ID: 1184507960

View in Genome Browser
Species Human (GRCh38)
Location 22:44915654-44915676
Sequence CCCAGCCATAAGCAAGAGAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 218
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 206}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184507953_1184507960 11 Left 1184507953 22:44915620-44915642 CCGTCAACATCCAGGCTGGGGAA No data
Right 1184507960 22:44915654-44915676 CCCAGCCATAAGCAAGAGAGGGG 0: 1
1: 0
2: 0
3: 11
4: 206
1184507955_1184507960 1 Left 1184507955 22:44915630-44915652 CCAGGCTGGGGAAGCAGAAGGTA 0: 1
1: 0
2: 2
3: 33
4: 349
Right 1184507960 22:44915654-44915676 CCCAGCCATAAGCAAGAGAGGGG 0: 1
1: 0
2: 0
3: 11
4: 206

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184507960 Original CRISPR CCCAGCCATAAGCAAGAGAG GGG Intronic
900561086 1:3307009-3307031 CTCAGCCATAAGAACGAGTGAGG - Intronic
900695486 1:4006880-4006902 CCCAGCCGACAGCAAGTGAGTGG - Intergenic
902849923 1:19147026-19147048 GTCAGCCATAAGCAAGAGCTGGG + Intronic
903355954 1:22747525-22747547 CACAGCCACAGGCAAGGGAGGGG + Intronic
903461759 1:23525336-23525358 CCCAGCCCTAACCAGGAGAGAGG - Intronic
903883887 1:26530189-26530211 CCCCGCCATAGCCAGGAGAGGGG + Intronic
905959598 1:42032689-42032711 CCTGTCCGTAAGCAAGAGAGAGG - Intronic
907222293 1:52915721-52915743 CCCACCCACATGCAAGGGAGGGG - Intronic
907359898 1:53906081-53906103 CCCAGCCATCTACAAGAGAAAGG - Exonic
907602123 1:55782472-55782494 CCCTCTCACAAGCAAGAGAGAGG - Intergenic
909839189 1:80296646-80296668 CCCAGCCCTAACAAAGACAGAGG - Intergenic
910089398 1:83444680-83444702 CCCTGCCAGATGCACGAGAGTGG + Intergenic
910790263 1:91043395-91043417 CCCTCCCATAACCAAGAAAGAGG + Intergenic
911433374 1:97822788-97822810 AGCAGCAATAAGCAAGAGATTGG + Intronic
911538582 1:99130445-99130467 CCCACCCAGAAGCAACACAGAGG - Intergenic
912382600 1:109255408-109255430 TGCAGCCATAGGGAAGAGAGTGG - Intronic
913193656 1:116434259-116434281 CCAAGCCAAAAGCAGGAGACAGG + Intergenic
915918492 1:159956473-159956495 CCCAGCCAGGGGTAAGAGAGAGG + Intergenic
916617945 1:166463048-166463070 CCCAACCAAAAGACAGAGAGTGG - Intergenic
916683757 1:167126616-167126638 CCACGCCAAGAGCAAGAGAGAGG + Exonic
920282381 1:204853882-204853904 CCCATCCATAGGGGAGAGAGGGG + Intronic
920539656 1:206768788-206768810 CCCATCCATGAGCATGAGGGAGG - Intronic
922560046 1:226563282-226563304 ACCAGCCATAAGTAAGTCAGGGG + Intronic
922939343 1:229447980-229448002 ACCCGCCAAAACCAAGAGAGTGG + Intronic
923728599 1:236529159-236529181 CCCAGCTATGAGGAAGAGTGAGG + Intronic
1068101243 10:52556299-52556321 CCCTGCCAAAAGAAAGAAAGAGG - Intergenic
1069904199 10:71722888-71722910 CCCAGGGATGTGCAAGAGAGGGG + Intronic
1071508650 10:86247786-86247808 CCCAGCCATGAACTAGAGAGGGG + Intronic
1074937221 10:118193512-118193534 CTCAGAGATAAGCAAGAGTGTGG - Intergenic
1075090229 10:119440172-119440194 CCCACCCAGAAGGAAGAGGGTGG + Intronic
1077178333 11:1200640-1200662 CCCAGCCAGGAGGCAGAGAGTGG + Intronic
1077293596 11:1813286-1813308 CCCAGCCATAACAAAGCAAGGGG + Intergenic
1077439548 11:2561683-2561705 CCCACACATTAGCAAGAGAAAGG - Intronic
1083864545 11:65446405-65446427 AACAGCCAGAAGCAGGAGAGAGG + Intergenic
1084095413 11:66907996-66908018 CCCACCCCTAAGCCAGAGATTGG - Intronic
1088826955 11:113504064-113504086 CCCAGCCATTTGGAAGAGGGAGG + Intergenic
1089929327 11:122293944-122293966 CCTAGCCAGAAATAAGAGAGTGG + Intergenic
1090364002 11:126191323-126191345 GGCAGCCATCAGCAACAGAGAGG + Intergenic
1091127235 11:133111367-133111389 CCCAGCCAGAAGCAAAAGAAAGG - Intronic
1092029232 12:5270050-5270072 CAGTGCCATAAGCAAGAGGGCGG - Intergenic
1098488760 12:71050868-71050890 CCCAGCCGTAAGGAAGGGAAAGG + Intronic
1099467860 12:83009241-83009263 CCCTGCCATCACCAGGAGAGTGG + Intronic
1100727268 12:97421788-97421810 TCCAGTAATAAGCAAAAGAGAGG + Intergenic
1101477727 12:105066412-105066434 GCCAGACATACGCAGGAGAGGGG - Intronic
1104273211 12:127301248-127301270 TCCAGACAGAAGCAGGAGAGGGG - Intergenic
1106468437 13:30033545-30033567 CCCAGCCCTAAGGGACAGAGGGG - Intergenic
1107670251 13:42738348-42738370 ACTAGCCTAAAGCAAGAGAGAGG - Intergenic
1108720393 13:53125657-53125679 CCCAGCCACAAGCTTGAGAGGGG - Intergenic
1110142904 13:72152915-72152937 CCCAGACATCAGCAATAGGGAGG + Intergenic
1115364059 14:32536383-32536405 CCCAGAGATAAGAAAGAGAATGG + Intronic
1120853221 14:89189380-89189402 CCTAGCCATAAGAAGGAGATAGG + Intronic
1121193987 14:92053800-92053822 CCCAGCAATCAGAAAGAGAAAGG - Exonic
1121322178 14:92998370-92998392 CCCAGGCATCAGCAGGAGGGTGG - Intronic
1121692777 14:95889714-95889736 ACCAGCCAGAAGCCAGACAGGGG - Intergenic
1121798613 14:96755394-96755416 CCCAGCCCTGAGCCAGAGAAGGG + Intergenic
1124651082 15:31474388-31474410 TGCAACCATAAGCAAGAGAATGG - Intergenic
1125001427 15:34774493-34774515 CCCAACTATATGCAAGAGGGAGG + Intergenic
1125391168 15:39194733-39194755 GACAGCCATATGGAAGAGAGTGG + Intergenic
1125417625 15:39469924-39469946 CCCAGCCATATTCAACAGTGTGG - Intergenic
1126166700 15:45659598-45659620 CACAGCTACAAGCCAGAGAGTGG - Intronic
1126497567 15:49309063-49309085 CCCAGCCATAAACAAGTGCCCGG - Intronic
1127354761 15:58187871-58187893 TCCAGCAATAAGAAAGAGATTGG - Intronic
1127697203 15:61462046-61462068 ACCAGGCATCAGCAAGAAAGTGG - Intergenic
1129269105 15:74410174-74410196 CCCAGCCATGAGAGAGGGAGGGG + Exonic
1130716572 15:86340825-86340847 CCCAACCAGAAGCAAGGTAGAGG - Intronic
1131672433 15:94633698-94633720 CACAGCTATATGCAACAGAGTGG + Intergenic
1131921608 15:97334214-97334236 CCCAGACAGAAGCAGGATAGGGG + Intergenic
1133692353 16:8229075-8229097 CACAGCCAGAAACAAAAGAGTGG + Intergenic
1135477106 16:22786336-22786358 CCCAGCCGCCAGCAAGAGTGAGG - Intergenic
1139095516 16:63700293-63700315 AACAGGCATGAGCAAGAGAGAGG + Intergenic
1139605531 16:68015580-68015602 CCCAGCCATAAGTAATATCGAGG - Intronic
1140793153 16:78411462-78411484 CCCAGACTTAATCAAGTGAGGGG + Intronic
1141941532 16:87279137-87279159 CCCGTCCATAAGCAAGATTGGGG + Intronic
1141950452 16:87336013-87336035 CCCAGCCCCCAGCAGGAGAGAGG + Intronic
1143278791 17:5734516-5734538 CTCTGCCATAATCAAGAGAGAGG + Intergenic
1143360601 17:6366173-6366195 CCAAGCCATGAAGAAGAGAGAGG + Intergenic
1144149513 17:12429810-12429832 GGGAGCCATAAGCAAGAGACAGG + Intergenic
1144300680 17:13920881-13920903 ACTGGCCATTAGCAAGAGAGGGG + Intergenic
1144491616 17:15717593-15717615 CTCTGACATAAACAAGAGAGGGG - Exonic
1144908862 17:18661612-18661634 CTCTGACATAAACAAGAGAGGGG + Exonic
1145235165 17:21202817-21202839 CACAGCCATAAGCAAGCACGTGG + Intronic
1148017192 17:44530191-44530213 CCCACCCACAATCAAGGGAGGGG - Intergenic
1149776958 17:59365767-59365789 ACCAGCAATAAGCCAGGGAGAGG - Intronic
1150122820 17:62617798-62617820 CCTAGCCATATGCAAGGTAGGGG + Intergenic
1151053311 17:71004153-71004175 CCCTGCCAAAAAAAAGAGAGAGG + Intergenic
1151522888 17:74643099-74643121 CCCAACCAGAAGCCAGAGTGAGG + Intergenic
1151814011 17:76462195-76462217 CCCAGCCAGAGCCAGGAGAGTGG + Intronic
1152641206 17:81450021-81450043 CTCAGCCAGAAGCAGGAGTGCGG - Intronic
1155645485 18:28072191-28072213 CACACCCATACCCAAGAGAGAGG - Intronic
1158004304 18:52654518-52654540 GCCATCCATAAGCCAAAGAGAGG - Intronic
1158613889 18:58968422-58968444 CCAAGCCAAAAGGAAGAGAGGGG - Intronic
1161145953 19:2678188-2678210 CACAGCAAGAAACAAGAGAGTGG + Intronic
1163636271 19:18438417-18438439 CCCAGCCACAAGCCAGGGGGTGG + Intergenic
1163662758 19:18588681-18588703 GCCAGCCAGAAGGAAGAAAGGGG - Intronic
1166215027 19:41329226-41329248 CCCAACCATGAGCAAGACGGCGG + Intronic
1167078100 19:47261135-47261157 CGCAGCACTAAGCAGGAGAGGGG - Intronic
1168244055 19:55101579-55101601 ACCAGCCAGCAGGAAGAGAGAGG - Intronic
925823280 2:7822122-7822144 CCCAGCCATAACCAGGAAGGAGG + Intergenic
925870073 2:8262739-8262761 CCCAGACATAAGCAGCAGAGTGG - Intergenic
927494991 2:23546152-23546174 CCCAGCCTCAGGCAAGGGAGTGG - Intronic
927503602 2:23598723-23598745 CCCAGTCATAAGCAAAACACAGG - Intronic
928016452 2:27662682-27662704 CACAGCCATAAGAAATAGACGGG - Intronic
928415343 2:31087107-31087129 ACCAGCCATAAGAAAGGGATGGG + Intronic
929392838 2:41491284-41491306 CCCAGCCACAAGCAATAGTCAGG + Intergenic
929455112 2:42059828-42059850 CCCAGTAATAACCAGGAGAGAGG + Intergenic
929719100 2:44348577-44348599 CAGAGCCAAAAGCAACAGAGCGG + Intronic
929969317 2:46560073-46560095 CGGAGCCACAAGCAAGAGGGTGG - Intronic
932144035 2:69303459-69303481 CCCAGCCAACAGGAAGGGAGAGG - Intergenic
933278962 2:80311391-80311413 CCCAGCCAGATGAAGGAGAGGGG - Intronic
933848975 2:86350194-86350216 CCCAGCCATAGGCCAGGGAAGGG + Intergenic
935193514 2:100796881-100796903 ACCAGCCATGAGGAAGGGAGAGG - Intergenic
935836016 2:107054429-107054451 TCCAGCCTTTAGCAGGAGAGAGG + Intergenic
937127200 2:119482297-119482319 CCCAGCCCCTAGCAGGAGAGGGG + Intronic
939872740 2:147543078-147543100 CCAAGCCAGAAGCAAGAGTGAGG + Intergenic
939883896 2:147660186-147660208 CACAGCCACAAGTAAGAAAGAGG + Intergenic
940204137 2:151183871-151183893 CACAGCCCTAAGCAAGATATAGG - Intergenic
942218370 2:173745140-173745162 ACCACCCACAAGCTAGAGAGAGG + Intergenic
943952689 2:194150602-194150624 CCCACCCAGGACCAAGAGAGTGG - Intergenic
944155294 2:196601408-196601430 CCCAGCCACTAGCTTGAGAGTGG - Intergenic
945031175 2:205665057-205665079 CACAGCCATAAAAAAGAGTGAGG - Intergenic
946550473 2:220795750-220795772 CCAAGTCATGAGCAAGAGATGGG + Intergenic
1169684598 20:8256773-8256795 CTCAGCCAGAAGCAGGAAAGAGG - Intronic
1171347113 20:24473968-24473990 ACCTGCCATCAGCAAGAGTGAGG + Intronic
1172047900 20:32093785-32093807 CCCACCCAAAAGCAGCAGAGAGG - Intronic
1172539110 20:35697716-35697738 CCCAGCCATAAGCATGTGTCCGG + Exonic
1173821274 20:46021998-46022020 CCCAGCCCTAGGCCTGAGAGGGG + Intronic
1176516039 21:7784124-7784146 CCCAGCCTTAGGAAGGAGAGGGG - Intergenic
1178650067 21:34414136-34414158 CCCAGCCTTAGGAAGGAGAGGGG - Intergenic
1180614497 22:17119073-17119095 CCCATCCATTAGGAGGAGAGGGG - Exonic
1181985575 22:26798029-26798051 CCCAGCTGTAAGCAGCAGAGTGG - Intergenic
1183310727 22:37108239-37108261 CCCAGGCAGAAGGAAGAGTGTGG - Intronic
1184507960 22:44915654-44915676 CCCAGCCATAAGCAAGAGAGGGG + Intronic
1185198319 22:49486464-49486486 TCCAGCAACAAGCAAGGGAGGGG + Intronic
949439771 3:4067755-4067777 CCCAGCCCTACTCAAGAGAGTGG + Intronic
949935526 3:9112819-9112841 GACAGACATAAGCTAGAGAGGGG - Intronic
950451801 3:13069568-13069590 CCCAAACAGAAGGAAGAGAGGGG + Intronic
954089982 3:48276612-48276634 CCCCGCCATAAGCAAGGCACGGG - Intronic
956051011 3:65248644-65248666 CCCAACCCCAAGCAAGAGAGTGG + Intergenic
959761394 3:109969806-109969828 CCAAACAATAAGCAAGAGATGGG - Intergenic
968067520 3:195766905-195766927 CCCAGCACTGAGCAGGAGAGGGG + Intronic
969943852 4:10762505-10762527 CCCAGCATAAAGGAAGAGAGAGG + Intergenic
970021676 4:11576002-11576024 GCAAACCATAAGCAAGAAAGAGG + Intergenic
970460741 4:16272436-16272458 CCCAGCCAGAGCCCAGAGAGGGG + Intergenic
970551658 4:17187804-17187826 CTCAGACATAAGAAAGAGTGTGG - Intergenic
972188706 4:36564551-36564573 CCCATCCATAAGCATGAGATGGG + Intergenic
974178083 4:58349818-58349840 CCCATCCTCAAGCATGAGAGTGG + Intergenic
974571340 4:63653208-63653230 ATTAGCCATAAACAAGAGAGTGG + Intergenic
975916571 4:79332488-79332510 GCTGGCCATATGCAAGAGAGTGG + Intergenic
980315695 4:131196864-131196886 GCCAGACACAAGCAGGAGAGAGG - Intergenic
981342203 4:143634556-143634578 CCAAGCCAGAAGCAAGATGGAGG + Intronic
981939468 4:150266751-150266773 TCCAGCCAAAAGGAAGAGATTGG + Intronic
982840376 4:160176617-160176639 CCCAATCAAAAGCCAGAGAGGGG + Intergenic
983582617 4:169324458-169324480 CCCAACTACAAGCAAGAAAGAGG + Intergenic
985469675 5:32294-32316 CCCAGGCACAGGCAGGAGAGGGG + Intergenic
985842339 5:2317695-2317717 CCCATCCAGAAGCAAGGGGGAGG + Intergenic
986473713 5:8102094-8102116 CCCAGCCATAAAAAAGAATGAGG - Intergenic
990254795 5:53956136-53956158 AGGAGCCACAAGCAAGAGAGAGG - Intronic
991158708 5:63469498-63469520 TCCAGCCATAAGGAGGAGACAGG + Intergenic
997060545 5:130496450-130496472 CTCAGTCATAAGCAGGAAAGAGG - Intergenic
997468882 5:134105604-134105626 CCCAGTCATGAGCAAGACGGAGG + Intergenic
998148871 5:139745938-139745960 CTCATCCAATAGCAAGAGAGGGG - Intergenic
998172028 5:139878097-139878119 CCAAGCCCTGTGCAAGAGAGAGG + Intronic
998697729 5:144659341-144659363 CCAAGCCATAACCAAGAGTCAGG + Intergenic
999967622 5:156826409-156826431 CCCATCCACAGGCTAGAGAGAGG + Intergenic
1000626454 5:163544974-163544996 CCCAGACATAATTAAGAAAGGGG - Intergenic
1000765227 5:165280951-165280973 CTCTGCTATAAGCAAGAGACTGG - Intergenic
1000809023 5:165837716-165837738 CCCAGCCACACTCAAGGGAGAGG + Intergenic
1000997110 5:167970479-167970501 TCCAGCCATTTCCAAGAGAGAGG - Intronic
1001550402 5:172598428-172598450 CCCAGCCAGAAGACAGAGGGTGG + Intergenic
1002960993 6:1914895-1914917 CCCAGGCCTAAGCAGGAGGGGGG - Intronic
1003302396 6:4896031-4896053 CCCAGGCAGAAGTGAGAGAGGGG - Intronic
1004347021 6:14857847-14857869 CCCCGCCTTCAGCAAGAGACTGG + Intergenic
1004511932 6:16290336-16290358 CCCAGCTATAGTCAAGAGAAAGG - Intronic
1006136436 6:31898929-31898951 CCCAGCCCTAAACATGGGAGAGG - Intronic
1006392002 6:33764035-33764057 CCCAACCAGAGCCAAGAGAGAGG + Intergenic
1007114830 6:39336020-39336042 CCCAGCCACAGGCAAGGCAGTGG - Exonic
1007176564 6:39901626-39901648 CCCAGCCTGAGGGAAGAGAGTGG + Intronic
1007707497 6:43799709-43799731 CTCAAACATAGGCAAGAGAGAGG - Intergenic
1008062264 6:47010950-47010972 CAGACCCATAAGCAAGAGAAGGG - Intronic
1013296183 6:108760285-108760307 CCCAGCCTTGAGACAGAGAGAGG - Intergenic
1017300343 6:152850227-152850249 CCCAGGCATATGAAAGAGTGTGG + Intergenic
1018090725 6:160345535-160345557 CTCAGCTATAAGGAGGAGAGGGG + Intergenic
1022182109 7:27930882-27930904 CACAGCCATCAGCAGGACAGTGG + Intronic
1022548304 7:31209795-31209817 CACATGCAGAAGCAAGAGAGGGG + Intergenic
1023556814 7:41431750-41431772 ACCAGCTATAAGCCAGAGAAAGG - Intergenic
1024301450 7:47890343-47890365 CCCAGACATCAGCCCGAGAGCGG + Intronic
1025723503 7:64037296-64037318 CACAGCCATTAGAGAGAGAGAGG - Intronic
1026462054 7:70623024-70623046 CATAGCAATTAGCAAGAGAGTGG + Intronic
1031085330 7:117296851-117296873 CCCACCTATAGCCAAGAGAGTGG + Intronic
1032134444 7:129262711-129262733 CCCAGCCATGACCAAGTGAAAGG - Intronic
1033682696 7:143611023-143611045 CACAGACATAAACATGAGAGAGG - Intergenic
1035824098 8:2626553-2626575 GCCAGACATAAGCAGGAGATGGG + Intergenic
1036640595 8:10581075-10581097 CCCTGCCAGTAGCAACAGAGTGG + Intergenic
1040843460 8:51809297-51809319 CCCGGCCAGGAGAAAGAGAGTGG + Exonic
1041007079 8:53505782-53505804 CCCAGCCATATGCTAGAGGCTGG - Intergenic
1041171517 8:55147307-55147329 AGTAGCCATAAGCAAGAGATTGG + Intronic
1041457636 8:58077401-58077423 CGCAGCCACATACAAGAGAGAGG - Intronic
1043324569 8:79034104-79034126 GCCAGCCACAAGCAACAGGGTGG + Intergenic
1043616717 8:82134408-82134430 CCCATCCATAAGCATGGGATGGG - Intergenic
1043717244 8:83502904-83502926 CCCATCCATAAGCATGGGATGGG + Intergenic
1044631840 8:94287771-94287793 CACAGCCAGAAGCAAGAGGCAGG - Intergenic
1046837713 8:118821420-118821442 ACCAGCAATAAGCATGAGATGGG + Intergenic
1046838712 8:118832287-118832309 CACAGCCATAAAAAAGAGTGAGG + Intergenic
1051364346 9:16310497-16310519 CCCAGGCATGAACAAGAGGGGGG - Intergenic
1052283858 9:26762481-26762503 CCCAGCCAGAACCTATAGAGAGG - Intergenic
1055751708 9:79513850-79513872 AGAAGCCAGAAGCAAGAGAGGGG + Intergenic
1056312592 9:85355468-85355490 CCCACCCATGAGCATGAGATGGG + Intergenic
1056513509 9:87328434-87328456 CCCAGGCCAAAGCAAGAGACAGG + Intergenic
1060279131 9:122204292-122204314 TCCAGACAAAAGCAACAGAGTGG + Exonic
1062732485 9:138117941-138117963 CACAGACAAAACCAAGAGAGTGG + Exonic
1203784724 EBV:121254-121276 CCCAGCCACCAGCAACACAGAGG - Intergenic
1186680680 X:11870541-11870563 CCCAGACAAAAGCAGGAGACTGG + Intergenic
1188243106 X:27812055-27812077 CCCAGCAATGAGCAAGAGCCTGG + Intronic
1190231062 X:48582224-48582246 TCCAGCCTTCAGCAAGAGTGTGG - Intergenic
1195025454 X:100872639-100872661 CCCAGCAAAAAATAAGAGAGGGG + Intronic
1195207560 X:102617949-102617971 CCATGCCATCAGGAAGAGAGTGG - Intergenic
1198111370 X:133505331-133505353 CCAGGGCAGAAGCAAGAGAGTGG + Intergenic
1199566509 X:149221375-149221397 CCCAGGAATTAGCAAGTGAGAGG - Intergenic