717608 12:97322280-97322302 TCTCTGAGACTTATTAAACAGGG + Intergenic
1100886883 12:99080788-99080810 TTTCTGTCTCTTTGGACACAGGG - Intronic
1101852815 12:108417805-108417827 TGACTCTCACTTATGACACATGG - Intergenic
1102984016 12:117264276-117264298 TTTCTCTCTCTTAAGAGACAGGG + Intronic
1103306876 12:119972127-119972149 TTTCTTTCTCTTTTGAGACAGGG - Intergenic
1103663799 12:122544740-122544762 TTTCTTTCACTTATGAATGTAGG - Intronic
1106131109 13:26940280-26940302 TTTTTATCACTTTTGAACCATGG + Intergenic
1107177753 13:37419597-37419619 ATTTTGTCATTTGTGAAACATGG + Intergenic
1107339135 13:39387586-39387608 TTTCCTTCACCTATTAAACAGGG - Intronic
1107344088 13:39440605-39440627 TTGCTGTCATTTTTGAGACAGGG + Intronic
1107479356 13:40772377-40772399 TACCTGTCCCTCATGAAACAGGG + Intergenic
1107874228 13:44775741-44775763 TCTCTTTCACTTATGAAGCTTGG + Intergenic
1107993362 13:45837927-45837949 TTTCTGTCACCCATGATAAATGG + Intronic
1108364396 13:49695487-49695509 TTTCTTTCTCTTTTGAGACAGGG + Intergenic
1109014113 13:56986617-56986639 TTTCTGTGTCTTATGAAACATGG + Intergenic
1110056462 13:70980495-70980517 TTTCTATCAGTGATGAAGCAAGG - Intergenic
1110091998 13:71463532-71463554 TTGCTGTCACGTAGGAAGCAAGG + Intronic
1110692555 13:78448084-78448106 TTTCCGTGACTGTTGAAACATGG - Intergenic
1111316394 13:86566820-86566842 TTTCTCACAGTTCTGAAACAGGG - Intergenic
1111710886 13:91813177-91813199 TTTTTGACACATATAAAACAGGG + Intronic
1111952412 13:94719880-94719902 TCTCTCTCTCTTTTGAAACAAGG + Intergenic
1112182010 13:97092557-97092579 TTTATGCCACTTAAGAAATATGG - Intergenic
1113317968 13:109204230-109204252 GTTGTGTCATTTAGGAAACATGG + Intronic
1115066910 14:29274245-29274267 TTTATGTAGCTTATGGAACATGG + Intergenic
1115082678 14:29476186-29476208 TTTATATCACTAATAAAACACGG - Intergenic
1116061218 14:39926578-39926600 TTTCTCTTACCTATAAAACAGGG - Intergenic
1117140607 14:52787235-52787257 ATACTGTGACTTATGAAATAAGG - Intronic
1118195322 14:63620269-63620291 ATCCTGTCATTTGTGAAACAGGG + Intronic
1120125069 14:80732109-80732131 TTTCTGTTAAATATAAAACATGG + Intronic
1120801195 14:88690679-88690701 TTTGTGTCACTTATTTAAGATGG + Intronic
1120918100 14:89727844-89727866 TTTCTGTCATTTAAGACACATGG + Intergenic
1122340246 14:101023364-101023386 TATCTGTGACGTATGTAACACGG + Intergenic
1122622581 14:103068318-103068340 TTTCTCTCTCTTTTGAGACAGGG - Intergenic
1124113500 15:26816366-26816388 TTTATGCCATTTATGAAACCAGG - Intronic
1124588167 15:31029639-31029661 TTGCTCTCGCTTATGACACAGGG - Intronic
1125217346 15:37290452-37290474 TTTCTGCCACTTTTATAACAAGG + Intergenic
1125372432 15:38992971-38992993 TTTCAGTGTCTTATGAAAAATGG + Intergenic
1126892763 15:53223658-53223680 TTTCTGTAACTTCTGGAATAAGG + Intergenic
1127046417 15:55030616-55030638 TCTCTGACACTTAGTAAACAAGG - Intergenic
1127220166 15:56871437-56871459 TATCTGGAAGTTATGAAACAAGG - Intronic
1128240950 15:66100545-66100567 TTTTTTTCACCTGTGAAACATGG + Intronic
1129968782 15:79759272-79759294 TTTCTTTCTCTTTTGAGACAAGG + Intergenic
1131317469 15:91352631-91352653 TTCCTCTCACCTATGAAATAAGG - Intergenic
1131775262 15:95788466-95788488 TTTTTATCACTTATGGTACACGG - Intergenic
1133700633 16:8305164-8305186 TTTCTATGACTTAGGAAACGGGG + Intergenic
1134338452 16:13323353-13323375 ATTCTGTCACTTAAAAGACATGG - Intergenic
1135606519 16:23830328-23830350 TTTCTCTCACTTTTGAAGGACGG + Intergenic
1137333778 16:47527976-47527998 TTTCTGTTACTTAAGCCACACGG + Intronic
1138806116 16:60090718-60090740 TCTCTGTAATTTATGAAAAAGGG - Intergenic
1139543028 16:67632801-67632823 TTTCAGTCACTTGAGAAATAAGG + Intronic
1139770004 16:69266721-69266743 TTTATTTTATTTATGAAACAGGG + Intronic
1141692823 16:85606260-85606282 TTTCTCTCAAATATGAAAAATGG + Intergenic
1144272596 17:13632695-13632717 TTTGTGTCACTCTTCAAACAAGG + Intergenic
1144394596 17:14832125-14832147 TTTCTTCACCTTATGAAACAGGG - Intergenic
1144539340 17:16124131-16124153 TATCTGTCTCTTTTAAAACATGG + Intronic
1146428305 17:32765080-32765102 TTTTTTTCACTTTTGATACAGGG - Exonic
1147724503 17:42558222-42558244 TTTCTTTCTTTTATGAGACAGGG - Intergenic
1149097867 17:52866244-52866266 TTTTTTTCACTTTTGAAAAAGGG - Intronic
1149347419 17:55752062-55752084 TTGCTTTCACCTATGAAACCTGG - Intronic
1150320653 17:64211659-64211681 TTTCAGTCCCTTATGTAAAATGG - Intronic
1150339513 17:64355303-64355325 TTTCTTTCTTTTTTGAAACAGGG + Intronic
1150966642 17:69977489-69977511 GTTTTTTCACTTCTGAAACAAGG + Intergenic
1151156382 17:72126210-72126232 CTTCTGTAACTTAAGAAACCTGG + Exonic
1153003074 18:473931-473953 TTTCATTCACTTATGAATCCTGG - Intronic
1156122920 18:33866388-33866410 TTTCTGTCTTTTTTTAAACAAGG - Intronic
1156163557 18:34389848-34389870 ATTCTGTCATTTGTGACACATGG - Intergenic
1158056645 18:53288420-53288442 TTTCCCTCAATTATGCAACATGG - Intronic
1158066615 18:53418098-53418120 ATTCTGTCACATATGTAACTTGG + Intronic
1158928775 18:62299954-62299976 TCACTGACATTTATGAAACAAGG - Intronic
1161415207 19:4142887-4142909 TTTCTCTCTCTTTTGAGACAGGG + Intergenic
1164795370 19:31022615-31022637 TTTCTTTTACTAATGAAATATGG - Intergenic
1165846508 19:38821299-38821321 TTTCTTTCATTTTTGAGACAGGG - Intronic
1168307715 19:55444499-55444521 TTTCTCTCTCTTTTGAGACAGGG - Intergenic
927132784 2:20074555-20074577 TATTTGACACTCATGAAACATGG - Intergenic
927823364 2:26288700-26288722 TTTCTGTTTTTTTTGAAACAGGG - Intronic
928052188 2:28010622-28010644 TTCCTGTCACTTAAAAAAAATGG - Intronic
928242151 2:29595988-29596010 TTACTCTCACTTCTTAAACATGG - Intronic
928781566 2:34828391-34828413 TATCGGTCACTTATGCCACAGGG + Intergenic
929660463 2:43779257-43779279 TTTCTTTCTTTTTTGAAACAAGG - Intronic
930330505 2:49977601-49977623 TTTCTGTAACTTATTAAAATTGG - Intronic
932203255 2:69852245-69852267 TTTCTGCCACTTAGGCTACAGGG - Intronic
933080762 2:77982281-77982303 TTTCTTTAAATTGTGAAACAGGG + Intergenic
933125347 2:78597827-78597849 ATTCTGTCAATTATAACACAGGG + Intergenic
933200283 2:79440148-79440170 TTTCTGGCACTTCTGAAGTAAGG - Intronic
933457879 2:82540206-82540228 TTTGTGACACTTACGAAATATGG + Intergenic
936293382 2:111246502-111246524 TTTCTCTAACTCATGATACAGGG + Intergenic
936550881 2:113438368-113438390 TACCTGTCACCTGTGAAACAGGG + Intronic
937798817 2:126057784-126057806 TTTCCTTCATTTATGAAACTTGG + Intergenic
939032773 2:137096101-137096123 TTTCTGTCTGTTATCAAACTGGG - Intronic
939901990 2:147861777-147861799 TTTCTCTCACTTTGGAAAGAAGG - Intronic
941298405 2:163770014-163770036 TTTCGGTTTCTTATAAAACAAGG + Intergenic
941825036 2:169885569-169885591 TTTCTGTCTGTTTTGAGACAGGG - Intronic
942140839 2:172976290-172976312 TCTCTGACACTTAAGAAGCAGGG + Intronic
942353592 2:175082096-175082118 TTTCTGTCACTTATCACTTAAGG - Intronic
942355126 2:175103207-175103229 TTTGTGGCACATATGAAATATGG - Intronic
942962680 2:181851594-181851616 TTTCCGTCACTACTGAAAAAAGG + Intergenic
943743419 2:191436160-191436182 TTTCTGGCACTTTTTCAACATGG + Intergenic
944481908 2:200165822-200165844 TTTCTGTCCCTTCTAGAACAGGG + Intergenic
946462487 2:219881485-219881507 GTTTTGTCTGTTATGAAACAGGG - Intergenic
1170079305 20:12454138-12454160 GTTCAGTCATTTATGTAACATGG - Intergenic
1171860187 20:30393443-30393465 TTTCTGTGACTTTTAAATCAGGG + Intronic
1172645283 20:36465355-36465377 TTTCATTCACCTGTGAAACAGGG - Intronic
1174565940 20:51464513-51464535 TTTCTGGCACTTCTGAAATAGGG + Intronic
1178809693 21:35870153-35870175 TTTCTTTCAGTTAGGAAATAAGG - Intronic
1182660923 22:31924618-31924640 TTTCTTTTATTTTTGAAACAGGG - Intergenic
1184505243 22:44896839-44896861 TTTCTGTCACTTATGAAACAGGG + Intronic
1185023148 22:48392324-48392346 TTTCTTTCACTTAACAAATATGG + Intergenic
949352584 3:3139732-3139754 TTTCTTTCTCTTTTGAGACAGGG + Intronic
949572547 3:5307443-5307465 TTTCTGTCTTTTTTGAGACAGGG - Intergenic
949781697 3:7696510-7696532 TTTCTGTTACTAAGGAAACATGG - Intronic
950230711 3:11273307-11273329 TTTCTGTCACTGAAGAAATCTGG - Intronic
950678535 3:14569190-14569212 TGGCTGTCACTTCTGAATCAGGG - Intergenic
951416327 3:22426801-22426823 GTTCTATCACTTATGGAGCAAGG - Intergenic
952672300 3:35984794-35984816 GTACTGTCAATTATGAAGCAAGG - Intergenic
955660874 3:61297792-61297814 TTTCTGTCACTTTTTAAAGGTGG - Intergenic
956804959 3:72800409-72800431 GTTTTCTCATTTATGAAACAAGG - Intronic
957409193 3:79815701-79815723 TCTCCTTCACTTATGAAACCTGG + Intergenic
957695530 3:83634052-83634074 TTTCTGTTATTCATGAGACAGGG - Intergenic
957901556 3:86500348-86500370 ATTCTTTCACTTAGGAAACCAGG + Intergenic
957928852 3:86851075-86851097 TTTCTGCAGCTTATGAATCAAGG + Intergenic
958262396 3:91396925-91396947 TTTCTTTCACCTTTGAAATATGG - Intergenic
958695135 3:97517900-97517922 ATTCTGTTACTTGTGCAACAGGG - Intronic
959243679 3:103834161-103834183 TTTCTGATACTTATGAATAATGG + Intergenic
959677988 3:109058261-109058283 TTTCTGTCTCATTTGAAAAATGG + Intronic
960321167 3:116238330-116238352 TGTCTGACATTTTTGAAACATGG + Intronic
960706320 3:120485396-120485418 TGTCTGTCTCTTATGGAAGAAGG + Intergenic
960738548 3:120807145-120807167 TTTCTGTAACATATTAAAGAAGG - Intergenic
961035902 3:123641529-123641551 TTTCTTTCACTTTTGAGACAGGG - Intronic
961035993 3:123641859-123641881 TTTCTTTCGCTTTTGAGACAGGG + Intronic
961052475 3:123758615-123758637 TTTCTGTCACTGAAAACACAAGG + Intronic
961436544 3:126922802-126922824 GTTCTGTCACCTTTGTAACAAGG + Intronic
962427954 3:135289846-135289868 TTTTTTTCACATATGATACAAGG + Intergenic
962626964 3:137235465-137235487 TTTCTGTTCCTTGTGAAAAAGGG + Intergenic
963426056 3:145125560-145125582 TTGTTATAACTTATGAAACAAGG - Intergenic
965340600 3:167486147-167486169 TATCTTTCACTTATGAATCTTGG - Intronic
965660263 3:171033983-171034005 TTTCTTTCACTTTTGTGACAGGG + Intergenic
966016375 3:175143401-175143423 TTTGTGTCACTTCTGAAAAGAGG + Intronic
967192535 3:186997275-186997297 GTTTTGTCACTTACAAAACAGGG - Intronic
968203214 3:196774338-196774360 TTTTTTTCACATATAAAACAAGG + Intronic
970535565 4:17026787-17026809 TTTCTTGCCCTTATCAAACATGG - Intergenic
971095824 4:23401159-23401181 TTTCTGTCACTAATTCAATAGGG + Intergenic
971320508 4:25601755-25601777 CTTCTGTCACTTACGTTACATGG + Intergenic
972672720 4:41229252-41229274 TTTCTTTCTTTTTTGAAACAGGG + Intergenic
972821545 4:42707691-42707713 TTTCTGGCACCAGTGAAACAGGG - Intergenic
972847690 4:43009549-43009571 TTTCTGTCAATTGTGAGACTGGG + Intronic
973629305 4:52803884-52803906 TCTCCTTCACTTATGAAACTTGG - Intergenic
973933854 4:55821698-55821720 ATTCTGTCATGTAAGAAACAAGG + Intergenic
974337276 4:60565760-60565782 TTTCTGTAAGATCTGAAACATGG - Intergenic
974731057 4:65866980-65867002 TTTATTTTACTTAAGAAACATGG + Intergenic
975197914 4:71547262-71547284 TATCTGTCTCCTATGAAAGAAGG + Intronic
976619001 4:87108858-87108880 TTTCTGTCCCATGTAAAACAGGG + Intronic
977076767 4:92462972-92462994 TTTCTGTCTCTTATGTAAACAGG - Intronic
977309782 4:95371602-95371624 TTTTTTTCACTTGAGAAACAGGG + Intronic
978094582 4:104760608-104760630 TTACTGTCATTTTTGAAACTTGG + Intergenic
978708175 4:111742056-111742078 TTTCTCTGTCTTATGAAACCTGG + Intergenic
979006612 4:115306335-115306357 TTTCTTTCACTTGTAAAATAAGG - Intergenic
981227863 4:142318099-142318121 TTTGTGTCAGTTATTTAACATGG + Intronic
981417972 4:144515639-144515661 TTTCTAGCACTTATAAACCATGG - Intergenic
981885537 4:149668325-149668347 TCTCCTTCACTTATGAAGCACGG - Intergenic
982534441 4:156591906-156591928 TATCTGAAACTTATGAAAGATGG - Intergenic
984907332 4:184640969-184640991 TTTTTGTCACTCTTGAAACAGGG - Intronic
986453174 5:7887070-7887092 TTTCTGTCACCAATTAAAGAAGG - Intronic
987071185 5:14338401-14338423 TTTCTGGCACCTTTGAGACAAGG + Intronic
987463947 5:18250246-18250268 TTTCTGTACCTTTAGAAACATGG + Intergenic
987694419 5:21309809-21309831 TAGCTTCCACTTATGAAACAAGG - Intergenic
988906464 5:35795854-35795876 TTTCTTCCACTTATGTAACTTGG + Intronic
989112411 5:37919390-37919412 TTCCTGTCACTTATGACAGGTGG + Intergenic
990507734 5:56461163-56461185 TCTCTCTCAGTTAAGAAACAGGG - Intronic
990748396 5:58984390-58984412 TTTCAGGCACTTAGGACACATGG - Intronic
990967143 5:61461358-61461380 TTTCTCTCACTTATTAAATAAGG - Intronic
991470939 5:66968409-66968431 TTTCAGTCACAGCTGAAACAGGG - Intronic
991745822 5:69739662-69739684 TAGCTTCCACTTATGAAACAAGG + Intergenic
991751885 5:69815571-69815593 TAGCTTCCACTTATGAAACAAGG - Intergenic
991797421 5:70319620-70319642 TAGCTTCCACTTATGAAACAAGG + Intergenic
991825200 5:70614976-70614998 TAGCTTCCACTTATGAAACAAGG + Intergenic
991831174 5:70690472-70690494 TAGCTTCCACTTATGAAACAAGG - Intergenic
991889764 5:71318947-71318969 TAGCTTCCACTTATGAAACAAGG + Intergenic
993189087 5:84658159-84658181 TTTCTGTCTCTAATAAAACAGGG - Intergenic
993428473 5:87800067-87800089 ATTAAGTCACTTTTGAAACATGG - Intergenic
993505880 5:88708079-88708101 TGTCTATCACTGATGGAACAGGG + Intergenic
994236336 5:97368064-97368086 TTTCTTTCACTTATTTTACAAGG + Intergenic
994872762 5:105374694-105374716 TTTCTGGCATTTAGGACACAAGG - Intergenic
994970185 5:106727694-106727716 TGCGTGTCATTTATGAAACAGGG - Intergenic
995408695 5:111830960-111830982 CTTCCATCACTTATGGAACAGGG - Intronic
996505352 5:124262300-124262322 TTTCTGGCCCTTATGATTCAGGG - Intergenic
996794347 5:127328091-127328113 TTTCTCTAAATTAGGAAACATGG - Intronic
997640956 5:135448607-135448629 TCTCTGTCACTTCTGGATCAAGG - Exonic
999013522 5:148070338-148070360 TTTCAGGCATTTATGAAAAATGG + Exonic
999344720 5:150806377-150806399 TTTCTTTCACTTAATAAATATGG + Intergenic
999759404 5:154688817-154688839 TTTATTTCACTTTTGAACCAGGG - Intergenic
999822863 5:155246374-155246396 TCTCTGTCATTTATGAAGCTTGG + Intergenic
1000910382 5:167014607-167014629 GTTCTTTCTCTTATGCAACAGGG - Intergenic
1001868962 5:175133649-175133671 CTTCTGTCATTTATGTAAGATGG - Intergenic
1004399832 6:15278223-15278245 TTTCTTTAACTTTTGAGACAGGG - Intronic
1004417845 6:15441046-15441068 TTTCTGATACTTATCAAAAAAGG + Intronic
1005178551 6:23076341-23076363 ATTCTGTCATTTGTGCAACATGG + Intergenic
1005383774 6:25264932-25264954 GTTCTGTCAGTTCTGAAACTAGG + Intergenic
1005671165 6:28107705-28107727 TTTCTGACAGTTCTGATACAAGG + Intergenic
1007454679 6:41967413-41967435 CCTCTGTCACTTATGACACTGGG + Intronic
1007667215 6:43521913-43521935 TTTCTGTTGTTTTTGAAACAGGG - Intronic
1007724028 6:43903598-43903620 TTTCTTTCCCTTTTGAGACAGGG - Intergenic
1008040092 6:46788495-46788517 TATCTTTCTCTTATGACACAAGG - Intergenic
1008993021 6:57625952-57625974 TTTCTTTCACCTTTGAAATATGG + Intronic
1009181635 6:60525057-60525079 TTTCTTTCACCTTTGAAATATGG + Intergenic
1009598129 6:65762901-65762923 TTTCTCTCCTTTATGCAACAGGG + Intergenic
1009718071 6:67426697-67426719 TCTCTTTCACTTATGAAGCTTGG + Intergenic
1010071130 6:71747542-71747564 TTTCTGTCACTACTGAAAAGAGG - Intergenic
1010850804 6:80774143-80774165 TTTTTTTCCCTTTTGAAACAGGG + Intergenic
1011908449 6:92403668-92403690 TTTCTGTAGCCTATGAACCAAGG - Intergenic
1012295040 6:97511886-97511908 TTTTTGTTTCTGATGAAACACGG + Intergenic
1012833513 6:104236130-104236152 TTTCTGTCATTTCTGATAAATGG - Intergenic
1012856931 6:104513238-104513260 CTTATGTCACTTATGTCACAGGG + Intergenic
1013413775 6:109906059-109906081 TTTCTCTCACACATGAAAAACGG + Intergenic
1013468925 6:110443570-110443592 TTTCTCTCACATATTACACATGG - Intronic
1014238173 6:118984688-118984710 ATTCTTTCACTTTTGTAACAAGG - Intronic
1015043078 6:128744934-128744956 TTTATGTCACTTGTTAAAGATGG + Intergenic
1015258693 6:131209927-131209949 TAGCTGTCACTTACTAAACAAGG - Intronic
1017425830 6:154320531-154320553 TTCCTGTCACTGATTAAAAAGGG + Intronic
1018434189 6:163746378-163746400 GTTTTGTCATTTATAAAACATGG + Intergenic
1018693013 6:166364167-166364189 ATTCTGTCACTTTTGAGACAGGG - Intergenic
1018949708 6:168371128-168371150 TTTCTGTCATCTTTGAAAGAAGG + Intergenic
1022246502 7:28565166-28565188 ATTCTCTCATTTATGATACATGG - Intronic
1026383544 7:69822939-69822961 TTTTTGTCACTTGCAAAACATGG - Intronic
1027801550 7:82757882-82757904 TTTCTGTATCATTTGAAACAAGG - Exonic
1027969579 7:85061633-85061655 TTTCTGTCCTTTATGAGAAATGG - Intronic
1028047334 7:86139144-86139166 TTCCTATCATTTATGTAACATGG + Intergenic
1028114272 7:86980155-86980177 TTTCTCTCACTTACCAAAAAAGG + Intronic
1028115448 7:86991993-86992015 TTTCTGTCACTAAGGAAAATGGG + Intronic
1028123949 7:87089944-87089966 TTTCTCTCACATATGATTCATGG - Intergenic
1028170815 7:87593329-87593351 TTTCTGTAAATGTTGAAACAAGG + Intronic
1031861789 7:126988416-126988438 ATTCTATCACTTATGAAAATAGG - Intronic
1033888330 7:145976433-145976455 TTTCTTTTTCTTTTGAAACAGGG - Intergenic
1034065991 7:148137058-148137080 TTTCTGTCATTTTTCATACATGG + Intronic
1034209137 7:149347506-149347528 TTTCTGTAAGATAAGAAACAAGG + Intergenic
1034506808 7:151498764-151498786 TGTCTGTAACTGATGAAACTAGG - Intronic
1034787692 7:153940549-153940571 TTTCTGTGTGTCATGAAACATGG - Intronic
1034885022 7:154792712-154792734 TTTCTGTGATGTCTGAAACATGG - Intronic
1036415503 8:8544162-8544184 TTTCTGACACTTAAGAAACCTGG + Intergenic
1037268266 8:17093318-17093340 TTTCTGTCAGCAATGAAACTAGG - Intronic
1038042613 8:23737533-23737555 TTTTTTTCTTTTATGAAACAGGG - Intergenic
1039144926 8:34437150-34437172 TTTCTTTCACTTATGAAGCTTGG + Intergenic
1039201626 8:35100655-35100677 TTTCTGTCACTTCTTAAAATAGG - Intergenic
1039389905 8:37170960-37170982 TTTCTGTCCCAGATGATACAAGG - Intergenic
1040717784 8:50279181-50279203 TTGATTTCACTTATGAAGCATGG + Intronic
1042054290 8:64747589-64747611 CTTCTGCCACTCCTGAAACAAGG - Intronic
1042187346 8:66150296-66150318 TTTCTGTCACTGTTGAAAATTGG - Intronic
1042644159 8:70967678-70967700 TCTCTTTCACTTATGAAACTTGG + Intergenic
1043000164 8:74748967-74748989 TTTCTGTTAATTGTGAAACCTGG + Intronic
1043807550 8:84691268-84691290 TTTCTGTCATATATAAAATACGG + Intronic
1043934725 8:86130261-86130283 TTTCTATCCCTTAAGAACCAAGG + Intronic
1044883210 8:96745577-96745599 TTTTTCTCACCTATGAAATAAGG - Intronic
1045906366 8:107350169-107350191 TTGCTGTCATTTAGGAAACATGG - Intronic
1046130379 8:109960433-109960455 TTTGTTTCACTTATAAAGCATGG - Intergenic
1046144004 8:110133513-110133535 TTTCTTTCATTTATGAATTAAGG - Intergenic
1046589814 8:116192692-116192714 TTTCTGACACTTAAGTAACTAGG + Intergenic
1046798077 8:118394012-118394034 TTTTTGTCACTTATCAAATAGGG - Intronic
1048145706 8:131840831-131840853 TTTGTGTCATTTCTGAAACCTGG + Intergenic
1048260600 8:132941916-132941938 TTACTGTCACTTGTGAAGCCAGG + Intronic
1048267457 8:133000043-133000065 TTGCTGTCACTTGTAAAACAGGG - Intronic
1048844711 8:138595438-138595460 TTTCTGTCACTGATGAATCCAGG + Intronic
1049350411 8:142161375-142161397 GCTCTGTCACTACTGAAACATGG - Intergenic
1049902054 9:178448-178470 TACCTGTCACCTGTGAAACAGGG - Intronic
1050557985 9:6806833-6806855 AGTGTGTCACTTCTGAAACAGGG - Intronic
1052443307 9:28526450-28526472 TTTCTGGCACTTCTGAAACTAGG + Intronic
1052729027 9:32263861-32263883 TTCCCTTCACTTATGAAAAAGGG - Intergenic
1053167506 9:35854845-35854867 TTTCTGGCACTCAGGAAAAATGG - Exonic
1053216629 9:36276509-36276531 TTTCCTTCCCTTTTGAAACATGG - Intronic
1055402811 9:75942449-75942471 GTTCTGTCAGTTATGTACCACGG + Intronic
1055862746 9:80772620-80772642 GTTCTTTCACTCTTGAAACAGGG + Intergenic
1055962037 9:81829916-81829938 TTTCTCCAACTTATGAAATAAGG + Intergenic
1056010640 9:82326403-82326425 TCTCCTTCACTTATGAAACTTGG + Intergenic
1056070512 9:82982019-82982041 TTTTTCTCACTTCTGAAATAAGG - Exonic
1056789109 9:89614141-89614163 TGCCTGTCAGTGATGAAACATGG + Intergenic
1056845322 9:90032484-90032506 TTTCTATCTCTTATGAAAACAGG - Intergenic
1057465468 9:95310354-95310376 TTTTTTTCTCTTTTGAAACAGGG - Intronic
1057495211 9:95555090-95555112 TTTCTGTCCTTTATAAATCATGG + Intergenic
1057836515 9:98449755-98449777 CTTCTGTCAATTATGCAACCAGG - Intronic
1059461585 9:114434223-114434245 CTGCTGTCATCTATGAAACACGG - Intronic
1059755405 9:117288971-117288993 TTTTTGTCATTTATAGAACAAGG - Intronic
1062140772 9:134957637-134957659 CTTCTTTGACTTATCAAACATGG - Intergenic
1185650786 X:1646441-1646463 TTTTTGTCACTTATGCCACTGGG + Intergenic
1186042204 X:5492872-5492894 TTTCTGACAATTATGAATTAGGG - Intergenic
1187015498 X:15323522-15323544 TATCTCTCCCATATGAAACATGG - Intronic
1187193356 X:17057743-17057765 TTTCTGTTTCTTCTGAATCAGGG + Intronic
1187569505 X:20486750-20486772 TCTCTGTCACTTATAAAACTGGG - Intergenic
1188002082 X:24992385-24992407 ATTCTGTCAATTATGAAATCAGG - Intronic
1190621463 X:52291097-52291119 TTTCTGTCACTGATGAGTTAGGG + Intergenic
1191140933 X:57116045-57116067 CATCTGCCACTTATGAAACAGGG + Intergenic
1191224342 X:58026372-58026394 TTTGTCTCACTTAAGAAAAAAGG + Intergenic
1193558545 X:82987304-82987326 TTTTTCTCGTTTATGAAACACGG + Intergenic
1193934777 X:87604044-87604066 ATCCTGCCGCTTATGAAACAAGG - Intronic
1194051857 X:89079146-89079168 TTTCTGCCATCTAGGAAACAAGG - Intergenic
1194135163 X:90132043-90132065 TTTATGTAATTTATGATACATGG - Intergenic
1194858157 X:98959969-98959991 TTTCTGTTTCTTCTGAAAAATGG - Intergenic
1195459085 X:105103440-105103462 TCTCTGTGACTAATGAAAGATGG - Intronic
1196426940 X:115579737-115579759 TTTCTTTCATTTTTGAGACAGGG + Intronic
1197186898 X:123597650-123597672 TTTCTGTTTTTTTTGAAACAGGG - Intergenic
1198305541 X:135379211-135379233 TTGCTGTCTCTTCTGAAACTGGG + Intergenic
1199483555 X:148324482-148324504 TTTCTTTCTTTTTTGAAACAGGG - Intergenic
1199604728 X:149568164-149568186 TTTCTGTCACCTGAGAGACATGG + Intergenic
1200480945 Y:3702135-3702157 TTTATGTAATTTATGATACATGG - Intergenic
1202167541 Y:22006565-22006587 TTTCTGTCATGTATGAATAAAGG + Intergenic
1202223818 Y:22579804-22579826 TTTCTGTCATGTATGAATAAAGG - Intergenic
1202264073 Y:22999818-22999840 TAACTGTCACACATGAAACAGGG + Intronic
1202319297 Y:23615857-23615879 TTTCTGTCATGTATGAATAAAGG + Intergenic
1202417064 Y:24633560-24633582 TAACTGTCACACATGAAACAGGG + Intronic
1202453723 Y:25036526-25036548 TAACTGTCACACATGAAACAGGG - Intronic
1202551472 Y:26054200-26054222 TTTCTGTCATGTATGAATAAAGG - Intergenic