ID: 1184508419

View in Genome Browser
Species Human (GRCh38)
Location 22:44917951-44917973
Sequence TGAGCCCGGCCTCCCACATC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 159}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184508416_1184508419 -1 Left 1184508416 22:44917929-44917951 CCATGCTGGGTCCTTAGCAAAAT 0: 1
1: 0
2: 0
3: 6
4: 121
Right 1184508419 22:44917951-44917973 TGAGCCCGGCCTCCCACATCAGG 0: 1
1: 0
2: 0
3: 7
4: 159
1184508414_1184508419 4 Left 1184508414 22:44917924-44917946 CCCTGCCATGCTGGGTCCTTAGC 0: 1
1: 0
2: 3
3: 16
4: 183
Right 1184508419 22:44917951-44917973 TGAGCCCGGCCTCCCACATCAGG 0: 1
1: 0
2: 0
3: 7
4: 159
1184508410_1184508419 29 Left 1184508410 22:44917899-44917921 CCTTGAGTCTAGTGATCTCTGTG 0: 1
1: 0
2: 1
3: 24
4: 263
Right 1184508419 22:44917951-44917973 TGAGCCCGGCCTCCCACATCAGG 0: 1
1: 0
2: 0
3: 7
4: 159
1184508415_1184508419 3 Left 1184508415 22:44917925-44917947 CCTGCCATGCTGGGTCCTTAGCA 0: 1
1: 0
2: 1
3: 16
4: 163
Right 1184508419 22:44917951-44917973 TGAGCCCGGCCTCCCACATCAGG 0: 1
1: 0
2: 0
3: 7
4: 159
1184508413_1184508419 5 Left 1184508413 22:44917923-44917945 CCCCTGCCATGCTGGGTCCTTAG 0: 1
1: 0
2: 1
3: 16
4: 201
Right 1184508419 22:44917951-44917973 TGAGCCCGGCCTCCCACATCAGG 0: 1
1: 0
2: 0
3: 7
4: 159
1184508409_1184508419 30 Left 1184508409 22:44917898-44917920 CCCTTGAGTCTAGTGATCTCTGT 0: 1
1: 0
2: 0
3: 21
4: 326
Right 1184508419 22:44917951-44917973 TGAGCCCGGCCTCCCACATCAGG 0: 1
1: 0
2: 0
3: 7
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184508419 Original CRISPR TGAGCCCGGCCTCCCACATC AGG Intronic
902770686 1:18643849-18643871 AGAACCCGGCCTCCCGCCTCGGG - Intronic
902861624 1:19251116-19251138 TGATCCCGTCCTCCCTCGTCAGG - Intronic
903366021 1:22805865-22805887 TGGGCTCGGCCTCCCACCCCAGG - Intronic
903848374 1:26291639-26291661 TGAGCCCAGCCCGCCACAGCAGG + Intronic
904030833 1:27532486-27532508 TGGGCCCGGCCTGCCCCACCTGG + Intergenic
904340945 1:29834132-29834154 AGAACCAGGCCTCCCCCATCAGG - Intergenic
904496614 1:30890897-30890919 TGAGCTGGGCCTCCCACTTGTGG - Intronic
904544421 1:31257319-31257341 TAGGCCCTGCCTCCAACATCGGG - Intergenic
905910171 1:41648019-41648041 TGAGCCCAGCTTCCCAGATAGGG - Intronic
907220695 1:52905110-52905132 TGAGGCCTCCCTCCCCCATCCGG + Intronic
908887651 1:68808523-68808545 TGTGCCCAGCCTCCCTCTTCTGG - Intergenic
914618143 1:149380011-149380033 TGGGCCCCACCTCCCACATTGGG + Intergenic
915154758 1:153865911-153865933 TGTGCCCGGCCTCAAACTTCTGG - Intronic
922418176 1:225441006-225441028 AGAACACGGCCTCCCACAGCAGG + Intergenic
1063906623 10:10786381-10786403 TGACCCTGGACTACCACATCAGG + Intergenic
1065356045 10:24842762-24842784 TGAGCCCCACCTCCAACATTAGG + Intergenic
1066022442 10:31318334-31318356 TCACCTCGGCCTCCCACACCCGG - Intergenic
1067685679 10:48465010-48465032 TGGGCCCGGCCTCCCTTATTAGG + Intronic
1070290144 10:75108652-75108674 TGGGCCCAGCCTCCCTCCTCTGG - Intronic
1070803180 10:79255291-79255313 AGAGCCCGGCCTTCCCCATCTGG - Intronic
1073103443 10:101019004-101019026 TCCACCCGGCCTCCCGCATCGGG + Exonic
1075398099 10:122142298-122142320 TGGGCCAGGCCGCCCACAGCAGG - Intronic
1076886810 10:133266833-133266855 TGCGCCCTGGCTCCCACCTCTGG - Intronic
1080002259 11:27363176-27363198 AGCGCCCCGCCGCCCACATCTGG + Exonic
1080044661 11:27796676-27796698 GGAGCCAGGGCTCACACATCTGG + Intergenic
1080050632 11:27855730-27855752 TGAGCCCCACCTCCCACCACCGG + Intergenic
1081866120 11:46361685-46361707 TGCGCCCTGCCTTCCAGATCAGG + Exonic
1083941839 11:65900181-65900203 TGACCCCGGCCTCCCACGCGCGG + Intronic
1084417789 11:69043430-69043452 TGCGCCCGGCATCTCACAGCTGG + Intergenic
1092794001 12:12092680-12092702 TGAGCCTGGCCTCCTCCATTGGG + Intronic
1097446200 12:59675135-59675157 TGAGCCTGTCCTCTCTCATCAGG - Intronic
1101829836 12:108248645-108248667 TGAGCCCTCCCTCCCACAAATGG - Exonic
1102340318 12:112116485-112116507 TGTGCCCGGCCTCACACCTTAGG + Intergenic
1102959648 12:117084531-117084553 TGGCCCTGGCCTCCCCCATCAGG + Intronic
1103228457 12:119307883-119307905 TGAGCCCGGCTTCCCATCACTGG - Intergenic
1107034160 13:35883231-35883253 TAGGCCCCGCCTCCCACATGGGG - Intronic
1107890021 13:44905962-44905984 TGGCCCCTGCCTCCCAGATCTGG - Intergenic
1108129032 13:47277051-47277073 TGGGCCCTGCCTCCAACATTGGG + Intergenic
1112557955 13:100486250-100486272 TAAGCCCTGCCTCCCATCTCTGG - Intronic
1116870344 14:50064019-50064041 TGGGCCCGGCTTTGCACATCTGG - Intergenic
1118765207 14:68904874-68904896 TGAGACCAGCCTTCCACATCTGG - Intronic
1124597449 15:31102628-31102650 TGAGCCCAGCCTCCAGCTTCAGG - Intronic
1124620749 15:31272623-31272645 TGAGCCCGGCCACACCCACCTGG - Intergenic
1127662331 15:61111980-61112002 TGAACCCAACCTCCCACACCTGG - Intronic
1131171206 15:90179554-90179576 TGAGGCTGGCCACCCACCTCTGG - Intronic
1131456475 15:92586078-92586100 AGTGCCTGGCCCCCCACATCTGG + Intergenic
1132275458 15:100559424-100559446 TGAATCCAGCCTCCCACATTGGG + Intronic
1133317221 16:4892284-4892306 TGAGCACAGATTCCCACATCAGG + Intronic
1136500731 16:30668716-30668738 TGAACAGGGCCTCCCACTTCTGG + Intronic
1136590375 16:31214747-31214769 TGCGCCCGGCCTCCTGCACCAGG + Exonic
1141662606 16:85449431-85449453 AGAGCCCCGGCTCCCAGATCCGG + Intergenic
1141691715 16:85600393-85600415 TCAGCCTGGCCTTCCCCATCAGG - Intergenic
1141828152 16:86495141-86495163 TGCACCCGGCCTCCCACCCCTGG + Intergenic
1142235199 16:88918762-88918784 CCAGCCCGGCCTCCCACGGCAGG + Intronic
1143406000 17:6677582-6677604 AGAGCCAGGCCTCCCACCGCAGG + Intergenic
1143541855 17:7573754-7573776 CGCCCGCGGCCTCCCACATCCGG + Intronic
1144649670 17:16999405-16999427 TGATCCAGGCATCCCACTTCCGG - Intergenic
1144684874 17:17219358-17219380 TGAGCCCTCCCTCCCACCCCAGG - Intronic
1145909870 17:28536249-28536271 TGAGCCCTGCTCCCCACTTCTGG - Intronic
1146525739 17:33565596-33565618 AGATCCAGGCCTCCCACCTCAGG + Intronic
1146649311 17:34597034-34597056 TGAGCCCTGCCTCCTCCCTCAGG + Intronic
1147123746 17:38352049-38352071 GGAGCTCGGCCTCCTGCATCGGG - Intergenic
1147603136 17:41758310-41758332 TGGTCCAGGCCTCCCAAATCTGG + Intronic
1151667503 17:75553699-75553721 TGACCCCCGCCTCCCACCCCGGG - Intronic
1151724290 17:75875596-75875618 TGAGCACAGCGTGCCACATCTGG - Intronic
1152019107 17:77771277-77771299 GGAGCCCGGCCCACCACAGCGGG + Intergenic
1152197395 17:78925536-78925558 TGTGCCCGGCCTGGCACGTCGGG + Intergenic
1152578043 17:81151517-81151539 GAGGCCCGGCCTCCCCCATCTGG + Intronic
1152592733 17:81221906-81221928 TCAGCCCGGCACCCCACAGCAGG + Intronic
1153591897 18:6683062-6683084 TGAGCCCGACTTCCCACCTATGG - Intergenic
1153617395 18:6947445-6947467 TGAGCCTCGGCTTCCACATCTGG + Intronic
1160686234 19:438268-438290 TGAGCCCGGCCTCACAGTGCTGG + Intronic
1163443499 19:17333618-17333640 TGAGCTCGGCTTCCCAGAACGGG - Intronic
1164591085 19:29507340-29507362 TGAGTCAGGCCTCCCCAATCAGG - Intergenic
1166876483 19:45901056-45901078 TGAGTCAGGCCTCCTAAATCTGG + Intronic
1167772904 19:51531847-51531869 TGTGTCCCGCCTCCCACCTCGGG + Intronic
1168194138 19:54760969-54760991 TGAGCCCAGTCTCCCTCCTCTGG - Intronic
1168196187 19:54775702-54775724 TGAGCCCAGTCTCCCTCCTCTGG - Intronic
1168199849 19:54806487-54806509 TGAGCCCAGTCTCCCTCCTCTGG - Intronic
1168689085 19:58366259-58366281 TGGGCAGGGCCTCCCTCATCAGG + Intergenic
926592288 2:14752282-14752304 TGAGCCTTGCCACCCACAGCTGG + Intergenic
927174246 2:20394168-20394190 TGAGACGGTCCTCCCACATCAGG + Intergenic
927639791 2:24839363-24839385 TCAGCCCAGCCTTCCCCATCTGG - Intronic
930479053 2:51924257-51924279 TAAGCCCAGCCTCCAACATTGGG - Intergenic
932366509 2:71156619-71156641 TGAGCCCTGCCTCTCATACCTGG + Intergenic
932402349 2:71489680-71489702 TGAGGCCTGTCTCCCACACCTGG + Intronic
936457471 2:112686431-112686453 TAAGCCCTGCCTACCTCATCAGG - Intergenic
938059118 2:128238468-128238490 AGGGCCCGGCCTCCCCCACCTGG - Intronic
938163499 2:129007123-129007145 TGTGCCCAGGCTCCCACTTCAGG + Intergenic
947274378 2:228373577-228373599 TAGGCCCTGCCTCCAACATCAGG + Intergenic
948099345 2:235360950-235360972 TGAGGCCCCCCTCCCACATTAGG - Intergenic
948330661 2:237161746-237161768 GGAGCCTGGCCTCCCTCCTCTGG - Intergenic
948394016 2:237631583-237631605 TGAGCTGCGCCTCCCACTTCTGG + Intronic
948444097 2:238018836-238018858 TGTGCCCTTCCTACCACATCAGG + Intronic
948534564 2:238636302-238636324 TGGGCCCGGCCTCCCCTGTCGGG - Intergenic
948681266 2:239636248-239636270 TGAGACCGGCATCCCAGCTCTGG - Intergenic
948727420 2:239943684-239943706 TGAGGCCTGCTTCCCAAATCAGG - Intronic
1169125036 20:3121396-3121418 TGAGCCCAGCCTGACACATATGG - Exonic
1172706685 20:36887312-36887334 TGAGCCCGGAGTCCCACCTGCGG + Intronic
1175947253 20:62564650-62564672 TCTGCCCGGGCTCCCCCATCGGG - Intronic
1178759227 21:35384664-35384686 TGAGCCTGTCCTTCCACATTTGG - Intronic
1178949918 21:36977808-36977830 TGAACCCGCCCACCCACACCAGG - Intronic
1180930945 22:19591058-19591080 TGAGCCTGGCTTCACACACCTGG + Intergenic
1181323295 22:22025383-22025405 GGAGCCCGGCCTCCCACGGGGGG + Intergenic
1181443404 22:22950245-22950267 TGAGCCACCCCACCCACATCTGG - Intergenic
1181667789 22:24410373-24410395 TCAGCCTGACCTCCCAGATCAGG - Intronic
1183173042 22:36201952-36201974 GGAGCCCTCCCTCCCACCTCAGG + Intronic
1183280569 22:36929835-36929857 TGAGCCTGCCCTCCCACCACGGG - Intronic
1183362725 22:37391074-37391096 TGAGCACGGCCTCCCGCAAGTGG + Intronic
1184508419 22:44917951-44917973 TGAGCCCGGCCTCCCACATCAGG + Intronic
1184674505 22:46033532-46033554 CAAGCCAGGCCTCACACATCTGG - Intergenic
952149175 3:30567695-30567717 TGAGACCGGTCTGCCACAGCAGG + Intergenic
954439679 3:50515008-50515030 TGAGCTCAGCCACCCACCTCTGG - Intergenic
960994218 3:123330486-123330508 TGAGCCCAACCTTTCACATCTGG + Intronic
961527198 3:127512673-127512695 TGAGCCTCGCCTCCTACCTCAGG - Intergenic
961561775 3:127735037-127735059 TGAGCCAAGACTCCCACGTCGGG - Intronic
969308477 4:6338893-6338915 TGAGCCCAGCTTCCCTCATCTGG + Intronic
978599464 4:110412832-110412854 TCAGGCTGGCCTCCTACATCTGG + Intronic
981154437 4:141417273-141417295 TAGGCCCCGCCTCCAACATCAGG - Intergenic
984146097 4:176063573-176063595 TGATCCCGGTCTCCCAGTTCAGG - Intergenic
985112020 4:186555607-186555629 TGGGCCCGGCTTCCCGCACCGGG - Intergenic
986627644 5:9737584-9737606 TGAGCCCAGCCTGCCAGGTCAGG + Intergenic
990358638 5:54996018-54996040 TGACCCCTGCCTCCTCCATCAGG + Intronic
992286111 5:75236983-75237005 CGCGCGCGGCCTCCCACTTCCGG - Intergenic
992796036 5:80255877-80255899 TGCGCCCGGCCTCGCTCACCTGG + Exonic
995543460 5:113206480-113206502 TGAGGCAGGCCTCCCACTTGAGG + Intronic
996343042 5:122459012-122459034 TGAGCCTGTCTTCCCACAGCGGG + Intronic
997239104 5:132294146-132294168 TGCGCCCGCCCTCCCACGTGGGG + Intronic
1001248584 5:170125552-170125574 TAATCCTGGCCTCCCATATCTGG + Intergenic
1001380863 5:171305615-171305637 GGAACCTGGCCTCCCACAGCTGG + Intergenic
1001447445 5:171796815-171796837 TGAGGCTGGGCACCCACATCTGG - Intergenic
1001948937 5:175802598-175802620 TCAGCCCTGGCTCTCACATCAGG + Intronic
1010554367 6:77260553-77260575 TGAGCCCAGCAGCCCACATATGG + Intergenic
1018771749 6:166976851-166976873 TGAGCCCTTCCTCCCACATGGGG + Intergenic
1020444082 7:8250036-8250058 AGAGCCAGGGCTCCCACATGGGG + Intronic
1020448037 7:8290763-8290785 TGAGCCCTGCTTCTCACACCTGG + Intergenic
1023109491 7:36794976-36794998 AATGCCTGGCCTCCCACATCCGG + Intergenic
1024698604 7:51883155-51883177 TGAGGCCTGCATCCCATATCAGG + Intergenic
1031450018 7:121904366-121904388 GGAACCAGGCCTCCCATATCAGG + Intronic
1032837213 7:135685452-135685474 TGAGCCAGGCCTGCCACTCCAGG + Intronic
1034538942 7:151743934-151743956 TGTGCCAGCCCCCCCACATCTGG + Intronic
1035356210 7:158277385-158277407 TGGGCCCGGCCTCCTCCGTCTGG - Intronic
1038307530 8:26418106-26418128 TGAGCCCAGGTTCCTACATCAGG - Intronic
1039403971 8:37297168-37297190 TTAGCTCCACCTCCCACATCTGG + Intergenic
1039608203 8:38900252-38900274 TGACTCCGGCCTCCCACGTCGGG - Intergenic
1039627546 8:39069570-39069592 TGAGCCCTGCCTTCCTCATAAGG - Intronic
1039864657 8:41490513-41490535 TCAGCTCGGCCTCCTACCTCAGG - Intronic
1042379812 8:68100636-68100658 TAAGCCCGGCCACCAACCTCTGG - Intronic
1042535629 8:69855743-69855765 TCTGCCCGGCCGCCCCCATCTGG + Intergenic
1045534472 8:103014256-103014278 CGAGTCCCGCCTCCCACCTCAGG - Intergenic
1049429700 8:142555040-142555062 TCAGCCCCACCTCCCACCTCTGG + Intergenic
1049678580 8:143904762-143904784 TGAGTCCTGCCTCCTACCTCAGG - Intergenic
1049836002 8:144735953-144735975 TGACCCTGGCCCCCCACAGCGGG + Intronic
1051245728 9:15109095-15109117 TGAGCCAGGAATCCCACTTCTGG + Intergenic
1056092545 9:83218744-83218766 AGAACCTGGCCTCCCACATCTGG + Intergenic
1057585875 9:96328323-96328345 TGAGCCCAGCCTCCATCTTCTGG + Intronic
1059322302 9:113479309-113479331 TCAGCCCCGCCCACCACATCGGG - Intronic
1059403442 9:114085284-114085306 TTTGCCCAGCCTCCCACAGCTGG + Intergenic
1060998043 9:127886059-127886081 GGATGCCGGCCTCCCACCTCTGG + Exonic
1061461103 9:130739845-130739867 TGAGACCAGCCTCCAACATAGGG + Intronic
1061617267 9:131788491-131788513 TGAGCCCAGCCTCCCTCCTGAGG - Intergenic
1062071013 9:134554986-134555008 TGAGCTCAGCCTCCCGCGTCTGG - Intergenic
1062446575 9:136597761-136597783 CCAGCCCAGCCCCCCACATCTGG - Intergenic
1189160336 X:38803952-38803974 TGTGCCCGGCCCTCCTCATCTGG + Exonic
1199676728 X:150195749-150195771 GGAACCTGGCCACCCACATCAGG - Intergenic
1202378174 Y:24256578-24256600 TGAGGCCTGCTTCCCCCATCTGG - Intergenic
1202492608 Y:25413543-25413565 TGAGGCCTGCTTCCCCCATCTGG + Intergenic