ID: 1184506673

View in Genome Browser
Species Human (GRCh38)
Location 22:44907917-44907939
Sequence CTGGAATCTCTGGGAAGTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184506666_1184506673 -4 Left 1184506666 22:44907898-44907920 CCCACGGTCCACTGACCTGCTGG 0: 1
1: 0
2: 0
3: 7
4: 88
Right 1184506673 22:44907917-44907939 CTGGAATCTCTGGGAAGTACAGG No data
1184506665_1184506673 9 Left 1184506665 22:44907885-44907907 CCAGGAACACAATCCCACGGTCC No data
Right 1184506673 22:44907917-44907939 CTGGAATCTCTGGGAAGTACAGG No data
1184506668_1184506673 -5 Left 1184506668 22:44907899-44907921 CCACGGTCCACTGACCTGCTGGA No data
Right 1184506673 22:44907917-44907939 CTGGAATCTCTGGGAAGTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184506673 Original CRISPR CTGGAATCTCTGGGAAGTAC AGG Intronic
No off target data available for this crispr