ID: 1184509013

View in Genome Browser
Species Human (GRCh38)
Location 22:44921212-44921234
Sequence CAGGGTAAGGAGAAGGGAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1521
Summary {0: 1, 1: 0, 2: 6, 3: 168, 4: 1346}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184509003_1184509013 21 Left 1184509003 22:44921168-44921190 CCAACACACGATGGGATGGCAGC 0: 1
1: 0
2: 0
3: 4
4: 71
Right 1184509013 22:44921212-44921234 CAGGGTAAGGAGAAGGGAGATGG 0: 1
1: 0
2: 6
3: 168
4: 1346
1184509007_1184509013 -3 Left 1184509007 22:44921192-44921214 CCACTAGCAGGGTGGACATTCAG 0: 1
1: 0
2: 0
3: 5
4: 86
Right 1184509013 22:44921212-44921234 CAGGGTAAGGAGAAGGGAGATGG 0: 1
1: 0
2: 6
3: 168
4: 1346

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184509013 Original CRISPR CAGGGTAAGGAGAAGGGAGA TGG Intronic
900736756 1:4304036-4304058 CAGGTTGTGGAGAAGGGAGCGGG - Intergenic
900919082 1:5659429-5659451 CACGGGAAGGTGAAGGCAGAGGG - Intergenic
901034622 1:6328924-6328946 CAGGCCAAGGGGGAGGGAGAAGG - Intronic
902219884 1:14958097-14958119 CAGGGGAGGGAGCAGGCAGAGGG - Intronic
902594378 1:17498263-17498285 GAGGGCAAGGAGTAGGTAGAAGG + Intergenic
902615444 1:17621070-17621092 AAGGGAAAGGAGAAGGGACTGGG + Intronic
903071822 1:20730539-20730561 GAGGCTAAGGACCAGGGAGATGG - Intronic
903231273 1:21923714-21923736 CTGGTAAAGGAGTAGGGAGAAGG - Intronic
903253744 1:22076799-22076821 AAGGGAAAGGAGAAGGAAAAAGG + Intronic
903271034 1:22188449-22188471 CAGGGTTAGGGGCAGGCAGAGGG - Intergenic
903459461 1:23510240-23510262 CAGGCTAAGGAGAGAGAAGAAGG - Intronic
903482344 1:23662999-23663021 CGGGGTGAGGAGCTGGGAGAGGG - Intergenic
903548906 1:24143981-24144003 CAGGGCCTGGAGAAGGTAGAAGG + Intergenic
903571297 1:24307588-24307610 CAGGAAAAGGAGAAGGAAGTGGG + Intergenic
903632852 1:24789977-24789999 AGGGAAAAGGAGAAGGGAGATGG + Intronic
903796055 1:25929764-25929786 AAGGGGAGGGAGAAGGGAAAGGG - Intergenic
903862183 1:26371238-26371260 CAGGGTCAGGAGATCTGAGATGG - Intronic
903934090 1:26882866-26882888 CAGGAAAAGGAGGAGGGAGCAGG - Intronic
904087190 1:27917127-27917149 AAGGGGAAGGAGGAAGGAGAAGG - Intergenic
904295393 1:29516937-29516959 GAGGAGAAGGAGAAGGAAGAAGG - Intergenic
904295740 1:29518748-29518770 GAGGAGAAGGAGAAGGAAGAAGG - Intergenic
904295752 1:29518808-29518830 GAGGAGAAGGAGAAGGAAGAAGG - Intergenic
904334737 1:29789615-29789637 AAGGACAAGGAGAAGGGAGAGGG + Intergenic
904360993 1:29971717-29971739 AAGGCAAAGGAGAAGAGAGAAGG - Intergenic
904529654 1:31160037-31160059 CATGGTAGAGAGAAGGCAGAAGG + Intergenic
904970762 1:34417926-34417948 GAGGTGGAGGAGAAGGGAGATGG + Intergenic
905297332 1:36962479-36962501 CAGGGGAAGGAGACAGGAAAGGG + Intronic
905318219 1:37097091-37097113 CAGCATTAGGAGAAAGGAGAAGG + Intergenic
905442004 1:38001593-38001615 CAGGGAAAAGGGCAGGGAGAGGG - Intronic
905510959 1:38519744-38519766 AAGGGAGAGGAGAAGGGAGGGGG + Intergenic
905980565 1:42222007-42222029 GAGGAGAAGGAGAAGGGGGAGGG + Intronic
906180845 1:43817591-43817613 GAGGAGAAGGAGAAGGGAGGAGG - Intronic
906180868 1:43817697-43817719 GAGGAGAAGGAGAAGGAAGAAGG - Intronic
907178923 1:52553117-52553139 GAGGGGGAGGAGGAGGGAGAGGG + Intronic
907222190 1:52915087-52915109 CAGGGTGTGGGGAAGAGAGATGG + Intronic
907401138 1:54225675-54225697 CAGGGGAGGGAGGAAGGAGAAGG + Intronic
907951748 1:59189897-59189919 CAGGGAAAGAAGAATGGAGAGGG - Intergenic
908364651 1:63408165-63408187 TTGGGAAAGGAGGAGGGAGAAGG - Intronic
908562413 1:65319872-65319894 GAGGCAAAGGAGAAGAGAGAGGG - Intronic
909170056 1:72283063-72283085 CTGGGGATGGAGAAGGGAGGGGG + Intergenic
909363172 1:74788813-74788835 AGGGGAAAGGAGAAAGGAGAGGG + Intergenic
909481586 1:76132753-76132775 CAGGGACAGAAGAAGGGACAAGG + Intronic
909492645 1:76242596-76242618 CAGGGTGAGGGGAAAGGGGAGGG - Intronic
910333011 1:86097550-86097572 GAGGGGGAGGAGAAGGGAGGAGG - Intronic
910855323 1:91689145-91689167 GAGGGTGAGAAGAAGGGGGAAGG - Intronic
911490255 1:98556181-98556203 CAGGGAATGGAAAAGGAAGAGGG + Intergenic
911536474 1:99106208-99106230 AAGGGGAGGGAGAAGTGAGAAGG + Intergenic
911958544 1:104269353-104269375 CAGGGAGAGGAGAAAGGAAAGGG - Intergenic
912630371 1:111241708-111241730 TAAGGCAAGGAGAAGGGAGAGGG + Intronic
912643499 1:111369539-111369561 TAGGGTGAGGAGAAGGGGGCAGG - Intergenic
912698405 1:111858238-111858260 CAGGGAAATGGCAAGGGAGAAGG - Intronic
913076432 1:115344204-115344226 CAGGTGAAGGAGTAGGGAGAAGG - Intergenic
913249758 1:116903133-116903155 CAAGGTAAGGAGGAGTTAGAAGG + Intergenic
913387554 1:118276083-118276105 CAGGGAAAGGAGGAGACAGAAGG + Intergenic
914240531 1:145849870-145849892 CAGGGAAAGGGGAAGGGTGTAGG - Intronic
914849263 1:151302006-151302028 CAGGGTGAGGACAAGAGACATGG + Intronic
914916095 1:151820126-151820148 CAGGGGAAGGAGGGGGGAGCAGG - Intronic
915168470 1:153962029-153962051 CAGGGAATGGGGAAGGGGGAGGG + Intronic
915307681 1:154990034-154990056 AAGGACAAGGAAAAGGGAGAAGG + Intronic
915555342 1:156657970-156657992 CCGGGGAAGGGGAAAGGAGAGGG - Intronic
915647802 1:157286283-157286305 GAGGGTGAGGAACAGGGAGAAGG + Intergenic
915784017 1:158587528-158587550 CAGGGTAAGCAAAAGAGAGTGGG + Intergenic
916300987 1:163274293-163274315 CTGGGAAAAGAGAAGGGAGCTGG + Intronic
916431691 1:164736151-164736173 CAGGGTGAAGGGAGGGGAGAGGG - Intronic
916495860 1:165346011-165346033 CAGGGTATAGGGGAGGGAGAAGG + Intronic
916885345 1:169061896-169061918 GAGGGGCAGGAGGAGGGAGAGGG + Intergenic
916935081 1:169619357-169619379 CAGGGCAATGAGAAGCAAGAAGG - Intronic
917082309 1:171268669-171268691 CAGGGGAGGGAGAAAGGAGAAGG - Intronic
917238164 1:172917144-172917166 CAGGCAAAGGAGAGAGGAGAAGG - Intergenic
917304091 1:173608973-173608995 AAGGGAAGGGAAAAGGGAGAAGG + Intergenic
917476363 1:175372660-175372682 CAGGGAAAGTGGTAGGGAGAAGG + Intronic
917499607 1:175574260-175574282 CAGGGTGGGGAGAAAGGAGAAGG - Intronic
917787760 1:178477171-178477193 AAAGGGAAGGAGAATGGAGAAGG - Intronic
917849902 1:179052838-179052860 CAGGATAGGAAGAAGGGAGTTGG - Intronic
917975833 1:180237089-180237111 CAGGGGAAGGAGAAGGAGGGAGG - Intronic
918001511 1:180502025-180502047 CAGGTAAAGTAGCAGGGAGAGGG - Exonic
918148877 1:181781348-181781370 CAGGGAAAGGAGAAGGAAGTGGG - Intronic
918202663 1:182281680-182281702 CAGGAAGAGGAGAAGGGAGGTGG + Intergenic
918322009 1:183373370-183373392 CATGGAAAGGAGAAGGGAGAAGG - Intronic
918329004 1:183438216-183438238 AAGGGAAAGGAAAAGGGAAAGGG + Intergenic
918469261 1:184853826-184853848 CAGGGTAAGAGAAAGGGAAATGG + Intronic
918472270 1:184886274-184886296 CAGGGTAGGGAGGCGGGGGAGGG + Intronic
918723304 1:187882558-187882580 CAAGGGAAGGGAAAGGGAGAGGG + Intergenic
918952748 1:191160690-191160712 GAAGGGAAGGAGAGGGGAGAGGG + Intergenic
919056946 1:192583037-192583059 AAGGGAAAGGAAAAGGGAGATGG + Intergenic
919260501 1:195187625-195187647 CAGGGAAAGGAAAAGAGGGATGG - Intergenic
919547533 1:198942096-198942118 CGGGGTAGGGAGATGGGAGAGGG + Intergenic
919775199 1:201189979-201190001 CAGGTGAAGTAGAAGGGAAATGG - Intergenic
920086213 1:203419308-203419330 CAAGGCAGGGAGAAGGGGGAGGG + Intergenic
920230577 1:204467132-204467154 CAGGGGATGGGGAAGGGTGAGGG + Intronic
920492889 1:206431755-206431777 GAGGGGATGGAGAAGGAAGAGGG + Intronic
920510891 1:206551360-206551382 CAGGGTAACGTGGAGGGAGCGGG - Intronic
920612870 1:207458718-207458740 CACTGGAAGGAGAAGGGACAGGG - Intronic
920657581 1:207888012-207888034 CAGGGGTGGGAGAAGGGGGAGGG + Intronic
920740719 1:208578922-208578944 CAGTGTATGGAGATGGGAAATGG - Intergenic
920748006 1:208647195-208647217 AGGGGGAAGGGGAAGGGAGAGGG - Intergenic
920815043 1:209323456-209323478 GAGGGTAAGGAGAAGAAAGGTGG - Intergenic
920910962 1:210216197-210216219 GAGGGTAAGGTGAAGTGGGATGG + Intergenic
920986149 1:210891390-210891412 TGGGGTGAGGAGAAGGGGGAGGG + Intronic
921396849 1:214677782-214677804 AAGGGGGAGGAGAAGGGAGGAGG - Intergenic
921557908 1:216621436-216621458 CTAGGTAAGGAAAAAGGAGATGG + Intronic
922247748 1:223817247-223817269 GAGGGAAAGGAGGAGGGGGAGGG + Intronic
922247756 1:223817265-223817287 GAGGGAAAGGAGGAGGGGGAGGG + Intronic
922247764 1:223817283-223817305 GAGGGAAAGGAGGAGGGGGAGGG + Intronic
922247772 1:223817301-223817323 GAGGGAAAGGAGGAGGGGGAGGG + Intronic
922247780 1:223817319-223817341 GAGGGAAAGGAGGAGGGGGAGGG + Intronic
922247788 1:223817337-223817359 GAGGGAAAGGAGGAGGGGGAGGG + Intronic
922247796 1:223817355-223817377 GAGGGAAAGGAGGAGGGGGAGGG + Intronic
922247804 1:223817373-223817395 GAGGGAAAGGAGGAGGGGGAGGG + Intronic
922471592 1:225880423-225880445 CAGGCTGAGGAGAAGGCAGGGGG + Intronic
922894342 1:229088771-229088793 CAAGGTAAGGAGAAAGAGGAGGG + Intergenic
923017946 1:230141446-230141468 CAGGGGGAGGGGAGGGGAGAAGG - Intronic
923080197 1:230646043-230646065 CAGGGTCCTGAGAAGGGAGAGGG - Intronic
923198238 1:231688179-231688201 CAGGGTAAGGAACAAAGAGAAGG - Intronic
923235774 1:232031422-232031444 AAGGGAAAGGAGAAGGGAAAAGG + Intronic
923373896 1:233340591-233340613 CAGGGGAAGGGGGAGGCAGATGG + Intronic
923482356 1:234397264-234397286 GAGGGAAGGGAGAAGGGAGTAGG + Intronic
923862713 1:237907657-237907679 CAGGGTGGAGAGAAAGGAGAGGG + Intergenic
924067159 1:240235823-240235845 CAGAGGAAGAAGAGGGGAGATGG - Intronic
924352273 1:243127426-243127448 CAGAGTAGGGAGTTGGGAGAAGG + Intronic
924587864 1:245375746-245375768 CTTGGTAAGGAGAAGCGGGATGG + Intronic
924589758 1:245392619-245392641 CAGGGAAAGGGGAAGGGAGAGGG - Intronic
1062767174 10:74696-74718 AAGGGGAAGGAGAAGGGGAAGGG + Intergenic
1062767175 10:74702-74724 AAGGAGAAGGGGAAGGGAGAAGG + Intergenic
1062922882 10:1293155-1293177 GAGGGTAAGAAGGGGGGAGAGGG + Intronic
1063045704 10:2390407-2390429 AAGGGTATGAAGAAGTGAGAAGG - Intergenic
1063207576 10:3849122-3849144 AAGGGGAAGGGGAAGGGGGAGGG - Intergenic
1063286251 10:4692080-4692102 AAGGGGAAGGAGAAGGGGAACGG + Intergenic
1063286255 10:4692092-4692114 AAGGGGAACGGGAAGGGAGAAGG + Intergenic
1063286257 10:4692099-4692121 ACGGGAAGGGAGAAGGGAGAAGG + Intergenic
1063403944 10:5774886-5774908 CAGGGGAAGGGGAAGGGCAAGGG + Intronic
1063488697 10:6443650-6443672 GAGGGTAGGGAGGAGGGATAGGG + Intronic
1063494326 10:6492626-6492648 CGGGGTAGGGAGAGGGGAGTGGG + Intronic
1063504714 10:6586076-6586098 CAGGCTATGGACAAAGGAGAAGG - Intergenic
1063524840 10:6775376-6775398 AAAGATAAGGAGAAGAGAGATGG - Intergenic
1064114791 10:12568383-12568405 GAGGGGAAGGGGAGGGGAGAAGG - Intronic
1064272682 10:13879723-13879745 AAGGGAGAGGAGGAGGGAGAAGG - Intronic
1064461965 10:15543918-15543940 GAGGGAAAGGTGATGGGAGATGG + Intronic
1064981344 10:21170469-21170491 AGGCGTAAGGAGAAGGGAAAGGG - Intronic
1065031377 10:21589897-21589919 AAGGGGAAGGGGAAGGGAAAGGG - Intronic
1065320242 10:24502586-24502608 CAGGGCAGGGAGGTGGGAGAAGG - Intronic
1065414384 10:25468541-25468563 CAGGTAGAGGAGAAGGAAGAAGG - Intronic
1065558073 10:26936554-26936576 CAGGGAAAGAAGAAGGGATCAGG + Intergenic
1065747417 10:28855009-28855031 AAGGATAAGGAGGAAGGAGACGG - Intronic
1065904467 10:30237871-30237893 CAGGGTCAGAAGGAAGGAGATGG + Intergenic
1066700553 10:38123122-38123144 CAGGGCAAAGAGAGGGGGGAAGG + Exonic
1066758984 10:38737168-38737190 CAGGGTCAGGACAAGGGGCAGGG - Intergenic
1066962645 10:42235601-42235623 CAGGGTCAGGACAAGGGGCAGGG + Intergenic
1067039263 10:42940303-42940325 GAGTCCAAGGAGAAGGGAGATGG - Intergenic
1067081209 10:43213436-43213458 CAGGGTGAGAAGAGGGGAGGGGG + Intronic
1068116771 10:52744677-52744699 CAGGGTGAGGAGCAGAGAGCAGG - Intergenic
1068243120 10:54331004-54331026 AAGGGGAAGGAGAAGAGAAAGGG + Intronic
1068502846 10:57861988-57862010 CAGTGTCTGGAGAAGGGAGACGG - Intergenic
1069583949 10:69584564-69584586 CAGGGTAAGGACAATGGGAATGG + Intergenic
1070199149 10:74186276-74186298 AAAGGAAAGGAGAAGGGAAAGGG - Intronic
1070278919 10:75034746-75034768 AAGGGGATGGAGAAGGTAGAAGG - Intergenic
1070680553 10:78446086-78446108 GAGGAGAAGGAGAAGGGAGGAGG + Intergenic
1070896209 10:79984436-79984458 CAGGATTTGAAGAAGGGAGAAGG + Intergenic
1070905977 10:80073496-80073518 CAGTATAATGAGAATGGAGAAGG - Intergenic
1071074333 10:81732877-81732899 ATGGGGTAGGAGAAGGGAGATGG - Intergenic
1071450754 10:85789993-85790015 CAGAGTCAGGAAAAGGGAGAGGG - Intronic
1071876243 10:89846355-89846377 GGGGAAAAGGAGAAGGGAGAAGG + Intergenic
1071880526 10:89892186-89892208 GTGGGTAAGCAGAAGGGAGAAGG - Intergenic
1072311607 10:94161649-94161671 CAGGGTAATCAGACAGGAGAAGG - Intronic
1072710592 10:97713625-97713647 GAGGGGAAGGGGAAGGGAAAGGG + Intronic
1072847776 10:98851349-98851371 GAGGTTAAGGATAAGTGAGAAGG - Intronic
1073351478 10:102822980-102823002 CAGGGTCAGGAAACGGGAGCTGG + Intergenic
1073523262 10:104155099-104155121 CAGGGTTGGGAGAAATGAGAGGG + Intronic
1073565791 10:104534677-104534699 AAGGGAAGGGAGGAGGGAGAGGG - Intergenic
1073847585 10:107576312-107576334 CAGAGAGAGGGGAAGGGAGAAGG + Intergenic
1074074958 10:110114681-110114703 CAAAGTAAGGAGAAGAGAGAAGG + Intronic
1074132653 10:110595307-110595329 CTGGGTGGGGAGAAGGGAGCAGG - Intronic
1074752829 10:116603297-116603319 TAAGGTAAGGTGAAGAGAGAGGG - Intronic
1074861958 10:117517066-117517088 CACGGTAAGGCCAAAGGAGATGG + Intergenic
1075219493 10:120572329-120572351 CAGGGCATGGAGAAGGGGAAGGG - Intronic
1075473501 10:122712091-122712113 AAGGATAAGGAGAATGGAGGGGG + Intergenic
1075476754 10:122742152-122742174 CAGAGTAAGAAGAAAAGAGATGG + Intergenic
1075585430 10:123653782-123653804 ATGGGGAAGGGGAAGGGAGAAGG + Intergenic
1075802342 10:125160925-125160947 CCGGGGAAGGAGAAGGAAAACGG + Intronic
1076148679 10:128145644-128145666 CAGAGTAGGAAGAAGAGAGAAGG - Intergenic
1076346038 10:129779872-129779894 CGGGAAGAGGAGAAGGGAGAGGG - Intergenic
1076564094 10:131386487-131386509 CAGAGGGAGGAGCAGGGAGAGGG + Intergenic
1076685097 10:132194994-132195016 CTGGTCAAGGAGAAGGGTGAGGG + Exonic
1076729400 10:132430977-132430999 CAGGGTCCCGAGAAGGAAGATGG + Intergenic
1076802198 10:132835916-132835938 CAGGGGCAGGAGCAGGGGGAGGG - Intronic
1076984203 11:223624-223646 ACGTGTGAGGAGAAGGGAGAAGG - Intronic
1077147567 11:1052860-1052882 CCGGGGAAGCAGAAGGGAAAGGG - Intergenic
1077392581 11:2306941-2306963 GAGGAGAAGGAGGAGGGAGAAGG + Intronic
1077719754 11:4616092-4616114 AAAGGAAAGGAGAAGGGAGGGGG - Intergenic
1077751349 11:4973636-4973658 CATGGTAGGGAGAGAGGAGAGGG + Intronic
1077923236 11:6656305-6656327 AGGGGTAAGGAGAAGAGAAAGGG - Intergenic
1078099518 11:8321513-8321535 CAGGGGCTGGAGAAGGGACAGGG - Intergenic
1078179583 11:8999887-8999909 CAGGGTAAGGGGAATAGGGAAGG - Intronic
1078434035 11:11309868-11309890 CAGGGTGAGGAGAGGTGGGATGG - Intronic
1078612937 11:12837701-12837723 AAGGAGAAGGAGAAGGGAGAAGG - Intronic
1079143516 11:17830624-17830646 GAGGGAAAGGGGGAGGGAGAGGG + Intronic
1079633173 11:22702818-22702840 CAGAGCAAGGAGAAGAGATAGGG + Intronic
1079998199 11:27318965-27318987 CAGTGTAAGAATAATGGAGAAGG - Intergenic
1080091315 11:28352618-28352640 CAGGGTAAGGAGCAGGAATAAGG - Intergenic
1080603218 11:33841331-33841353 AAGGGAAAGGAGGAGGGAGAAGG - Intergenic
1080695480 11:34600007-34600029 CAGGGCAGGCAGAAGAGAGAGGG + Intergenic
1080793341 11:35540483-35540505 CCTGGTAGGGAGAAGAGAGAGGG + Intergenic
1080946551 11:36980750-36980772 CAGGAGAAAGAGAAGGGAGGAGG + Intergenic
1081155475 11:39684421-39684443 AAGGGGAAGGAGAAGGGGAAGGG - Intergenic
1081255168 11:40884055-40884077 CGGGGTAGGGGGAAAGGAGAGGG - Intronic
1081492561 11:43579513-43579535 CGAGGTAAGGAGCAGGGAGTCGG + Intronic
1081634830 11:44714158-44714180 CAGAATAAGCAGATGGGAGAAGG + Intergenic
1081741368 11:45443307-45443329 CAGGGTCTGGAGAATGCAGAGGG + Intergenic
1081871079 11:46382751-46382773 CAGCGAAAGGAGAAGGGGGTGGG + Intronic
1081983994 11:47288567-47288589 CAGGGTATGAGGATGGGAGATGG - Intronic
1082050726 11:47768338-47768360 CAGAGGCAGGAGACGGGAGAGGG - Intergenic
1082196805 11:49316270-49316292 AAGGGGAAGGGGAAGGGAAAAGG + Intergenic
1082609745 11:55282454-55282476 CAGGGAGAGAAGAAGGCAGAGGG - Intergenic
1082656938 11:55868071-55868093 CAGGGAGAGAAGAAGGCAGAGGG + Intergenic
1082992728 11:59222181-59222203 GAGGGTTAGGAACAGGGAGAGGG - Intergenic
1083043904 11:59714837-59714859 CAGAGGGAGGAGAAGGGAGATGG - Intronic
1083141844 11:60728696-60728718 GAGGGAAAGGAAAAGGGGGAAGG - Intergenic
1083322856 11:61857820-61857842 CAGGGAGCGGGGAAGGGAGATGG - Intronic
1083884634 11:65566418-65566440 GAGGGAAAGGAGGAGGGGGAGGG - Intergenic
1084066690 11:66708314-66708336 CAGGGTTAGTGGAAGGGACAGGG + Intronic
1084122371 11:67077280-67077302 CAGGGTGAGGAGGATGGAGGAGG - Intergenic
1084757533 11:71249266-71249288 AAAGGGAAGGAGAGGGGAGAAGG - Intronic
1085065077 11:73487886-73487908 CAGGGTTAGGAGAGAGGTGAGGG - Intronic
1085069035 11:73525085-73525107 GAGGGAATGGAGAGGGGAGAAGG - Intronic
1085112242 11:73898206-73898228 GAGGGGAAGGGGGAGGGAGAGGG + Intronic
1085127046 11:74008918-74008940 GAGAACAAGGAGAAGGGAGAGGG + Intronic
1085134421 11:74073022-74073044 CAGGCAAAAGAGAAGGGTGACGG + Intronic
1085479647 11:76810647-76810669 CAGGCCAAGGAGCAGGGACAGGG - Intergenic
1085540412 11:77262685-77262707 CAGGGTAAAGTCAAGGGACAGGG - Intronic
1085587906 11:77728602-77728624 AAGGGAAGGGAGAAGGGAGACGG + Intronic
1085640506 11:78189761-78189783 AAGGATAAGGAGGAGAGAGAAGG - Intronic
1085927042 11:81035061-81035083 CAGGGAAAGGAAAGGGGAAAGGG + Intergenic
1086067944 11:82766034-82766056 AAGGGTAAGGGGTAGGGACATGG + Intergenic
1086477131 11:87189121-87189143 AAGGGAAAGGAAAAGGGAAAGGG - Intronic
1086659020 11:89391916-89391938 AAGGGGAAGGGGAAGGGAAAAGG - Intronic
1087448448 11:98285832-98285854 CAGGGCAAGGTGAAGAAAGAAGG + Intergenic
1088166649 11:106946086-106946108 GATGGTGAGGAGAGGGGAGAAGG + Intronic
1088339330 11:108745128-108745150 GAGTGGAAGGAGAAGGGAGAAGG - Intronic
1088728995 11:112664217-112664239 CAGGGAGAGGAAGAGGGAGAGGG + Intergenic
1089173872 11:116534740-116534762 CAGGGTAAGGAGGAATGGGAAGG + Intergenic
1089622595 11:119730126-119730148 CAGAGTAAGGGGAAGAGGGAAGG - Intergenic
1090333922 11:125950484-125950506 AAGGGGAAGGGGAAGGGAGGGGG + Intergenic
1090376709 11:126294702-126294724 CATGATAGGGAGAAGTGAGAGGG - Intronic
1090464628 11:126923293-126923315 AAGGAGAAGGAGAAGGAAGAAGG - Intronic
1090464635 11:126923344-126923366 AAGGAGAAGGAGAAGGAAGAAGG - Intronic
1090480277 11:127061760-127061782 CAAAGAAAGGAGAAGGGGGAAGG - Intergenic
1091044631 11:132314722-132314744 CTGGGCAAGAAGAGGGGAGAGGG + Intronic
1091164747 11:133465276-133465298 CAAGGTAAGGAGGAGGGTTATGG - Intronic
1091192428 11:133706847-133706869 AAGGGGAAGGGGAAGGGAAAGGG + Intergenic
1091710148 12:2734121-2734143 CAGGGGAAGGGGAAGGGAAAGGG + Intergenic
1091784797 12:3236770-3236792 CAGGTTCAGCAGGAGGGAGAGGG + Intronic
1091916414 12:4274003-4274025 CGGGGAAAGCAGGAGGGAGAGGG + Exonic
1091977511 12:4837257-4837279 CAAGGTATGGAGAAGAGACACGG - Intronic
1092542143 12:9426657-9426679 CATGGGAAGAAGAGGGGAGAAGG + Intergenic
1092817240 12:12322940-12322962 GAGGGGAAGGGGAAGGGAGAAGG + Intergenic
1093017637 12:14170943-14170965 GAGAGGAAGGAGAAGGGTGAGGG + Intergenic
1093017645 12:14170967-14170989 AAGGGGAAGGAGAAGGGTAAAGG + Intergenic
1093017652 12:14170979-14171001 AAGGGTAAAGGGAAGGGGGAGGG + Intergenic
1093092289 12:14935660-14935682 CAGGGTGAAGAGGAGGGAGTTGG - Intronic
1093459228 12:19393277-19393299 AAGGGGAAGGGGAAGGGGGAAGG + Intergenic
1093523347 12:20076116-20076138 GAGGGTGAGGAAGAGGGAGAGGG - Intergenic
1094047377 12:26182558-26182580 AAGGGGAAGGGGAAGGGAGACGG - Intronic
1094216944 12:27952439-27952461 CAGGGAAAGGGGGAGGGAGGGGG + Intergenic
1094223183 12:28016820-28016842 TAGGTTTAGGAGAAAGGAGAGGG - Intergenic
1094510869 12:31095776-31095798 CATGGGAAGAAGAGGGGAGAAGG - Intronic
1095944880 12:47748161-47748183 CAGGGTGAGGGGATGGGAGGAGG + Intronic
1095946402 12:47756282-47756304 CAAGGTAGGGGGTAGGGAGAAGG - Intronic
1096046663 12:48568466-48568488 TGGGGTAAGGAGAAGGAGGATGG + Intronic
1096071030 12:48775644-48775666 CAGGTTACTGAGGAGGGAGAAGG - Intronic
1096526483 12:52213078-52213100 CTGGGTCTGGAGAAGGGAGGAGG + Intergenic
1096638281 12:52975036-52975058 GAGGAGAAGGAGCAGGGAGAGGG + Intergenic
1096751104 12:53759306-53759328 CAGCATAGGGAGAAAGGAGAAGG + Intergenic
1096788076 12:54029220-54029242 CAGTCTGAGGAGAAGGGAGGGGG + Intronic
1096809813 12:54162078-54162100 CATGGCAAAGAGAAGGGAGCAGG + Intergenic
1096845268 12:54403157-54403179 CAGGGCAGGGAGAAGGGACCTGG - Intronic
1096920161 12:55075646-55075668 CAGGGTATGGGGTAGGGGGAGGG - Intergenic
1097167872 12:57095158-57095180 ACGGGGAAGGAGAGGGGAGAAGG - Exonic
1097516176 12:60609425-60609447 CAGGGTAAATAGAAAGGAGATGG - Intergenic
1097658783 12:62403651-62403673 AAGGGGAAGTAGAATGGAGAGGG + Intronic
1097905537 12:64915395-64915417 CAGGTGAAGGAGGAGGGAAAGGG + Intergenic
1098462008 12:70742391-70742413 AAGGGCAAGGAGTAGGGAAAAGG + Intronic
1098462523 12:70748001-70748023 TGGGGGAAGGAGAAGGGAAAGGG + Intronic
1098998862 12:77153064-77153086 CAGTGTATGGGGGAGGGAGAAGG + Intergenic
1099100437 12:78433211-78433233 CGGGGTAGGGTGCAGGGAGAGGG - Intergenic
1099119333 12:78668425-78668447 CAGGGCAAGGGGATGGGAGGTGG - Intergenic
1100002277 12:89851527-89851549 GAAGGTAGGCAGAAGGGAGAAGG - Intergenic
1100179396 12:92068686-92068708 CAAGAAAAGGAGAAGGGACAGGG + Intronic
1100383276 12:94082299-94082321 CATGTTAATGAGAAGGGACAAGG - Intergenic
1100604811 12:96142925-96142947 TTGGGGAAGGAGAAGAGAGAGGG + Intergenic
1100891062 12:99126497-99126519 CAGGGTAAGGTGGGGGGAGGGGG - Intronic
1101042567 12:100771612-100771634 AGGGGCTAGGAGAAGGGAGAGGG + Intronic
1101241968 12:102848068-102848090 CAGGGTAATGAGCAGATAGATGG + Intronic
1101594226 12:106149471-106149493 CAGGGCAGGGAGAAGGAAGGCGG + Intergenic
1101594881 12:106155450-106155472 TAGGGGAAGGGGAAGAGAGAGGG - Intergenic
1101640561 12:106583399-106583421 GGAGGGAAGGAGAAGGGAGAGGG + Intronic
1101648881 12:106656677-106656699 GAGAATGAGGAGAAGGGAGATGG - Intronic
1101709579 12:107252708-107252730 AAGGGTGGGGAGGAGGGAGAAGG - Intergenic
1101840610 12:108325049-108325071 GAGGAAAAGGAGGAGGGAGAAGG + Intronic
1101842878 12:108340558-108340580 GAGGGGAAGGTGAAGGGAGAGGG + Intergenic
1101843168 12:108342162-108342184 CAAGGGGAGGAGAGGGGAGAGGG + Intergenic
1101843621 12:108344701-108344723 CAGGGCAGGGAGAAGGCAGTGGG + Intergenic
1101909457 12:108850632-108850654 CAGGGAGGGGAGATGGGAGAGGG + Intronic
1102035830 12:109769908-109769930 CAGGGTTTGGAGAATGGGGATGG - Exonic
1102090660 12:110184592-110184614 AAGGGTAAAGGGAAGGGAGCAGG + Intronic
1102397052 12:112595495-112595517 AAGGGGAAGGAGGAGGGAGAGGG - Intronic
1102518430 12:113465103-113465125 CAGGGTTTGGAGAGGGAAGAGGG - Intronic
1102574581 12:113848230-113848252 CAGGCTAAAGAGTGGGGAGAAGG + Intronic
1102904357 12:116662758-116662780 CAAGGCAAGGAGAAAGGAGAGGG - Intergenic
1102990445 12:117311890-117311912 CATGGAATGAAGAAGGGAGAGGG - Intronic
1103087473 12:118072539-118072561 AAGAGAAAGGAAAAGGGAGAAGG + Intronic
1103097424 12:118143236-118143258 CAGGGCTAGGGGAAGGGAAATGG - Intronic
1103265470 12:119626509-119626531 GAGGAGGAGGAGAAGGGAGAAGG + Intronic
1103793819 12:123490037-123490059 CAGGAGAAGGAGAAAGGGGATGG - Intronic
1103883509 12:124184361-124184383 CAGGGTCACCAGAAAGGAGAGGG - Intronic
1103990358 12:124795075-124795097 CAGGGCATGGGGAGGGGAGAGGG - Intronic
1104036400 12:125100342-125100364 CAGGGAAAGAAAAAGAGAGAAGG - Intronic
1104066854 12:125313611-125313633 AGGGGAAAGGAGAGGGGAGAGGG - Intronic
1104416665 12:128601461-128601483 CAGAGAAAGGAGGAGGAAGATGG + Intronic
1104499296 12:129269377-129269399 AAGGGAAAGGAGAAGGCAAAGGG - Intronic
1104508282 12:129353130-129353152 CAGGATAAAAAGAAGAGAGAAGG - Intronic
1104667202 12:130656073-130656095 GAGGGTGGGGAGAAGGGACATGG + Intronic
1104715436 12:131013116-131013138 CAGGGCCAGGAGGAGGGTGAGGG - Intronic
1105387384 13:19943955-19943977 GAGGGGAATGAGAAGGGAGATGG + Intergenic
1106776084 13:33011157-33011179 CAGAGTAACGAGCAGGGAGATGG + Intergenic
1106821529 13:33469831-33469853 CAGGGTAGGGACAAGGGAAAAGG + Intergenic
1107095077 13:36527287-36527309 CAGAGGAGGGAGAAGGGAGGTGG + Intergenic
1107217053 13:37934328-37934350 CAGCACAAGGAGAATGGAGAAGG + Intergenic
1107694045 13:42982760-42982782 CAGGGGAAAAAGATGGGAGAAGG - Intronic
1107697621 13:43015850-43015872 CAGTGGAAGGAGAGGGGAGGAGG - Intergenic
1107726930 13:43308274-43308296 CAAAGAAAGGAGAAGTGAGAGGG - Intronic
1107795453 13:44046903-44046925 AAGGGGAAGGAGAAGGGGAAGGG - Intergenic
1108298056 13:49045052-49045074 AAGGGAAAGGAAAAGGGAAAGGG - Intronic
1108856874 13:54803509-54803531 CAGGGTTAAGAGAAGTGACATGG - Intergenic
1109023666 13:57131960-57131982 CAGGGAAAGTCAAAGGGAGAGGG - Intergenic
1109230026 13:59745208-59745230 AAGGCAAAAGAGAAGGGAGATGG + Intronic
1109514069 13:63418039-63418061 CAGGGTGGGGAGAGGGGGGAGGG + Intergenic
1109620756 13:64901381-64901403 TAGGGACAGGAGAGGGGAGAAGG + Intergenic
1109704594 13:66073379-66073401 CAGGGAAAAGAGGATGGAGATGG + Intergenic
1110805670 13:79751512-79751534 AAGGGAAAGGGTAAGGGAGAAGG - Intergenic
1110868002 13:80419949-80419971 AAGGGAAGGGAGAAGGGAGAAGG - Intergenic
1111133946 13:84014146-84014168 TGAGGAAAGGAGAAGGGAGAAGG + Intergenic
1111234672 13:85393246-85393268 CAGGGAAATGAAAATGGAGAGGG + Intergenic
1111251606 13:85608633-85608655 AAGGGTAAGGAGAAGAGGGCGGG - Intergenic
1111267642 13:85838588-85838610 AAGGTAAAGGAGAAGGGAAAGGG + Intergenic
1111760442 13:92457405-92457427 CTGGGGAAGGAGAAGGGTGCTGG - Intronic
1111979852 13:95004095-95004117 CGGGGGAAGGAGGGGGGAGAAGG + Intergenic
1112532202 13:100216053-100216075 GAGGGGAAGGGGAAGGGAAAGGG - Intronic
1112724086 13:102282037-102282059 CAGGGTTAGGAGAAGCGGCAAGG - Intronic
1112836639 13:103522795-103522817 CAGGGTAGGGGGAAAGGTGAGGG + Intergenic
1113138147 13:107116839-107116861 CAGGGTGGGCAGAAGGCAGAGGG + Intergenic
1113448595 13:110389360-110389382 CAGATTAGGGAGAAGGGTGATGG - Intronic
1113564319 13:111309644-111309666 CAAGGCAAGGAAAAGGGGGAGGG + Intergenic
1113890373 13:113732254-113732276 CAGGGAAGTCAGAAGGGAGAGGG - Intronic
1113975512 13:114225263-114225285 GAGGGAGAGAAGAAGGGAGAAGG + Intergenic
1114161118 14:20168792-20168814 GAGGATAAAGAGGAGGGAGATGG + Intergenic
1114547726 14:23514575-23514597 CGGGGTGAGGCGAAGGGAGGGGG - Intergenic
1114618228 14:24079802-24079824 CAGGCTAAGGGGAGGGCAGATGG - Intergenic
1114906408 14:27133272-27133294 GAGGGTAAGGAGAAGGGGGATGG - Intergenic
1115095383 14:29629943-29629965 AAGGAGAAGGAGAAGGAAGAAGG - Intronic
1115098285 14:29666406-29666428 CAGGAAGAGGAGAAGAGAGATGG - Intronic
1115421474 14:33199706-33199728 GAGGGGAAGAAGAAGGGGGAGGG - Intronic
1115926225 14:38439098-38439120 AAGGGAAAGGAAAAGGGAAAGGG - Intergenic
1116922315 14:50592477-50592499 CAGGGTAAACAGAAGGAGGAAGG + Intronic
1117122797 14:52586581-52586603 AAGAGTAAAGAAAAGGGAGATGG - Intronic
1117284504 14:54273887-54273909 TGGGGTGAGGAGAAGGGGGAGGG - Intergenic
1117471911 14:56054847-56054869 GAGGGAAAGGAAAAGGGAAAAGG - Intergenic
1117480562 14:56140020-56140042 CAGGAAAAAGAGAAGGGGGAAGG - Intronic
1118484099 14:66197455-66197477 CAGGGTAAGGAGAACACATAAGG + Intergenic
1118656244 14:67952706-67952728 GAGGAAAAGGAGAAGGAAGAGGG + Intronic
1118737362 14:68711621-68711643 CAGGGCAAGCAGATGGGGGAAGG - Intronic
1118815596 14:69311517-69311539 AAATGTAAGGAAAAGGGAGAGGG - Intronic
1118855405 14:69617847-69617869 CAAGGTAGGGAGGAGGGAGAGGG + Intronic
1119172317 14:72544757-72544779 CAGGGGAAGGAACAGGGGGATGG - Intronic
1119329807 14:73785692-73785714 TAGGAAAAGGAGATGGGAGATGG - Intronic
1119330829 14:73792308-73792330 AAGGGTAAGGAGAGAGAAGAGGG + Intergenic
1119345515 14:73920474-73920496 CTGGGTAGGTAGAATGGAGACGG + Intronic
1119443776 14:74647303-74647325 CAGAGGAAGGAGAAGGGAGTCGG - Intergenic
1119859099 14:77923870-77923892 CAGGGAGGGGAGCAGGGAGAGGG + Intronic
1119925390 14:78488782-78488804 GAGGGGGAGGAGAAGGGAGGAGG + Intronic
1119950430 14:78738822-78738844 CAGGGAAATAAGAAGGCAGATGG + Intronic
1120306762 14:82780818-82780840 AAGGAGGAGGAGAAGGGAGAAGG - Intergenic
1120382606 14:83800576-83800598 GAGGGTAAGGGGAGAGGAGAAGG - Intergenic
1120484852 14:85100230-85100252 GAGGCTAAGGAGGAGGAAGAGGG + Intergenic
1120686326 14:87542292-87542314 GGGGGTGAGGAGAAGGGAGGAGG - Intergenic
1120917290 14:89721250-89721272 CAGCTTAAGGAGAGGGGAGAGGG - Intergenic
1121468175 14:94129307-94129329 CAGGGGAAGGCAGAGGGAGATGG + Intronic
1121593267 14:95137174-95137196 AAGGGGAAGGAGAAGGAAAAGGG + Intronic
1121593369 14:95137506-95137528 AAGGGGAAGGAAAAGGGAAAGGG + Intronic
1121724925 14:96140274-96140296 GAGGGTAAAGAGAAGGGAGATGG - Intergenic
1121970229 14:98349199-98349221 GAGGGTGAGAAGAAGGGAGAGGG + Intergenic
1122004710 14:98692636-98692658 CAGGGGAAGGACAAGAGGGAGGG - Intergenic
1122091607 14:99344390-99344412 GATGGCGAGGAGAAGGGAGAAGG + Intergenic
1122172150 14:99885751-99885773 CAGTGAAAGGAGGAGGAAGAGGG + Intronic
1122283274 14:100636741-100636763 CAGGGGAAGGAGCAGGGAGTGGG - Intergenic
1122533461 14:102445375-102445397 CGGGGGAAGGAGTAGAGAGATGG + Intronic
1122533474 14:102445422-102445444 CGGGGGAAGGAGTAGAGAGATGG + Intronic
1122533486 14:102445469-102445491 TAGGGGAAGGAGTAGAGAGATGG + Intronic
1122695251 14:103549273-103549295 CAGAGACAGCAGAAGGGAGAGGG + Intergenic
1202929718 14_KI270725v1_random:26772-26794 CAGGGTCAGGACAAGGGGCAGGG - Intergenic
1123422583 15:20144472-20144494 CAGGGTCAGGACAAGGGGCAGGG + Intergenic
1123442431 15:20301892-20301914 CAGGGTCAGGACAAGGGGCAGGG - Intergenic
1123457480 15:20439167-20439189 CAGGGCACAGGGAAGGGAGACGG + Intergenic
1123457518 15:20439353-20439375 CAGGGTACAGGGAAGGGAGACGG + Intergenic
1123457545 15:20439477-20439499 CAGGGTACAGGGAAGGGAGACGG + Intergenic
1123531811 15:21151012-21151034 CAGGGTCAGGACAAGGGGCAGGG + Intergenic
1123660526 15:22560944-22560966 CAGGGTACAGGGAAGGGAGACGG - Intergenic
1123660553 15:22561068-22561090 CAGGGTACAGGGAAGGGAGACGG - Intergenic
1123660578 15:22561192-22561214 CAGGGCACAGGGAAGGGAGACGG - Intergenic
1123685579 15:22794882-22794904 CAGGGTCAGGGGACAGGAGAGGG - Intronic
1123830982 15:24136879-24136901 CAGGGTATGCAGAAGGAACATGG + Intergenic
1123836064 15:24194254-24194276 CAGGGTATGCAGAAGGAACATGG + Intergenic
1124045184 15:26142503-26142525 GAGGGGAGGGGGAAGGGAGAGGG - Intergenic
1124263638 15:28214378-28214400 CAGGGCACAGGGAAGGGAGACGG + Intronic
1124263650 15:28214440-28214462 CAGGGCACAGGGAAGGGAGACGG + Intronic
1124263662 15:28214502-28214524 CAGGGCACAGGGAAGGGAGACGG + Intronic
1124647666 15:31450415-31450437 AAGGGGAGGGAGAAGGGAAAGGG + Intergenic
1124798823 15:32809617-32809639 GAAGGGTAGGAGAAGGGAGAAGG - Intronic
1124957730 15:34370763-34370785 AAGGGAAAGGAGGAGGAAGAAGG - Intergenic
1125397711 15:39268367-39268389 CTGGGTGAGGGGAAGGGGGAGGG + Intergenic
1125538340 15:40455640-40455662 CAGAGTAAGGAGAAGGCGGCTGG - Intronic
1125697676 15:41652368-41652390 CGGGGAAAGGAGAGGGGAGAGGG - Intronic
1125931630 15:43604342-43604364 CAGGGTGAGATGAAGGAAGAAGG - Exonic
1125944734 15:43703822-43703844 CAGGGTGAGATGAAGGAAGAAGG - Intergenic
1126542817 15:49840981-49841003 CAGGGAAAGGAAAAGGGAAAGGG + Intergenic
1126575593 15:50193256-50193278 CAGGGGAAGGAGAAGGTATTTGG - Intronic
1126890952 15:53203675-53203697 CAGGGTGAGGAGAAGAGTGAGGG - Intergenic
1127029441 15:54845493-54845515 CAGGAAAAGGAGGCGGGAGAAGG + Intergenic
1127269010 15:57384089-57384111 GAAGGTAGGGTGAAGGGAGAGGG + Intronic
1127446389 15:59067337-59067359 AAGGGAAAGGAGAAAGGAGAGGG - Intronic
1127671443 15:61198897-61198919 CTGGGTAAGGAGAATGGACAGGG - Intronic
1127723042 15:61721484-61721506 CAGGGAAAGGAGAAGACAGCTGG + Intergenic
1127961128 15:63891793-63891815 AGGGGCAAGGAGGAGGGAGAGGG - Intergenic
1127996568 15:64156375-64156397 AAGGGTGAGGAGGAGGAAGAGGG + Exonic
1128159961 15:65417150-65417172 CTGGGAAAGGAGAATGGTGATGG - Intronic
1128241776 15:66106160-66106182 AAGGGAAAGGAGAAAGGAGATGG + Intronic
1128451189 15:67806805-67806827 CAGCATACGGAGAAGGGCGACGG - Exonic
1128528180 15:68426457-68426479 CTGGGTGGGGAGAGGGGAGAGGG + Intronic
1128539777 15:68518499-68518521 GAGAGTAGGGAGAAGGTAGAAGG - Intergenic
1128725013 15:69982009-69982031 CAGGGTAAAGGAAAAGGAGAGGG - Intergenic
1128818181 15:70629545-70629567 TAGGGCAGGGAGGAGGGAGAGGG - Intergenic
1128839861 15:70841377-70841399 GAAGGTTAGGAAAAGGGAGAAGG - Intronic
1128977827 15:72166512-72166534 CAGGGAATGGGGCAGGGAGAGGG - Intronic
1129044981 15:72725982-72726004 AGGGGAAAGGGGAAGGGAGATGG - Intronic
1129067149 15:72914802-72914824 CTGTGGAAGGAGAAGGCAGAAGG - Intergenic
1129156140 15:73719394-73719416 CCGTGAAAGGAGAAGGGGGAGGG - Intergenic
1129165618 15:73775487-73775509 GAGGCTGAGGAGTAGGGAGAGGG + Intergenic
1130035902 15:80361256-80361278 CTGGGTCAGGAAAAGGGATAGGG + Intronic
1130171784 15:81522709-81522731 AGGGGAAAGGAGAAGGGCGAGGG + Intergenic
1130223660 15:82043041-82043063 GCCGGGAAGGAGAAGGGAGAGGG + Exonic
1130224007 15:82044622-82044644 CAGGGTGCGGAGGAGGGAGTGGG + Intronic
1130226006 15:82058867-82058889 GAGAGGAAGGAGAAGGGGGAAGG - Intergenic
1130226059 15:82059034-82059056 GAGGGGGAGGAGAAGGGGGAAGG - Intergenic
1130226113 15:82059217-82059239 GAGGGGGAGGAGGAGGGAGAGGG - Intergenic
1130254721 15:82320612-82320634 CAGGGTCAGGAGAAGAAAGCTGG - Intergenic
1130321245 15:82843976-82843998 GAGGGTAACATGAAGGGAGAAGG + Intronic
1130577790 15:85107583-85107605 CAGTGGAAGGAGAGGGGAGGGGG + Intronic
1130600252 15:85269394-85269416 CAGGGTCAGGAGAAGAAAGCTGG + Intergenic
1130602154 15:85283491-85283513 GAGGGTAAGGAGGAGTGGGAGGG + Intergenic
1130657063 15:85799131-85799153 CAGGGTCAGGAACAGGGAGGTGG - Intergenic
1130894913 15:88162460-88162482 CAGCAGAAGGAGAGGGGAGAAGG + Intronic
1131017848 15:89072488-89072510 GAGGGGAAGGAGAAGGGGAAGGG + Intergenic
1131139838 15:89968142-89968164 GGGGGGAAGGAGAAGGGAAAGGG + Intergenic
1131641577 15:94299035-94299057 GAGGGGAAGGGGAAGGGGGAGGG - Intronic
1131659729 15:94501011-94501033 GAGGGTAGGGAGAGGGGAAAAGG - Intergenic
1131689373 15:94809973-94809995 GAGGGAAATGAGAAGGGAGCAGG - Intergenic
1131755070 15:95550711-95550733 GAGAGTAAGGGGAAAGGAGAGGG - Intergenic
1132037571 15:98499502-98499524 CTGGGAAAAGAGAAGGGAAAAGG - Intronic
1132284369 15:100650439-100650461 CAGGGATAGGAGGAGGCAGAGGG + Exonic
1132922006 16:2400780-2400802 GAGGGGGAGGAGGAGGGAGAGGG + Intergenic
1133102220 16:3486397-3486419 CAGCCTGAGGAGGAGGGAGAGGG + Exonic
1133344034 16:5058442-5058464 CAGGGGAAGGGGAAGGAAAAAGG - Intronic
1133392645 16:5422410-5422432 GAGAGGAAGGAGGAGGGAGAGGG + Intergenic
1133392853 16:5423089-5423111 AAGAGGAAGGAGGAGGGAGAGGG + Intergenic
1133547937 16:6826120-6826142 TGGGGTAGGGAGAAGTGAGACGG - Intronic
1133895088 16:9919510-9919532 CATGGTAAGGAGAAGAGAAATGG + Intronic
1134316583 16:13124373-13124395 CAGGGTAGGGAGATGGAGGAGGG + Intronic
1134330811 16:13249695-13249717 CAAGTGAAGGAGAAGGAAGAGGG - Intergenic
1134352619 16:13451929-13451951 AAGGAGAAGGGGAAGGGAGAAGG + Intergenic
1134572482 16:15303208-15303230 CAGGGTAGGCAGATGGGAGAGGG - Intergenic
1134729902 16:16452832-16452854 CAGGGTAGGCAGATGGGAGAGGG + Intergenic
1134750338 16:16619888-16619910 CAGGGGGAGGGGGAGGGAGAGGG + Intergenic
1134770600 16:16806037-16806059 AGGGGGAAGGGGAAGGGAGAAGG - Intergenic
1134770605 16:16806050-16806072 AAGGGGAAGGAGAAGGGGGAAGG - Intergenic
1134777381 16:16864975-16864997 CAGGGGAAGGGGTAGGGAGGAGG - Intergenic
1134840721 16:17399433-17399455 CAGTGTAATGAGGAGGGAGCAGG - Intronic
1134882161 16:17754622-17754644 GAGGGAAAGGGAAAGGGAGAAGG - Intergenic
1134937530 16:18259064-18259086 CAGGGTAGGCAGATGGGAGAGGG - Intergenic
1135247513 16:20869615-20869637 AATGGAAAGGAGGAGGGAGAGGG + Intronic
1135480710 16:22818640-22818662 AAGGAAAAGGAGAAGGGAAAGGG - Intronic
1135500341 16:22990671-22990693 CAAAGAAGGGAGAAGGGAGAAGG - Intergenic
1135624385 16:23982026-23982048 AAGGGGAAGGTGAAGGGAAAGGG - Intronic
1135624476 16:23982270-23982292 GAAGGGAAGGAGAAGGGAAAGGG - Intronic
1135793647 16:25421485-25421507 CTGGGCAGGGAGAAGGAAGAGGG + Intergenic
1136033318 16:27519235-27519257 CTGGGGAAGGGGAGGGGAGAGGG + Intronic
1136381510 16:29898189-29898211 CAGCCCAGGGAGAAGGGAGAGGG - Intronic
1136384265 16:29912989-29913011 CAAGGTTGGGAGAAGTGAGAGGG - Intronic
1136526577 16:30834943-30834965 CAGGGTAAGGGGAGGTGAGTGGG - Exonic
1136661291 16:31765546-31765568 CAGGGAAAGGAAAGGGGAAAGGG - Intronic
1136702006 16:32152813-32152835 CAGGGCATGGGGAAGGGAGACGG + Intergenic
1136723812 16:32342019-32342041 CAGGGTCAGGACAAGGGGTAGGG + Intergenic
1136765660 16:32774647-32774669 CAGGGCATGGGGAAGGGAGACGG - Intergenic
1136802439 16:33095731-33095753 CAGGGCATGGGGAAGGGAGACGG + Intergenic
1136842141 16:33548063-33548085 CAGGGTCAGGACAAGGGGTAGGG + Intergenic
1136862169 16:33710888-33710910 CAGGGTCAGGACAAGGGGCAGGG - Intergenic
1137016069 16:35376682-35376704 GAGGTTAAGGAGTAGGGAGATGG + Intergenic
1137232354 16:46578174-46578196 AAGGGAAAGGAAAAGGGAGAGGG + Intergenic
1137768069 16:50993017-50993039 AAGGGAGAGGAGAAAGGAGAAGG + Intergenic
1137788280 16:51154285-51154307 CCGGGAAAGGAGATGGGAGGTGG + Intergenic
1138044346 16:53705220-53705242 CAGAGTAAGGAGAAAGGAAAGGG - Intronic
1138217177 16:55214553-55214575 GAGGATGAGGAGAGGGGAGAGGG + Intergenic
1138350609 16:56344488-56344510 CAGGGGAGGGAGCAGGGAGACGG - Exonic
1138413916 16:56860351-56860373 CAGAGGAAGGAGAGGGGAGAGGG - Intergenic
1138458804 16:57135954-57135976 AAGGGGAAGGGGAAGGGAGAAGG + Intronic
1138459184 16:57138002-57138024 CAAGGTCAGGAGAAGGCAGAAGG - Intronic
1138594403 16:58022150-58022172 CAGGGAAAGGTGTGGGGAGAGGG + Intergenic
1139060950 16:63250708-63250730 AAGGGGAAGGAGGAGGGAAAGGG + Intergenic
1139144808 16:64310338-64310360 AGGGGTGAGGAAAAGGGAGAGGG + Intergenic
1139253049 16:65515207-65515229 CAGATGAAGGCGAAGGGAGATGG + Intergenic
1139485306 16:67252885-67252907 GAGCTTGAGGAGAAGGGAGAGGG - Intronic
1139946263 16:70644690-70644712 CAGGGTGAGGAGGAGGAGGAGGG + Intronic
1139963498 16:70731377-70731399 CAGGAAAAGGAGGAGAGAGAAGG + Intronic
1140017554 16:71202830-71202852 TAGGGGAGGGACAAGGGAGAGGG - Intronic
1140104434 16:71946811-71946833 GAGGGGGAGGAGGAGGGAGAAGG + Intronic
1140728915 16:77838643-77838665 GAGGGAAAGGAGGAGGGAAAGGG - Intronic
1141235253 16:82210067-82210089 AAGGGGAAGGGGAAGAGAGAGGG - Intergenic
1141590600 16:85066256-85066278 TGGGGAATGGAGAAGGGAGAGGG + Intronic
1141645531 16:85365382-85365404 CAGGGAAAAGAGAAGAGTGAAGG - Intergenic
1141805480 16:86338731-86338753 TGAGGTAAGGAGAAAGGAGATGG - Intergenic
1142160445 16:88554812-88554834 CAGCGGAAGGAGTAGGGAGGAGG - Intergenic
1142444021 16:90122249-90122271 CAGGGTAAGGGTAAGGGTTATGG + Intergenic
1203002619 16_KI270728v1_random:175746-175768 CAGGGTCAGGACAAGGGGTAGGG - Intergenic
1203068048 16_KI270728v1_random:1036895-1036917 CAGGGCATGGGGAAGGGAGACGG - Intergenic
1203123663 16_KI270728v1_random:1559071-1559093 CAGGGTCAGGACAAGGGGCAGGG - Intergenic
1203134225 16_KI270728v1_random:1712152-1712174 CAGGGTCAGGACAAGGGGTAGGG - Intergenic
1203152306 16_KI270728v1_random:1848360-1848382 CAGGGTCAGGACAAGGGGTAGGG + Intergenic
1142480474 17:215613-215635 CGGGGGCAGGAGAGGGGAGAAGG + Intronic
1142717024 17:1752787-1752809 CTGGGTAAGGAGGAGGGTGCGGG + Exonic
1143382821 17:6507120-6507142 CAGGGGAAGGAGAAGAAAGCTGG + Intronic
1143473997 17:7192678-7192700 TGGGGCAAGGAGAAGGGAGTGGG + Intronic
1143513451 17:7408028-7408050 AAGGGGAAGGAAATGGGAGAAGG - Intronic
1143881786 17:10035500-10035522 CAGTGCCAGGGGAAGGGAGATGG - Intronic
1143887500 17:10076104-10076126 GAGGGGAAGGAGAGGGGAAAGGG + Intronic
1144027884 17:11294427-11294449 CAGGATAAGGGGCAGGGAGAAGG + Intronic
1144244068 17:13345871-13345893 CAGGGTGAAGAGAAGGGGAATGG + Intergenic
1144362425 17:14507951-14507973 AAGGGTCGGGGGAAGGGAGAAGG + Intergenic
1144398517 17:14870468-14870490 TAGGCTAAGGAGGAGGGAGGGGG + Intergenic
1144415453 17:15042279-15042301 CAGGACATGGAGCAGGGAGAAGG - Intergenic
1144732608 17:17537305-17537327 CAGGGCAAGGGGAAGGCAAAGGG - Intronic
1145157543 17:20553198-20553220 CAGGGTAAGGGGAAGAAACAGGG + Intergenic
1145312615 17:21708747-21708769 CAGGGGAAGGATAGGGGAGAGGG + Intergenic
1145686832 17:26677543-26677565 CAGGGTAATTAGGAAGGAGAAGG + Intergenic
1145839613 17:27983568-27983590 CAGGTAAAGGAGAAGGCACAGGG + Intergenic
1145841176 17:27996181-27996203 CAGGGTCAGGAGCAGGTAGAAGG + Intergenic
1145843506 17:28017070-28017092 AAGTGTAAGGAGTAAGGAGATGG - Intergenic
1146296361 17:31653660-31653682 CAGGATACGGAGAGGGGAGAGGG - Intergenic
1147167919 17:38603189-38603211 CAGGGAAGGGAGGGGGGAGAGGG + Intronic
1147638413 17:41978471-41978493 GGGAGTAAGGAGAATGGAGATGG - Intronic
1147660117 17:42112883-42112905 CAGGTTAAGGTGAAGGCAGGAGG + Intergenic
1147689933 17:42308792-42308814 CAGGGGTGGGAGCAGGGAGAGGG + Intronic
1147710517 17:42460382-42460404 CATTGTCAGTAGAAGGGAGAAGG + Intronic
1147788770 17:42999548-42999570 CAGTCTCAGGAGATGGGAGAGGG - Intronic
1147981933 17:44280157-44280179 CAGGGTCAGGGGAAGGAAGAGGG - Intergenic
1148282641 17:46361155-46361177 AAGAGGAAAGAGAAGGGAGAGGG - Intronic
1148304859 17:46579080-46579102 AAGAGGAAAGAGAAGGGAGAGGG - Intronic
1148319293 17:46736486-46736508 CAGGGTAAGGAGTAGAGGGAGGG - Intronic
1148475948 17:47928665-47928687 AGGGGTGAGGTGAAGGGAGAGGG - Exonic
1148557408 17:48586752-48586774 GAGGGATAGGAGAAAGGAGAAGG + Intronic
1149019684 17:51948599-51948621 CAGAATAAGGAGAAGGGACTGGG - Intronic
1149132174 17:53316122-53316144 CAGGGGAGTCAGAAGGGAGATGG + Intergenic
1149546868 17:57510303-57510325 CAGGGTAGGAAGAAACGAGAGGG - Intronic
1149556713 17:57578561-57578583 GAGGGGAAGGGGACGGGAGAAGG + Intronic
1149752424 17:59158780-59158802 GATGGTAAGGAGAAGAGACAGGG + Intronic
1150266748 17:63837218-63837240 CAGGTTAAAGAGGAGGAAGATGG - Exonic
1150282092 17:63934658-63934680 CAGGGTCGGGCGAAGGGACAAGG + Intergenic
1150510813 17:65751051-65751073 AGGGGCAAGGAAAAGGGAGAGGG + Intronic
1150551087 17:66210905-66210927 AAGGGTGAGGAGAAGGAAGGTGG + Intergenic
1150628598 17:66859816-66859838 GAGGAGAAGGAGGAGGGAGAGGG - Intronic
1150696302 17:67408583-67408605 GAGGGAAAGGAAAAGGGAAAGGG - Intronic
1151218995 17:72597854-72597876 CAGGGTAGGGAGGGGGCAGAAGG - Intergenic
1151483654 17:74385147-74385169 CAGGGGAAGGAAAAGGAAAAGGG + Intergenic
1151497460 17:74467205-74467227 CAGGGTACGGAGGAGGGGGTGGG + Intronic
1151820345 17:76493586-76493608 CAGAGTTAGCAGAGGGGAGAGGG + Intronic
1151837572 17:76593317-76593339 CAAGGTATGGGGAAGGGACACGG - Intergenic
1151920388 17:77150382-77150404 CAGGGTATCTGGAAGGGAGAGGG - Intronic
1152008496 17:77696846-77696868 AAGGAGGAGGAGAAGGGAGAGGG - Intergenic
1152012522 17:77727160-77727182 AAGGGCAAGGAGAAGGGCGGGGG - Intergenic
1152084609 17:78210367-78210389 GAAGGTAAGGAGAAAGGAGGTGG + Intergenic
1152098402 17:78286537-78286559 CAAGGCAAGGAGAAGCCAGAGGG - Intergenic
1152268846 17:79312000-79312022 AAGGGGGAGGAGAAGGGAGAGGG - Intronic
1152302032 17:79500640-79500662 CGGGAAAAGGAGAAGGGGGATGG - Intronic
1152337590 17:79707230-79707252 CAGGGGAGGAAGAAGGGAGGAGG - Intergenic
1152476676 17:80522883-80522905 CAGGGGAGGGAGTAGGGAGTGGG + Intergenic
1152609221 17:81307449-81307471 AAGGGGAAGGGGAAGGGGGAGGG - Intergenic
1152609255 17:81307532-81307554 AAGGGGAAGGGGAAGGGGGACGG - Intergenic
1152840066 17:82561626-82561648 CGGGGAAAGGAGAAGGGCGAGGG + Intronic
1152960026 18:74031-74053 AAGGGGAAGGGGAAGGGAGAAGG + Intergenic
1153096981 18:1418286-1418308 CAGAGAAATGAGAAGGGAGCTGG + Intergenic
1153520912 18:5953174-5953196 CAGGAGAAGGGGAAGGGAGCTGG + Intergenic
1153711269 18:7802089-7802111 CAGAGAAGGGAGAGGGGAGAAGG - Intronic
1153861656 18:9216253-9216275 TAGGCTGAAGAGAAGGGAGAAGG - Intronic
1155936778 18:31762862-31762884 TAAGGAAAGGAGAAGGAAGAAGG + Intergenic
1156354009 18:36325706-36325728 CAGAGTAAGAAGAAAAGAGAGGG - Intronic
1156500357 18:37553778-37553800 CAGGGTAAGGGGTAGGGTGCGGG + Intronic
1156675664 18:39524712-39524734 CTGAGTAAGGGGAGGGGAGAAGG - Intergenic
1156791755 18:40984096-40984118 CAGGGGGAGGAGGAGGAAGAGGG - Intergenic
1156892531 18:42206361-42206383 CAGGGTGGGGAGAAGGGGGAGGG - Intergenic
1157237605 18:45979188-45979210 AAGAAGAAGGAGAAGGGAGAGGG - Intergenic
1157331909 18:46710467-46710489 AAGGGGAAGGGGAAGGGAGAAGG - Intronic
1157422681 18:47559574-47559596 AAGGGGAAGGAGAAAGGGGAAGG - Intergenic
1157481844 18:48060227-48060249 CAGGGGAAGCAGAGGGGAGAAGG + Intronic
1157545709 18:48545090-48545112 CCAGGAAAGGAGATGGGAGACGG + Intronic
1157570041 18:48706137-48706159 CAGGGCAAGGGGATGAGAGAGGG - Intronic
1157796641 18:50580979-50581001 CTGGGTAAGCAGAAGGTGGAAGG - Intronic
1157852166 18:51065311-51065333 AAGGGTAAAGGGAGGGGAGATGG - Intronic
1157916359 18:51667544-51667566 CAGGACACGGGGAAGGGAGAAGG + Intergenic
1158288533 18:55912709-55912731 CAGAGAAAGGAGAAAGGAAAGGG - Intergenic
1158859699 18:61580434-61580456 CAGGGGAAGGGGAAAGGAGAAGG - Intergenic
1159001976 18:62982499-62982521 CAGGGTAAGTATTAGGGAGAAGG + Intergenic
1159189648 18:65025200-65025222 CATAGTTAGGAGAAGGGAGAAGG - Intergenic
1159279324 18:66265014-66265036 CTGGTTTAGGAGAAGGGAAAAGG - Intergenic
1159463715 18:68752407-68752429 CAGGGAAAGGGGAAGGGAAAAGG + Intronic
1159664398 18:71140298-71140320 CAGTGTAAGGAGCATTGAGAAGG - Intergenic
1159964064 18:74579170-74579192 AAGGAAAGGGAGAAGGGAGAAGG - Intronic
1159983261 18:74811874-74811896 TGGGGTAAGGGGAAGGGGGAGGG + Intronic
1160002047 18:75033864-75033886 CAGGGAAAGGAGAAGGGAAGAGG - Intronic
1160464726 18:79067129-79067151 GAGGGTAAGGAGACAGGAGACGG + Intergenic
1160535524 18:79589551-79589573 CGGGGGAGGGAGAAGGGAGATGG + Intergenic
1160736594 19:665430-665452 CAGGGGAAGGAGAGGGGACTTGG - Intergenic
1160794816 19:940440-940462 CAGGGTTTGGAGCTGGGAGAAGG + Intronic
1160939182 19:1612154-1612176 CTGGGTGTGGGGAAGGGAGAGGG + Intronic
1160965775 19:1746310-1746332 GAGGGAGAGGAGGAGGGAGATGG + Intergenic
1161330985 19:3687770-3687792 CCCGGCAGGGAGAAGGGAGAAGG - Intronic
1161415776 19:4145593-4145615 GAGGGGAAGGAGAAGAGGGAAGG + Intergenic
1161620358 19:5293922-5293944 GAGGGAGAGGAGGAGGGAGAGGG + Intronic
1162031548 19:7919664-7919686 CCGGGTAAGGAGAGGAGGGAGGG - Intergenic
1162032841 19:7924902-7924924 CAGGGGAGGGAGGAGGGACAAGG + Exonic
1162089542 19:8269966-8269988 CAGGTGAAGGAAAAGGGAGGGGG + Intronic
1162601748 19:11675007-11675029 CAGGATCAGGAAAAGGCAGAGGG - Intergenic
1162632299 19:11938375-11938397 TGGGGTAGGGGGAAGGGAGAGGG - Intronic
1162686184 19:12386479-12386501 AAGGGGAAGGGGAAGGGAAAGGG + Intronic
1162686189 19:12386491-12386513 AAGGGAAAGGGGAAGGGAAAGGG + Intronic
1162690511 19:12426035-12426057 AAGGGGAAGGAGAAGGGGAAGGG + Intronic
1162853870 19:13453108-13453130 GAGGGTCAGGGGAAGTGAGAGGG - Intronic
1163171235 19:15532698-15532720 GAGGGGGAGGAGAAGGGAGGAGG - Intronic
1163318146 19:16555469-16555491 CAGGGTTAGGGGAAGGGATGTGG + Intronic
1163350974 19:16776993-16777015 GAGGGAAAGGAGAGGGAAGAGGG + Intronic
1163928040 19:20363892-20363914 CAGGGTAAGGGGCAGGGATGAGG - Intergenic
1163933823 19:20423906-20423928 CAGGGAAAGAAGAGGGAAGAAGG + Intergenic
1164056189 19:21623885-21623907 CAGGGAAAGGAAAGGGGACAAGG + Intergenic
1164453745 19:28389600-28389622 CAAGGCTGGGAGAAGGGAGAAGG + Intergenic
1164467314 19:28498695-28498717 CAGGGTCAGGATAGGGGAGCAGG + Intergenic
1164501441 19:28823631-28823653 GAAGGTAAGGAGAAGGAAGGAGG - Intergenic
1164592313 19:29513556-29513578 GAGGATAAGGAGGAAGGAGAGGG + Intergenic
1164592328 19:29513605-29513627 GAGGATAAGGAGGAAGGAGAGGG + Intergenic
1164680556 19:30131195-30131217 AAGGGGAAGGGGAAGGGAGAAGG - Intergenic
1164718701 19:30415250-30415272 CAGGAGGAGGAGAAGGGGGAGGG - Intronic
1164918094 19:32067955-32067977 AAGGGTAAGGAGAAGCAAGAAGG - Intergenic
1165140432 19:33696650-33696672 CACGGTCTGGGGAAGGGAGATGG - Intronic
1165312487 19:35037249-35037271 CTGTGTTAGGAGAAGGCAGATGG + Intronic
1165361297 19:35338477-35338499 CAGGGAACGGGGAAGGCAGATGG + Intronic
1165477861 19:36042074-36042096 GAGGGGAAGGGGAAGGGGGAGGG + Intronic
1166034965 19:40161432-40161454 AAGGGGAAGGGAAAGGGAGAGGG + Intergenic
1166034971 19:40161450-40161472 GAGGGAAAGGGAAAGGGAGAGGG + Intergenic
1166088808 19:40494882-40494904 CAGGGTAACTGGAAGGGTGAAGG - Exonic
1166137041 19:40783902-40783924 CCGGCTGTGGAGAAGGGAGAAGG - Exonic
1166140367 19:40802158-40802180 CAGGAGAAGCAGAAGGGGGAGGG + Intronic
1166203647 19:41254576-41254598 GAGGGTAAGGGGAGGGTAGAAGG + Intronic
1166325278 19:42046126-42046148 CAGGGCAGTGGGAAGGGAGACGG + Intronic
1166347964 19:42178047-42178069 GAGGAAAAGGAGAAGGGAGAGGG + Intronic
1166408948 19:42543487-42543509 CTGGGTCAGGAGCAGGGAGAGGG + Intronic
1166461734 19:42993663-42993685 CAGCGTCCGGAGAAGGGAGGTGG + Intronic
1166735136 19:45079485-45079507 TGGGGTGAGGAGAAGGGAGAAGG + Intronic
1166818310 19:45560498-45560520 CAGGAGAGAGAGAAGGGAGATGG - Intronic
1166881041 19:45930289-45930311 CAGAGGAAGGAGAATAGAGATGG - Intergenic
1166936917 19:46339637-46339659 CTGGGGGAGGAGAAGGCAGATGG - Exonic
1166954537 19:46454589-46454611 AAGGGGAAGGGGAAGGGATAGGG - Intergenic
1167067232 19:47195669-47195691 AAGGGGAAGGGGAAGGGAAAGGG - Intronic
1167284510 19:48591577-48591599 GATGGTGAGGAGAGGGGAGAAGG - Intronic
1167440676 19:49507018-49507040 GAGGGGAAGGAGAAGGGGAAGGG - Intronic
1167440683 19:49507036-49507058 GAGGGGAAGGGGAAGGGGGAGGG - Intronic
1167510001 19:49890903-49890925 CAGGGAAAGTAGCAGGGAGTGGG - Intronic
1167579069 19:50331484-50331506 AAGGGGAAGAAGAAGGGGGAGGG - Intronic
1167621631 19:50564012-50564034 CAAGGGAAGGAGAGTGGAGAGGG + Intronic
1168185323 19:54696661-54696683 CAGGGTGAGGAGGAGGGACCTGG - Intronic
1168229903 19:55023936-55023958 CAAGGGAAGGAGAAGGGTGTAGG + Intronic
1168287538 19:55342113-55342135 CAGGCTAAGGAGAGGGCCGAGGG - Intronic
1168581239 19:57557452-57557474 TAGGGTAATGAGTGGGGAGAGGG - Intronic
1168660642 19:58163162-58163184 CAGGGTCGGGAGAGGGGGGAGGG + Intergenic
925005651 2:441185-441207 CAGGGCAAGAAAACGGGAGAAGG - Intergenic
925542878 2:4985268-4985290 CAGGGGAAGAGGAAGGGATAGGG + Intergenic
925548288 2:5041746-5041768 AAGGGGAAGGAGAAGGGGAAGGG - Intergenic
925548320 2:5041826-5041848 AAGGGGAAGGGGAAGGGAAAGGG - Intergenic
925691683 2:6530727-6530749 CAGGGAAGGCAGAAGGAAGAAGG - Intergenic
925894284 2:8459410-8459432 CAGGATAAGCAGAGGGAAGAGGG - Intergenic
925927586 2:8681666-8681688 GAGGGGAAGGAGGAGGGAGAAGG - Intronic
926221776 2:10941048-10941070 CAGGTGAGGGAGCAGGGAGAGGG + Intergenic
926228179 2:10983247-10983269 CAGGGCAGGGAGGTGGGAGAGGG - Intergenic
926268670 2:11347848-11347870 CTGGGAAAGGTGAAGGGACATGG - Intronic
926327088 2:11794718-11794740 CAGGCAAAGGAGGACGGAGATGG - Intronic
926562860 2:14436471-14436493 GAGGAAAGGGAGAAGGGAGAGGG + Intergenic
926839921 2:17068727-17068749 CAGGGTTAGGAGGCGGGTGAAGG - Intergenic
927220632 2:20705291-20705313 GAGGATAAGGAGATGGGATAGGG - Intronic
927400890 2:22708390-22708412 CAGGAGAAGGAGAAGTGAGTGGG + Intergenic
927710812 2:25324746-25324768 ATGGATAAGGAGGAGGGAGAGGG + Intronic
928789350 2:34932456-34932478 GAGGCTATGGATAAGGGAGAAGG + Intergenic
929391025 2:41468847-41468869 AAGGTTAAGGATAAGGAAGAAGG - Intergenic
929481220 2:42310299-42310321 AAGGGAAAGGGGAAGGGAAAGGG - Intronic
929481229 2:42310323-42310345 AAGGGGAAGGAGAAGGGGAAGGG - Intronic
929587134 2:43123676-43123698 CAGGGTAGGGAGTAGGGCCAGGG + Intergenic
929745172 2:44649757-44649779 CAGGGTAAGGACAGGAGAGCAGG - Intronic
930083992 2:47480023-47480045 GGGGGAAGGGAGAAGGGAGAAGG - Intronic
930288555 2:49465433-49465455 AAGGGAAAGGGGAAGGGAAAGGG - Intergenic
930768413 2:55108397-55108419 CAGGAGAGGGAGAAGGGTGAAGG + Intronic
931502203 2:62881461-62881483 AAGGGGAAGGAGAAGGGGAAGGG + Intronic
931759325 2:65402587-65402609 GAGGGAAAGGAGAAGGGGGTAGG + Intronic
932171971 2:69565621-69565643 CAGGGAAGGGAGAAGAGAAATGG + Intronic
932172719 2:69572150-69572172 CAGGGTCAGGACTAGGGTGAGGG + Intronic
932239014 2:70142612-70142634 GAGGGGAAGGAGAACAGAGAGGG - Intergenic
932313856 2:70767211-70767233 CAGGGAGAGGAGAGGGAAGATGG + Intronic
932356334 2:71071386-71071408 CGGGGCAAGGTGAGGGGAGATGG - Intronic
932433104 2:71687042-71687064 CCGAGTAAGGAGAAGGCAGGGGG - Intergenic
932437467 2:71711087-71711109 CAGGGCAGGGAGAGGGCAGAAGG + Intergenic
932610419 2:73195186-73195208 CCGGGTAGGGAGAAGGGAGTAGG - Intergenic
932744545 2:74322094-74322116 CAGGCTAAGAACAAGGCAGAAGG + Intronic
932952444 2:76310055-76310077 CAGGGAGAGGGGTAGGGAGAAGG - Intergenic
933312806 2:80681939-80681961 CAGGGTAAAGAGAGGTGAGAAGG + Intergenic
933441107 2:82315400-82315422 GAGGGGGAGGAGAAGGAAGAGGG - Intergenic
933785589 2:85838698-85838720 TATGGTGAGGAGGAGGGAGATGG + Intergenic
933980978 2:87550514-87550536 AAGCTTCAGGAGAAGGGAGAAGG - Intergenic
934460617 2:94212330-94212352 CAGGGTCAGGACAAGGGGCAGGG - Intergenic
934851884 2:97706998-97707020 CCGGGATAGGAGAAGGGAGGAGG + Intergenic
935063291 2:99626539-99626561 GAGGGGAGGGAGAAGGGAGAAGG - Intronic
935277057 2:101484181-101484203 CTAGGGAAGGAGAAGGGGGAAGG - Intergenic
935308467 2:101759781-101759803 AAGGGAAGGGAGAAGGGAGGGGG - Intronic
935712830 2:105914237-105914259 CAGGGAAATGAGCAGGGAGGCGG - Intergenic
935725211 2:106018122-106018144 CAGGGCAAGGAGTGGGGAGTGGG + Intergenic
935786028 2:106549679-106549701 CAGGGCAAGGAGAGGTGGGAGGG + Intergenic
935918533 2:107985431-107985453 CAGTGTAAGAAAAGGGGAGATGG + Intergenic
935946139 2:108288525-108288547 CAGGCTAAGGAGGAAGGAAAAGG + Intergenic
936073949 2:109389909-109389931 CAGATTCAGGAGAAGGCAGATGG - Intronic
936312853 2:111400271-111400293 AAGCTTCAGGAGAAGGGAGAAGG + Intergenic
936674582 2:114700252-114700274 CAGGGGCAGGAGAAGGTGGAGGG - Intronic
936768938 2:115888336-115888358 CAGGGTGAGAGGAAAGGAGAAGG - Intergenic
936799065 2:116244165-116244187 CAGGGTGAGGAGAATAGAGCAGG + Intergenic
937178262 2:119964960-119964982 CAGGGTACCGAGCAAGGAGATGG + Intronic
937947309 2:127352684-127352706 GAGGGGGAGGAGGAGGGAGAGGG - Intronic
938043413 2:128095383-128095405 AAGGGGAAGGAGAAGGGGAAGGG - Intronic
938099708 2:128490439-128490461 CAGGCAAAGGAGAAGGAGGAAGG + Intergenic
938142023 2:128802405-128802427 AAAGGGAAGGGGAAGGGAGAAGG - Intergenic
938647023 2:133342229-133342251 CAGGGAAAGGAAATGGGGGAGGG + Intronic
938709829 2:133966656-133966678 TATGATAAGGAGAAGAGAGAGGG - Intergenic
938957673 2:136314498-136314520 AAGGGGAAGGGGAAGGGAAAGGG - Intergenic
938969559 2:136419837-136419859 CCAGGCAGGGAGAAGGGAGACGG - Intergenic
939353655 2:141072699-141072721 AAGGGTTAGGACAATGGAGAAGG - Intronic
939547617 2:143572414-143572436 CAGGGCAAGGGAAAGGGAGAGGG - Intronic
939783880 2:146484187-146484209 ATGAGTAGGGAGAAGGGAGAAGG + Intergenic
940219383 2:151335847-151335869 CAGGGAAAGGAGAAGGGCGGTGG - Intergenic
940413281 2:153390946-153390968 CAGGGTAAGGAGAATTGGGAGGG + Intergenic
940852484 2:158701699-158701721 GAGAGAAAGGAGAAGAGAGAGGG - Intergenic
940946407 2:159623083-159623105 GAGGGGAGGGAGAGGGGAGAGGG + Intergenic
941038196 2:160590516-160590538 GAGGGGAAGGAGAAGGGGGAGGG - Intergenic
941038267 2:160590680-160590702 GAGGGGAAGGGGAAGGGAGGAGG - Intergenic
941038276 2:160590699-160590721 GAGGGGAAGGGGAAGGGAGGAGG - Intergenic
941038285 2:160590718-160590740 GAGGGGAAGGGGAAGGGAGGAGG - Intergenic
941066055 2:160904158-160904180 TAGGGGATGGGGAAGGGAGATGG + Intergenic
941072062 2:160966678-160966700 CAGGGAGAGGAGCAGGGGGAAGG + Intergenic
941234024 2:162946629-162946651 AAGGGGAAGGAGAAGGGGAAGGG + Intergenic
941416149 2:165224102-165224124 CAGGGTATGAGGAAGAGAGATGG + Intergenic
941772240 2:169357635-169357657 CAAGGTAAGTAGAAAGTAGAAGG - Intronic
941784414 2:169481938-169481960 AATGGTAAGGACATGGGAGAAGG - Intronic
942312714 2:174670291-174670313 CAGGGAGAGGAAAAGGGAGGAGG - Intronic
942538211 2:176988023-176988045 CAGGGGATGCAGAAGAGAGAAGG - Intergenic
942567732 2:177283153-177283175 CAGGGTGAGGAAAGGGGAGTAGG + Intronic
942695463 2:178637797-178637819 CAGTGTAGGGAAAAGGGAAATGG + Intronic
943101041 2:183486900-183486922 CAGGGTCCAGAGAAGGCAGAGGG + Intergenic
943253722 2:185566064-185566086 TAGGATGAGGAGAAAGGAGAAGG + Intergenic
943287899 2:186028086-186028108 CAAGGGAAGGAGAAGTGAGTAGG + Intergenic
943547424 2:189298165-189298187 GAGGGTAGGGAAAATGGAGAGGG + Intergenic
943793681 2:191965232-191965254 CAGGGGAAGGAAGTGGGAGAAGG - Intronic
944162501 2:196679320-196679342 CAGGGGAAGGAGGTGGAAGAAGG - Intronic
944973498 2:205021053-205021075 CAGAGAAAGGTGATGGGAGATGG + Intronic
945777569 2:214126184-214126206 CGGAGAAGGGAGAAGGGAGAAGG + Intronic
945823918 2:214697654-214697676 AAGGGAAAGGGGAAGGGAAATGG - Intergenic
945916435 2:215709342-215709364 CAGAGTAAGCAGTAGAGAGAAGG - Intergenic
946010503 2:216560166-216560188 GAGGGGAGGGGGAAGGGAGAAGG - Intronic
946355292 2:219180787-219180809 CAAGGAAAGAAGAAAGGAGAGGG - Intronic
946399375 2:219460669-219460691 GAGGGGGAGGAGAGGGGAGAGGG - Intronic
946519067 2:220446583-220446605 GAGGGAAAGGGGAAGGGGGAAGG - Intergenic
946531799 2:220578327-220578349 AAGGGAAAGGAGATGGGAGTTGG + Intergenic
946554946 2:220845938-220845960 AAGGGAAAGGAAAAGGGAAAGGG + Intergenic
946588250 2:221215083-221215105 TAGGGTTGGGGGAAGGGAGAAGG - Intergenic
946593977 2:221285521-221285543 CAGGGGAGAGAGAAGGGAGTTGG - Intergenic
946876842 2:224138004-224138026 GAGGGCAAAGAGAAGGAAGAGGG - Intergenic
946918660 2:224554071-224554093 AAGAGTGAGGAGAAGAGAGAAGG - Intronic
946931468 2:224675702-224675724 GAGAGCAAGGAGAAGGCAGAGGG + Intergenic
947205484 2:227657296-227657318 CAGCGTTTGGAGAAGGAAGAAGG + Intergenic
947391842 2:229647197-229647219 CAGGGTAAGAAGAGGTCAGAGGG + Intronic
947483042 2:230520800-230520822 TAGGGTCAGGAGAAGGAAGAGGG + Intronic
947756500 2:232569715-232569737 AAGGGAAAGCAGAAGGGAGAAGG - Intronic
947843148 2:233221759-233221781 CAGGCAGAGGAGATGGGAGAAGG - Intronic
948029057 2:234801421-234801443 CAGTTTGAGGAGAAGGGAGCAGG - Intergenic
948034487 2:234847154-234847176 CAGGGGATGGAGAGAGGAGAAGG + Intergenic
948091800 2:235301757-235301779 AAGGATAACGAGGAGGGAGAAGG - Intergenic
948331548 2:237170721-237170743 GAGGCTAAGGTGAACGGAGAAGG + Intergenic
948344335 2:237282673-237282695 AAGGGGAAGGAGAAGGGGAAGGG + Intergenic
948344349 2:237282703-237282725 AAGGGGAAGGAGAAGGGGAAGGG + Intergenic
948487892 2:238292362-238292384 CAGGGTGAGGCGAAGAAAGATGG - Intergenic
948568386 2:238900960-238900982 GGGGGGAAGGAGAAGGGATAGGG - Intronic
948692937 2:239718431-239718453 CAGGGCCAGGAGAAGGGAGATGG - Intergenic
948923806 2:241081385-241081407 GAGGAGAAGGAGGAGGGAGAGGG - Intronic
948928885 2:241117506-241117528 GAGTGTCAGGAGGAGGGAGAAGG + Intronic
1168904345 20:1391813-1391835 AAGGGGAAGGAGGAGGGGGAGGG + Intronic
1169129618 20:3159143-3159165 CACGGAAAGAAAAAGGGAGAAGG + Intronic
1169178628 20:3542567-3542589 AAGGGGAAGGAGAAAGGGGAAGG - Intronic
1169178635 20:3542586-3542608 AGGGGGAAGGGGAAGGGAGAAGG - Intronic
1169325253 20:4670551-4670573 CAGGATGAGGAGGAGGAAGAGGG + Intergenic
1169334931 20:4748385-4748407 TGGGGAAGGGAGAAGGGAGATGG + Intergenic
1169815797 20:9654801-9654823 CAGGGGAGGGAGAAGTTAGAGGG - Intronic
1169852782 20:10070678-10070700 CAGAGTAGGAAGAAGAGAGAGGG + Intergenic
1169867602 20:10218083-10218105 CGGGGGAAGGAGAAGGGAAGCGG - Intergenic
1169908083 20:10623786-10623808 CAGGCTGAGGAGCAGGGGGATGG - Exonic
1170140642 20:13122395-13122417 CAGGGTAAGGAGAGTGGAATTGG + Intronic
1170345031 20:15376292-15376314 CAGTGCAAGGAGAAGGAAGCAGG + Intronic
1170596033 20:17806634-17806656 CAGGGTAAGGAGGAGAAAGAAGG + Intergenic
1170631255 20:18067868-18067890 CATGGTAAGGAGAAATGAAAAGG - Intergenic
1170657748 20:18305607-18305629 CAGGGTGAGGGGCAGGGATAAGG - Intronic
1170810891 20:19673484-19673506 GATAGTAAGGAGAAGGCAGACGG - Intronic
1170944107 20:20874625-20874647 CAGGTAAAGGTGAAGGGAGGAGG + Intergenic
1171100129 20:22375028-22375050 GAGGGAAAGGAGAAGAGAAAAGG - Intergenic
1171183908 20:23111381-23111403 TGGGGTCAGGGGAAGGGAGATGG + Intergenic
1171257875 20:23704528-23704550 CAGGGGAAGGGAAAGGGAGTAGG + Intergenic
1171304269 20:24091899-24091921 CAGGGAAAGGAGAGGGAGGAGGG - Intergenic
1171474518 20:25397830-25397852 AAGGGAAAGGGGAAGGGGGAAGG + Intergenic
1171474528 20:25397849-25397871 AAGGGGGAGGGGAAGGGAGAGGG + Intergenic
1171801444 20:29623493-29623515 CAGGGCAATCAGAAAGGAGAAGG + Intergenic
1171941129 20:31330955-31330977 AAGGAGAAGGAGAAGGAAGAAGG + Intergenic
1172180432 20:33000236-33000258 CAGGGAGAGAAGAAGGGATAGGG - Intronic
1172292144 20:33784157-33784179 GAGGGAGAGGAGTAGGGAGAGGG - Intronic
1172292206 20:33784321-33784343 GATGGGAAGGAGGAGGGAGAAGG - Intronic
1172375738 20:34438451-34438473 CTGGGTAAGAAGAGGGGAAAAGG - Intronic
1172468061 20:35171869-35171891 CAGCCCAAGGAGAAGGGAAAAGG + Intergenic
1172765982 20:37351129-37351151 CAGAGCAAGGAGTAGGGAGATGG - Intronic
1172811258 20:37649945-37649967 AAGGAAAAGAAGAAGGGAGAAGG + Intergenic
1172962488 20:38808283-38808305 CTGGTTTAGGAGAAGGCAGAAGG + Intronic
1173522404 20:43709784-43709806 CGGGGGAAACAGAAGGGAGAGGG - Intronic
1173549815 20:43924863-43924885 CTGTGTGTGGAGAAGGGAGAGGG - Intronic
1173838154 20:46139125-46139147 CTGGGCAAAGAGGAGGGAGAGGG - Intergenic
1173929606 20:46807656-46807678 CAGGGGGAGGAGAAGGGAACAGG + Intergenic
1174004307 20:47398261-47398283 AAGGGAAAGGAAGAGGGAGAGGG + Intergenic
1174012862 20:47464667-47464689 CAGGGGAAGGAGAATGGAAAAGG - Intergenic
1174057111 20:47805750-47805772 CAGGGTCCAGAGAACGGAGAGGG + Intergenic
1174569145 20:51488773-51488795 CAGGATAGGGACAAGGGACAAGG - Intronic
1174709522 20:52690257-52690279 AAGGGGAAGGAGAAGGGGAAAGG - Intergenic
1175120155 20:56710808-56710830 GAGGGGAAGGAGGAGGGAAAGGG - Intergenic
1175120180 20:56710883-56710905 GAGGGGAAGGAGGAGGGAAAGGG - Intergenic
1175120206 20:56710958-56710980 GAGGGGAAGGAGGAGGGAAAGGG - Intergenic
1175128995 20:56775112-56775134 CAGGAGAAAGAGAAGGGGGAGGG - Intergenic
1175140451 20:56857025-56857047 AAGGGAAAGGAGAAGGGAGCGGG + Intergenic
1175190195 20:57206610-57206632 CAGGTGATGGAGAAGGGATAAGG + Intronic
1175401164 20:58700867-58700889 CAGGGGCAGGAGAAGGGGCAGGG + Intronic
1175539060 20:59736845-59736867 CAGGGAAGGCAGAGGGGAGAGGG + Intronic
1175601343 20:60276267-60276289 CAGGGTAGGGAGGAGGGAGCTGG - Intergenic
1175605467 20:60308767-60308789 CAGGTGGAGGGGAAGGGAGAAGG + Intergenic
1175871833 20:62212893-62212915 GGGGGTAAGGAGAGGGGGGATGG + Intergenic
1175871854 20:62212940-62212962 GGGGGTAAGGAGAGGGGGGATGG + Intergenic
1175941060 20:62537707-62537729 CAGGGAAGGGAGGAAGGAGAGGG + Intergenic
1175998074 20:62820211-62820233 CATGGCAGGGAGAAGGGGGATGG + Intronic
1176145707 20:63564523-63564545 CATGGTGAGGAACAGGGAGATGG + Exonic
1176270404 20:64233193-64233215 GAGGGATAGGGGAAGGGAGAGGG - Intronic
1176591740 21:8655371-8655393 CAGGGTCAGGACAAGGGGCAGGG - Intergenic
1176736624 21:10554881-10554903 CAGGGTAAGGACAATACAGAGGG - Intronic
1177058791 21:16343985-16344007 CAGCATAATGAGTAGGGAGAAGG + Intergenic
1177114866 21:17073349-17073371 AAGGGGAAGGAGAAGGGGAAGGG + Intergenic
1177177128 21:17712299-17712321 GAGGAGGAGGAGAAGGGAGAAGG - Intergenic
1177370420 21:20196636-20196658 CAGGGTAGGGGGAAGAGAAAGGG + Intergenic
1177646301 21:23903683-23903705 AACAGCAAGGAGAAGGGAGAGGG + Intergenic
1178319866 21:31597207-31597229 GAGGGGAAGGGGAAGGGAGAAGG - Intergenic
1178594457 21:33940393-33940415 CAGGGTCCGGGGAAGGGAAAAGG + Intergenic
1178965807 21:37116332-37116354 GAGGGAAAGGAGATTGGAGAGGG + Intronic
1179084815 21:38207422-38207444 AAGGGAGAGGAGAAGGGAGAAGG - Intronic
1179111182 21:38446878-38446900 GGGGGCAAGGAGAAGGCAGATGG - Intronic
1179291217 21:40019926-40019948 AAGGGAAAGAAGGAGGGAGAAGG - Intronic
1179406050 21:41126804-41126826 AAGGGTAGGGGGAAGGGAGGGGG - Intergenic
1180274587 22:10632483-10632505 CAGGGTCAGGACAAGGGGCAGGG - Intergenic
1180549070 22:16527427-16527449 CAGGGTCAGGACAAGGGGCAGGG - Intergenic
1180557020 22:16586265-16586287 TAGGGTAAGAATGAGGGAGATGG - Intergenic
1181019959 22:20094547-20094569 CAGGGTCAGGAGAGGACAGAAGG - Intronic
1181034821 22:20164820-20164842 CAGGGGCAGGAGAAGGGGCAGGG + Intergenic
1181180568 22:21065251-21065273 GAAGGTAAATAGAAGGGAGAAGG - Intergenic
1181355630 22:22294425-22294447 CAGGGTCAGGACAAGGGGCAGGG + Intergenic
1181508997 22:23380539-23380561 CAGGGGCAGGAGGAGGGACAGGG - Intergenic
1181625155 22:24118160-24118182 CAGGGGAGGGAGAAGGGCAATGG + Intronic
1181823468 22:25494151-25494173 CTGGATGAGGAGTAGGGAGAAGG - Intergenic
1181899711 22:26143497-26143519 AAGGGTATGGATAAGGGAAAGGG - Intergenic
1182018860 22:27064032-27064054 CAGGGTGAGAAGAAGAAAGAAGG + Intergenic
1182459961 22:30476509-30476531 CTGGGCAAGGGGAGGGGAGATGG - Intergenic
1182779026 22:32852663-32852685 CAGAGTTAGCAGACGGGAGAAGG - Intronic
1182859875 22:33549996-33550018 CAGGGTCAGGGGATGGGGGAGGG + Intronic
1183023696 22:35047963-35047985 CAGGGTGAGGAAAAGGAAGAGGG + Intergenic
1183153082 22:36053500-36053522 AAGGGAAGGGGGAAGGGAGAAGG - Intergenic
1183153116 22:36053602-36053624 ATGGGAAGGGAGAAGGGAGAAGG - Intergenic
1183153165 22:36053761-36053783 GAGGGAAGGGGGAAGGGAGAAGG - Intergenic
1183153178 22:36053792-36053814 GAGGGAAGGGGGAAGGGAGAAGG - Intergenic
1183161248 22:36114788-36114810 CAGGTGCAGCAGAAGGGAGACGG - Intergenic
1183226748 22:36555613-36555635 AAGGGCAAGGAGAAGGAAAAGGG - Intergenic
1183249007 22:36715244-36715266 ATGGGTACGGAGATGGGAGAGGG - Intergenic
1183460508 22:37947220-37947242 CTGGGGGAGGACAAGGGAGAGGG - Intronic
1183858717 22:40653616-40653638 CAGGGTAGGGAGCAGAGAGTAGG + Intergenic
1183952558 22:41359715-41359737 CAGGGTAAGGAAGAGAGAGTGGG + Exonic
1184341158 22:43886633-43886655 CAGGGCCAGGGGAAGGCAGAAGG - Intronic
1184421437 22:44384868-44384890 GAGGGGCAGGAGAGGGGAGATGG + Intergenic
1184509013 22:44921212-44921234 CAGGGTAAGGAGAAGGGAGATGG + Intronic
1184652596 22:45925962-45925984 CAGGGGAGGGAGGAGGGGGAGGG - Intronic
1184912374 22:47544825-47544847 AAGGGTTGAGAGAAGGGAGATGG + Intergenic
949127947 3:469091-469113 GAGGAAAAGGAGAAGGGGGACGG - Intergenic
949302894 3:2605343-2605365 CAGTGTTAGGAGGTGGGAGAAGG + Intronic
949441471 3:4085641-4085663 TAGGTGAAGGAGAAGGGATATGG - Intronic
949707362 3:6834401-6834423 GAGGGGGAGGAGGAGGGAGAGGG + Intronic
949833610 3:8244109-8244131 CAGGAAAAGGGGAAGGGAGAAGG + Intergenic
949914176 3:8944593-8944615 GAGGGGAAGGAGAAAGGAGGAGG + Intronic
950190713 3:10974399-10974421 CAGGGAAAGCAGGAAGGAGAAGG - Intergenic
950569591 3:13791897-13791919 CAGGGCACGGAGAAGGGTGAAGG - Intergenic
950723657 3:14901942-14901964 CAGGGTTCAGAGAAGGGAGGTGG + Intronic
950797479 3:15521795-15521817 GGGGGTGAGGAGGAGGGAGAGGG - Intergenic
951072085 3:18341308-18341330 GAGAGCTAGGAGAAGGGAGAGGG - Intronic
951537303 3:23751582-23751604 CAGGGGAGGGAGATGGGAGGGGG - Intergenic
951795925 3:26538228-26538250 AAAGGGAAGGAGAAGGGGGAGGG + Intergenic
951881367 3:27484060-27484082 CCGGGTAACGAGCAGGGTGAGGG - Intronic
952003059 3:28808976-28808998 CAGGGAAATGATATGGGAGAAGG - Intergenic
952213328 3:31251330-31251352 GAGGATAAAGAGAAGGAAGAAGG + Intergenic
952273778 3:31857846-31857868 GAGGGAAAGAAGGAGGGAGAGGG + Intronic
952447705 3:33398660-33398682 CAGGATAAGGAAAAGGCAGAAGG + Intronic
952569238 3:34694478-34694500 GAGGGGAGGGGGAAGGGAGAAGG - Intergenic
953142043 3:40238145-40238167 GAAGGGAAGGAGAAGGAAGAAGG - Intronic
953462939 3:43095963-43095985 CAGGCTATGGGGCAGGGAGAAGG + Intronic
953497334 3:43399619-43399641 GAGGGCAAGGAGAAGAGAGATGG - Intronic
953510807 3:43537018-43537040 CAGAGTAAGGTGAAAGGTGAGGG - Intronic
953876550 3:46670006-46670028 CAGGGCAAAGCGTAGGGAGAGGG - Exonic
954130727 3:48559375-48559397 GAGGGTCAGGAAGAGGGAGAAGG + Intronic
954263367 3:49455836-49455858 CAGGGTAAGGAATTGGGAGGAGG - Intergenic
954272173 3:49518544-49518566 CAGGGTCAGGAGAATAAAGAAGG + Intronic
954367376 3:50153892-50153914 GAGGGTAAAGAGCAGGAAGAAGG + Intergenic
954689805 3:52389652-52389674 CAGGGTAGGAAGGAGGCAGAAGG - Intronic
954935751 3:54325003-54325025 GAGGGGAGGGAGAAGGCAGAAGG + Intronic
956223749 3:66933344-66933366 CAAGGTAAGCAGAAGGGACAAGG - Intergenic
956689627 3:71863860-71863882 CAGGGTCATCAGAAGGCAGAGGG + Intergenic
957311556 3:78526151-78526173 CTGGGGAAGGAGAGGGGAGGAGG - Intergenic
957540129 3:81557501-81557523 GAAAGAAAGGAGAAGGGAGAAGG + Intronic
957928568 3:86847283-86847305 CAGGAAAGGGAGAAGGAAGAGGG - Intergenic
958047445 3:88303172-88303194 GAGAGAAGGGAGAAGGGAGAAGG - Intergenic
958848895 3:99298201-99298223 TAGGGTAGGGAGAGGGGTGAGGG + Intergenic
959112841 3:102142663-102142685 CAGGGAAGGGAGAGTGGAGAGGG + Intronic
959563864 3:107814627-107814649 AAGGGTATGGCAAAGGGAGAAGG - Intergenic
959695184 3:109241534-109241556 CAGGGGAAGAAGAAGGGTGGGGG + Intergenic
960254688 3:115499353-115499375 CAGGGCAAGGAAAAGGCAGTGGG + Intergenic
960343608 3:116505557-116505579 CAGGGTAGGGGGAGGGGGGACGG - Intronic
960529921 3:118753013-118753035 GAGGAGAAGGAGAAAGGAGAAGG + Intergenic
960611326 3:119557568-119557590 CAGGGTTAAGAGAAAGGACATGG - Intronic
960628323 3:119702973-119702995 CGGGGCAAGGAGGAGGGAGGAGG - Intergenic
960706367 3:120485934-120485956 CTGGGGCAGGAGAAGGGATAAGG - Intergenic
960822901 3:121753026-121753048 CAGGGGAAGAAGAAGAGGGAAGG + Intergenic
960856522 3:122107706-122107728 CAGGGTATGGAGCAAGGAGTTGG - Intronic
960972669 3:123150706-123150728 CAGTGTCTGGAGAAGGAAGAGGG - Intronic
961002827 3:123385372-123385394 GAGGGGATGGAGAAAGGAGAGGG + Intronic
961097719 3:124172239-124172261 CAAGGTAAGGCGAAGGGGAATGG - Intronic
961105202 3:124234940-124234962 CAAGGTAAGGGGAAGGGGAATGG + Exonic
961406252 3:126681828-126681850 CAAGGTGAGGAGCAAGGAGAGGG - Intergenic
961660274 3:128464942-128464964 GAGGGAAGGGAGAAGGGGGAAGG - Intronic
961703086 3:128762265-128762287 AAGGCTAAGGAGGAGGGACAAGG + Intronic
961861455 3:129919504-129919526 GAAGGTAAGGAAAAGGGAAAGGG + Intergenic
962064171 3:131961862-131961884 CTGAGTAGGGAAAAGGGAGAAGG - Intronic
962202708 3:133414406-133414428 AGGGGTAAGTAGAGGGGAGAGGG - Intronic
962202743 3:133414526-133414548 AGGGGTGAGTAGAAGGGAGAGGG - Intronic
962203019 3:133415625-133415647 ACGGGTAAGTAGAGGGGAGAGGG - Intronic
962203054 3:133415766-133415788 AAGGGTAAGTGGAGGGGAGATGG - Intronic
962203077 3:133415850-133415872 GAGGGTGAGTAGAGGGGAGAGGG - Intronic
962203108 3:133415990-133416012 CGGGGTGAATAGAAGGGAGAGGG - Intronic
962203383 3:133417114-133417136 AGGGGTAAGTAGAGGGGAGAAGG - Intronic
962203425 3:133417279-133417301 AGGGGTGAGCAGAAGGGAGAGGG - Intronic
962203467 3:133417420-133417442 GAGGGTGAGTAGAAGGGAGAGGG - Intronic
962306868 3:134295339-134295361 CAGGTTAAGGATGAGGGATAAGG + Intergenic
962405238 3:135094659-135094681 GAGGGAAAGCAGGAGGGAGAAGG - Intronic
962732758 3:138298947-138298969 CAAGGTAAGGCGAAGAGAGTAGG + Intronic
962826284 3:139103063-139103085 CAAGGTCAGGTGGAGGGAGATGG - Intronic
963143257 3:141965541-141965563 GAGGGGAAGGGGAAGGGGGAGGG + Intronic
963604085 3:147399248-147399270 CAGGGGAAGGATCAGAGAGATGG - Intronic
964762000 3:160143026-160143048 CAGGGGCTGGAGAAGGAAGAGGG + Intergenic
965319394 3:167233187-167233209 GAGGGAAAGGGGAAGAGAGAAGG - Intergenic
965369818 3:167847998-167848020 GAGGGTTAGGAGAGGGGAGATGG - Intergenic
966099187 3:176245396-176245418 CAGAAGGAGGAGAAGGGAGATGG + Intergenic
966314508 3:178630684-178630706 CAAGAAAAGGAGAAGGGAGGAGG - Intronic
966555205 3:181251364-181251386 AAGGGGAAGGGGAAGGGAGAAGG - Intergenic
966799320 3:183748209-183748231 AAGGGGAAAGGGAAGGGAGAAGG - Intronic
966954742 3:184864126-184864148 AAGGAGAAGGAGAAGGGAGGGGG + Intronic
967276925 3:187784865-187784887 TGGGGTGAGGAGAAGGGAGATGG + Intergenic
967332817 3:188308953-188308975 AGGAGAAAGGAGAAGGGAGAAGG - Intronic
967332819 3:188308960-188308982 GAGGAGAAGGAGAAAGGAGAAGG - Intronic
967874249 3:194256032-194256054 CAGTGTAAGGAGGAGTGTGAGGG - Intergenic
967947897 3:194818587-194818609 GTGGGTGAGGAGAGGGGAGAGGG - Intergenic
967962822 3:194939406-194939428 CAGGGGAGGTAGAGGGGAGACGG + Intergenic
967973742 3:195018763-195018785 CAAGGTAATTAGAAGGTAGAAGG + Intergenic
968075980 3:195816356-195816378 CTGCGTAAGGAGAAGGGCGGAGG - Intergenic
968076006 3:195816448-195816470 CCTGGTAAGGAGAAGGGCGGAGG - Intergenic
968076068 3:195816688-195816710 CCTGGTAAGGAGAAGGGCGGAGG - Intergenic
968076080 3:195816736-195816758 CCTGGTAAGGAGAAGGGCGGAGG - Intergenic
968434323 4:576784-576806 CTGGGTAAGGAGAAGGGGAAAGG + Intergenic
968652499 4:1765842-1765864 CAGAGTGGGGAGAAGGGAGGAGG + Intergenic
968857502 4:3138136-3138158 AAGGGAAAGGGAAAGGGAGAGGG - Intronic
969088849 4:4677336-4677358 GAAGGTAAGGAGGAGGGGGAAGG - Intergenic
969275237 4:6130198-6130220 CAGGGGAAGAAGGAGGGAGCGGG + Intronic
969352552 4:6606167-6606189 GAGGGAGAGAAGAAGGGAGAGGG + Intronic
969397674 4:6933272-6933294 AAGGGGAAGGGGAAGGGGGAGGG - Intronic
969475059 4:7417670-7417692 CAGGGTCAGGGGAAGTGATAGGG - Intronic
969659187 4:8516455-8516477 CAGGGAATGGTGAAGGGTGAGGG - Intergenic
969660067 4:8522237-8522259 CAGGGCAAGGAGCAGGGCAAGGG - Intergenic
969707442 4:8819594-8819616 CAGGGGAAGGGGAAGGGAGTAGG + Intergenic
970645300 4:18113838-18113860 AAGGGGAAGGGGAAGGGAAAGGG + Intergenic
970645305 4:18113850-18113872 AAGGGAAAGGGGAAGGGAAAGGG + Intergenic
970652890 4:18197954-18197976 CTGGGAAAAGAGAATGGAGAGGG - Intergenic
970803943 4:20007727-20007749 CAGGGAAAGGAGGAATGAGAAGG + Intergenic
970817033 4:20168788-20168810 GGGGGTAAGGAAGAGGGAGAGGG - Intergenic
970924868 4:21439667-21439689 CAAAGCAAGAAGAAGGGAGAAGG - Intronic
970954465 4:21794123-21794145 CGGGGTAGGGGGAGGGGAGAGGG + Intronic
971570946 4:28210010-28210032 GAGGGGAAGGAGGAGGAAGAGGG - Intergenic
971636652 4:29068730-29068752 CAAGATAAGGCTAAGGGAGAAGG - Intergenic
972284049 4:37631323-37631345 CAGGGTGAGGAGAAGGTACTTGG - Intronic
972589867 4:40474870-40474892 CATCATAATGAGAAGGGAGAAGG + Intronic
972770202 4:42190562-42190584 TAAGGTAAGGAAAAAGGAGAAGG - Intergenic
973667460 4:53177399-53177421 GTGGGTTAGGAGAAGGGAGAGGG + Intronic
973765973 4:54163242-54163264 GAGGGGAAGGAGAAGGAAGTGGG - Intronic
973772119 4:54216807-54216829 TAGGGACAGGAGCAGGGAGAGGG - Intronic
973878728 4:55247521-55247543 CTGGGTAAGGAATAGGGAAAAGG + Intergenic
973956681 4:56069674-56069696 CAGGGAAAGAAGAAAGGATAGGG + Intergenic
973963663 4:56137923-56137945 AAGGGTAAGGATAAGGAAGTGGG + Intergenic
974214951 4:58832985-58833007 AAGGGGAAGGGGAAGGGAAAGGG - Intergenic
974753775 4:66176790-66176812 AAGGAGAAGGAGAAGGGAAAGGG + Intergenic
975109211 4:70605207-70605229 AAGAGTCAGGAGAAAGGAGAAGG + Intronic
975207816 4:71664568-71664590 GTTAGTAAGGAGAAGGGAGAAGG + Intergenic
975270381 4:72425475-72425497 TGGGGTAAGGGGAAGGGGGAGGG - Intronic
975442029 4:74421808-74421830 GAGGGGAAGGGGAAGGAAGATGG + Intergenic
975456715 4:74599582-74599604 CAGGGGTGGGAGGAGGGAGAGGG - Intergenic
975712940 4:77178660-77178682 CTGTGGAAGGAGAAGGAAGAGGG + Intronic
976483320 4:85570259-85570281 AAGGGGAAGGGGAAGGGAGTGGG - Intronic
976626972 4:87195599-87195621 AAGGGTAGAGAGAAGGCAGAAGG + Exonic
976700293 4:87962639-87962661 CAGGGTAGGGATGAGGGTGAAGG + Intergenic
977125310 4:93158437-93158459 CTGGGGAAAGAGAAAGGAGAAGG + Intronic
977756949 4:100682782-100682804 CAGGGGAGCCAGAAGGGAGATGG - Intronic
978313944 4:107415151-107415173 TAGGGTAAGGGGAAGGGGAAGGG + Intergenic
978665653 4:111178101-111178123 AAGGGAGAGGGGAAGGGAGAGGG - Intergenic
979192085 4:117874269-117874291 CAGGAAGAGGAGAAGGGAGGAGG - Intergenic
979249671 4:118553099-118553121 CAGAGTAGGGAGTTGGGAGAAGG - Intergenic
979755751 4:124338507-124338529 CAAGCTAAGGAGAAGGGAAAGGG + Intergenic
980320530 4:131267048-131267070 CAGGTTCAGGAAAAGGGAGTGGG + Intergenic
980526331 4:133994717-133994739 CAGGGAAAGGAAACGGGAAAGGG - Intergenic
980893470 4:138838786-138838808 CAGGGTAAGGAGAGGGGCGCGGG - Intergenic
981391871 4:144200308-144200330 CAGGGTTGGGGGCAGGGAGAGGG + Intergenic
981406450 4:144375280-144375302 GAGGTTAAGGAGGAGGGAGATGG - Intergenic
981521145 4:145663643-145663665 CAGTGAATGGAGAAGGGAGTGGG + Intergenic
981922227 4:150097892-150097914 CAGGGAAAGGAGAATGAATATGG + Intronic
983034793 4:162850235-162850257 CAGGACCAGAAGAAGGGAGAGGG + Intergenic
983900388 4:173127330-173127352 CAGGGAAAGGGAAAGGGAAAGGG - Intergenic
984070344 4:175103411-175103433 GAGGGGAGGGAGGAGGGAGAAGG + Intergenic
984070365 4:175103464-175103486 GAGGGGAGGGAGGAGGGAGAAGG + Intergenic
984261249 4:177445337-177445359 CGGGGGAACCAGAAGGGAGACGG - Intergenic
984858986 4:184219984-184220006 AAGGGTAAGGGGAAGGGGAAGGG + Intronic
984911247 4:184676418-184676440 AAGGGAAGGGGGAAGGGAGAAGG - Intronic
984911318 4:184676639-184676661 GAAGGGAAGGAGAAGGGAGGGGG - Intronic
984911463 4:184676992-184677014 AAGGGAAGGGGGAAGGGAGAAGG - Intronic
984911473 4:184677016-184677038 AAGGGAAGGGGGAAGGGAGAAGG - Intronic
984911483 4:184677040-184677062 AAGGGGAAGGGGAGGGGAGAAGG - Intronic
984966533 4:185144707-185144729 CAGGGTAGAGAGAAGGGAAGAGG - Intronic
985190666 4:187369328-187369350 GAGGGTAAGGAAAAGGGGGTGGG + Intergenic
985277930 4:188256488-188256510 CAGGGTAAGGGTAAGAGAGATGG + Intergenic
985321860 4:188721641-188721663 GGGGGAAGGGAGAAGGGAGAAGG + Intergenic
985657006 5:1137526-1137548 CAGGTTGAGGAGGAGGGGGAAGG - Intergenic
985690136 5:1304316-1304338 AAGGAGAAGGAGAAGGGAGAAGG - Intergenic
986006266 5:3671699-3671721 CAGGGTTAGGAGGTGGGAGTCGG - Intergenic
986129375 5:4912731-4912753 GAGAGAAAGGAGAAGGAAGAAGG + Intergenic
986183621 5:5416959-5416981 GAGGGTGAGGAGGAGGGAGAGGG + Intergenic
986695815 5:10353750-10353772 GAGAGGAAGGAGAGGGGAGAGGG - Exonic
986723448 5:10577086-10577108 AAGGGGAAGGGGAAGGGAAAGGG - Intronic
986723456 5:10577104-10577126 AAGGGGAAGGGGAAGGGAAAGGG - Intronic
986782718 5:11081816-11081838 CAGGGGCTGGAGAAGGGGGATGG + Intronic
987122933 5:14784635-14784657 CAGAGTAAGGAGCAGGGTCATGG + Intronic
987195533 5:15522229-15522251 GAGGATAAGGAAAAGGGAGAAGG - Intronic
987397988 5:17443576-17443598 CAGGGGAGACAGAAGGGAGATGG - Intergenic
987772212 5:22319940-22319962 CGGGAGCAGGAGAAGGGAGATGG + Intronic
988597467 5:32608035-32608057 CAAGGTATGGGGAAGGGAGATGG + Intergenic
988632079 5:32942330-32942352 AAGGAGAAGGAGAAGGGAGGAGG + Intergenic
988688381 5:33547966-33547988 CAGGGGAAGGAGGATGAAGAGGG + Intronic
988735984 5:34021764-34021786 CAGGGTGAGGGGAAAGGGGAGGG + Intronic
988893546 5:35647249-35647271 CTTAGTAAGGAGAAGGGGGAGGG + Intronic
989181008 5:38577170-38577192 CAGGATGAGAAGAAAGGAGAGGG - Intronic
989260203 5:39411010-39411032 CAGAGTAAGCAGATGGGATAAGG + Intronic
989405430 5:41056173-41056195 CAGGAAAAGGAGAAGAGACATGG + Intronic
989677866 5:43993495-43993517 CAGGTCAAGGACAAGGGTGAAGG - Intergenic
989846909 5:46156440-46156462 TGGGGTAAGGGGATGGGAGAGGG - Intergenic
990019452 5:51107416-51107438 CAGGTAGAGGAGAGGGGAGACGG - Intergenic
990553263 5:56905113-56905135 CAGGATAATGAGAAGAGAGTGGG - Intergenic
990830504 5:59951928-59951950 CAGAGAAAGGAGAAGTGAGGAGG - Intronic
990846735 5:60148943-60148965 CAGGGCAAAGTAAAGGGAGATGG + Intronic
990943901 5:61230252-61230274 GAGTTTAAGGGGAAGGGAGACGG + Intergenic
991350186 5:65713282-65713304 AAGGGGAAGGAGAAGGGAAAGGG - Intronic
991474270 5:67003473-67003495 GAGGATAAAGAGAAGGAAGAGGG - Intronic
991568158 5:68026551-68026573 CAGGGTGGGGAGAAGCCAGAGGG + Intergenic
991601054 5:68351508-68351530 CAGGATAAGGGGAAAGGAGAAGG - Intergenic
992149011 5:73882700-73882722 CAGGGGAAGAAGAAGGGAGGTGG + Intronic
992638356 5:78747127-78747149 CGGGGTAAGGGGCAGGGAAAAGG + Intronic
992673063 5:79078829-79078851 AAGAGTAAGGATAAGGGAGGAGG + Intronic
992830699 5:80590698-80590720 CAGGGCAAGGAGAAAGGTGATGG + Intergenic
993326622 5:86546562-86546584 CAGGATTAAGAGAAGGGAGATGG + Intergenic
993333454 5:86627905-86627927 TAGGGTAGGGAGAATGGGGATGG + Intergenic
993505105 5:88699706-88699728 GAGGATGAGGAGAAAGGAGAAGG - Intergenic
993836137 5:92822440-92822462 AAGGGCAAGGAGAAGAGAGCTGG + Intergenic
993879557 5:93346846-93346868 TGGGGTCAGGAGAAGGGGGAGGG - Intergenic
993966933 5:94370527-94370549 GATGGGAAGGAGAAGAGAGATGG + Intronic
994030510 5:95136456-95136478 GAGGGAGAGGAGAAGGAAGATGG + Intronic
994609196 5:102014549-102014571 AAGGGAAAAGGGAAGGGAGAGGG + Intergenic
994670763 5:102758824-102758846 CAGGGTAGGGGGAGGGGGGAAGG + Intronic
994734561 5:103536393-103536415 CAGGTTAAAGAGAAGGGTCAAGG - Intergenic
995238801 5:109861757-109861779 CATGGGAACAAGAAGGGAGAGGG + Intronic
995308315 5:110680971-110680993 GAGGGAAAAGAGAAGGGTGAGGG + Intronic
995315014 5:110759814-110759836 CAGGGTCAGAAGTAGGAAGATGG + Intronic
995569399 5:113463405-113463427 TAGGGTAATCATAAGGGAGATGG + Intronic
995735854 5:115298386-115298408 GAGAAGAAGGAGAAGGGAGAAGG + Intergenic
995820015 5:116219290-116219312 AAGGGGAAGGGGAAGGGAAAGGG - Intronic
995882451 5:116858275-116858297 AAGGGGAAGGGGAAGGGAAAGGG - Intergenic
996012687 5:118498762-118498784 CAGGGCAATCAGACGGGAGAAGG - Intergenic
996031203 5:118705841-118705863 CAGTTTAAGGAGCAGGGAGAAGG - Intergenic
996131483 5:119786933-119786955 AAGGGTAAGGAAGAGGGAGCAGG - Intergenic
996337809 5:122403878-122403900 CAGGATAAGGAGAAGAGGGGAGG - Intronic
996387597 5:122925263-122925285 GAAGGAAAGGAGAAGGGGGAGGG - Intronic
996538912 5:124608555-124608577 CAGAGTGAAGAGAAGGCAGATGG + Intergenic
996656095 5:125938386-125938408 AAGGCGAAGGAGAAGGAAGAAGG - Intergenic
996699435 5:126435471-126435493 CAGGGAGAGCAGAAGGGGGAAGG + Intronic
997465696 5:134086683-134086705 AAGGGGAAGGGGAAGGAAGAAGG - Intergenic
997632541 5:135379721-135379743 CACTGAAAGGAGAAGGAAGAAGG - Intronic
998006414 5:138659852-138659874 AAGGAGAAGGAGAAAGGAGATGG - Intronic
998199428 5:140107864-140107886 CAGGGGAAGGAGGAGGAGGAGGG + Intronic
998374833 5:141683276-141683298 CAGGGGAAGAAGAGGGGAGTGGG + Intergenic
998526888 5:142850715-142850737 CAGCCTAATGAGAAGGGAGGAGG - Intronic
998537818 5:142951035-142951057 AAGGGGAAGGGGAAGGGAAAGGG - Intronic
998947482 5:147355322-147355344 CAGACAAAGGAGAAGAGAGAAGG - Intronic
999000241 5:147912920-147912942 GAGGGGAAAGAGAAGAGAGAAGG + Intergenic
999182669 5:149681103-149681125 CAGGGGAGGGAGGAGGGAGGAGG - Intergenic
999227592 5:150039820-150039842 AAGGGTAAGGAGAAGTGCAAAGG - Intronic
999241748 5:150131937-150131959 GAGGGGAAGGAGCAGGGACATGG + Intronic
999501474 5:152150961-152150983 AAGGTTAAGGACAAGGGATATGG - Intergenic
999777627 5:154823599-154823621 AAGGGAAGGGAGGAGGGAGATGG + Intronic
1000030184 5:157394742-157394764 CAGGGAAGAGAGAAGGGAGGAGG + Intronic
1000291539 5:159875788-159875810 CAGGGAAAGGAGAAGAAAAAGGG + Intergenic
1000308213 5:160015609-160015631 CAGGGAAAGGTAGAGGGAGAAGG - Intronic
1000325154 5:160166440-160166462 TAGAGGAAGGAAAAGGGAGAAGG - Intergenic
1000593750 5:163189970-163189992 AAGGATAAAGAGAAAGGAGAAGG + Intergenic
1000912388 5:167037917-167037939 TAGGGGTAGGAGAAAGGAGAGGG + Intergenic
1001801502 5:174548234-174548256 GAGGGTGAGGAGAAGGAAGAAGG - Intergenic
1001804776 5:174574014-174574036 CTCATTAAGGAGAAGGGAGAGGG + Intergenic
1002190292 5:177474049-177474071 CAGGGAAAGGAGACGGGCCAGGG - Intronic
1002260504 5:177990857-177990879 CAGGGCAAGGGGTAGGGACAAGG - Intergenic
1002897545 6:1388406-1388428 CAGGGATAGGAGCTGGGAGAGGG - Intergenic
1002969125 6:1996093-1996115 AAGGAGAAGGAGAAGGAAGAAGG - Intronic
1003578833 6:7321085-7321107 CAGGGTCAGAATAGGGGAGAGGG + Intronic
1004177731 6:13354734-13354756 CAAGGGAAGGAGAAGGGAGCAGG - Intergenic
1004332940 6:14737843-14737865 CAGGGCAAGGGGAGGGGAGTGGG + Intergenic
1004578379 6:16922523-16922545 CAGTGGCAGGAGATGGGAGAGGG + Intergenic
1004617412 6:17303622-17303644 GAAGGGAAGGAGAAGGGAAAAGG + Intergenic
1004631669 6:17427235-17427257 CTGGGAAAAGATAAGGGAGAGGG + Intronic
1004634995 6:17458277-17458299 CAGGATAAAGAGAAAGAAGATGG + Intronic
1004899514 6:20181392-20181414 GAGGGGAAGAAGAAGGCAGAAGG - Intronic
1005016259 6:21377981-21378003 CAGGGGAAGGAGAGGGATGAGGG + Intergenic
1005223859 6:23619793-23619815 AAGGGGAAGGAGAAGGGAAGGGG + Intergenic
1005921528 6:30406213-30406235 CAGGGGAAAGAGCAGGCAGAAGG - Intergenic
1006201890 6:32300838-32300860 CTGGGCAAAGAGAAGGGGGAAGG - Intronic
1006459282 6:34148940-34148962 CAGGGGAAGGGGAAGGGTGAAGG + Intronic
1006567804 6:34974303-34974325 AAGGGGAAGGGGAAGGGAAAGGG - Intronic
1006567831 6:34974377-34974399 AAGGGGAAGGGGAAGGGAAATGG - Intronic
1006651417 6:35554874-35554896 CAGAGTCAGCAGCAGGGAGAAGG + Intergenic
1006697478 6:35943474-35943496 CAGAATACAGAGAAGGGAGAAGG + Intergenic
1006789020 6:36686613-36686635 AAGGGAAAGGACAAGGGGGAGGG - Exonic
1006810843 6:36819690-36819712 CAAGGAAAGGGGAAGGGAGGGGG - Intronic
1006824571 6:36925212-36925234 CAGGGTAAGGACACTGCAGAAGG - Intronic
1006934532 6:37708158-37708180 AAATGGAAGGAGAAGGGAGATGG + Intergenic
1007093639 6:39200076-39200098 CTGGGTTAGGGGAAGGGACATGG + Intronic
1007177923 6:39909219-39909241 CAGGGGAGGGGGAGGGGAGAGGG + Intronic
1007339891 6:41184570-41184592 TGGGGTAGGGAGAAGGGGGAGGG + Intergenic
1007428182 6:41760534-41760556 CAGGGACAGGAGCAGTGAGATGG + Intergenic
1007927635 6:45663201-45663223 CAGGAAGAGGAGGAGGGAGATGG - Intronic
1008077877 6:47164644-47164666 AAGGTTAAAGAGAATGGAGAAGG - Intergenic
1008502896 6:52200841-52200863 AAGGGGAAGGGGAAGGGAAAGGG + Intergenic
1008581707 6:52913980-52914002 CAGTGGAAGGAGATGGGACAAGG + Intergenic
1008690259 6:53971073-53971095 CAATGTAAAGAGAAGGGAGGGGG + Intronic
1008862981 6:56173376-56173398 AAGGGAAAGGAGAAGGGGAAGGG + Intronic
1009053067 6:58301663-58301685 CGTGGTAAGGAGAAGAAAGATGG - Intergenic
1009238041 6:61148897-61148919 CGTGGTAAGGAGAAGAAAGATGG + Intergenic
1009450686 6:63796873-63796895 CAGGAAAGGAAGAAGGGAGAAGG - Intronic
1009591979 6:65684649-65684671 CATGGTAAGGTGAGGAGAGAAGG + Intronic
1009628205 6:66163514-66163536 CTGGGGAAGGAGAAAGGAAAGGG + Intergenic
1009999045 6:70929198-70929220 CAGGGTAGGGAGAGGGGGGAGGG + Intronic
1010022064 6:71171872-71171894 CAAGGCAAGCAGAAGGAAGAAGG - Intergenic
1010151744 6:72740843-72740865 CAGGTAAAGGAGACTGGAGAAGG - Intronic
1010172369 6:72988509-72988531 GAGGGGAAGGAGAAGGGCGTAGG + Intronic
1010653888 6:78488723-78488745 GAAGGTAAGGAGAGGGGAGAGGG + Intergenic
1010737123 6:79455476-79455498 CAGGTGCAGGAGAAGGAAGAGGG + Intergenic
1011041587 6:83035253-83035275 CAGGGTAAGGAGTGGGCAGCAGG - Intronic
1011256224 6:85424114-85424136 GAGGGTAAGGTGAGGGGACAGGG + Intergenic
1011550031 6:88523200-88523222 CAGGGCAATTAGACGGGAGAAGG - Intergenic
1011679495 6:89769191-89769213 GTGGGTAAGGAGATGGGATAGGG - Intronic
1011771914 6:90682786-90682808 CCAGGTAAGGAGAAGGCAGCTGG + Intergenic
1011962326 6:93106425-93106447 CAGGGTAAGGAGTCAGCAGATGG - Intergenic
1012140007 6:95614874-95614896 CAGGGAAAAGAGAAGGAGGAGGG - Intergenic
1012366544 6:98447551-98447573 CTGGGTGAGGAGGAGGTAGAAGG - Intergenic
1013106439 6:107029913-107029935 CAGGGTAAGGGGGATTGAGAGGG - Intronic
1013307442 6:108862644-108862666 CAGAGATAGGGGAAGGGAGAGGG + Intronic
1013348137 6:109282099-109282121 GAAGGGAGGGAGAAGGGAGACGG - Intergenic
1013565240 6:111352445-111352467 CAGGGGAAGGTGAAGTGTGAGGG + Intronic
1013602143 6:111715042-111715064 TAGGGGGAGGACAAGGGAGAGGG - Intronic
1013853472 6:114543079-114543101 CAGGGGCTGGAGAAGGGGGATGG - Intergenic
1014484081 6:121977755-121977777 GAGAGTCAGGAGAAGGGAGTGGG + Intergenic
1014749310 6:125237094-125237116 CAGAGTAAGAAGAAATGAGAGGG + Intronic
1014760677 6:125353381-125353403 AAGGGTGAGGAAAAGGAAGAAGG + Intergenic
1015106479 6:129542587-129542609 CAGGGAAAGGATTGGGGAGATGG - Intergenic
1015471628 6:133612758-133612780 CAGAGAAAGGAGCATGGAGAGGG - Intergenic
1015890660 6:137966950-137966972 AATGGGAAGGAGAAGGCAGAGGG + Intergenic
1015921004 6:138266368-138266390 AAGGGAAAGGAGAAGGGAAAGGG + Intronic
1016058391 6:139602836-139602858 GAGGTAAAGGATAAGGGAGAGGG - Intergenic
1016369367 6:143356615-143356637 AAGGGGAAAGAGAAGGGAGAGGG - Intergenic
1016448721 6:144158916-144158938 CTTGGTAGGGAGAAGGGAAAGGG - Intronic
1016715288 6:147219765-147219787 CATGCTAAGGAAAAAGGAGAGGG - Intronic
1016784306 6:147993271-147993293 GGGAGTAAAGAGAAGGGAGAGGG + Intergenic
1016830110 6:148425716-148425738 GAGGGGGAGGGGAAGGGAGAGGG - Intronic
1017079975 6:150658743-150658765 CAGGGTGAGGAGCAGGGAGGAGG - Intronic
1017122635 6:151038862-151038884 CATGGAAAGGACACGGGAGAAGG + Intronic
1017131813 6:151114388-151114410 CAAGGTGGGGAGAAGGGAGTTGG + Intergenic
1017237323 6:152130172-152130194 TAGGATAAGCAGAAGAGAGAAGG + Intronic
1017896773 6:158686862-158686884 CAGGGCCAGGAGGAGGGAGAAGG - Intronic
1018149645 6:160926181-160926203 CGGGGAAAGGAGAAAGGAGTTGG + Intergenic
1018528447 6:164737906-164737928 GAGAGTGAGGAAAAGGGAGAAGG - Intergenic
1018789355 6:167134751-167134773 CAGGGAAAAGAGGAGGAAGATGG + Intronic
1018870252 6:167777161-167777183 CAGGGAAAGGGAAAGGGAAACGG + Intergenic
1019075516 6:169384434-169384456 CAGGGTCAGCAGAAGGGATCAGG - Intergenic
1019410726 7:905473-905495 AAGGGAAAGGAGAAAGGAGAAGG + Intronic
1019410728 7:905480-905502 AGGAGAAAGGAGAAGGGAGAAGG + Intronic
1019410780 7:905733-905755 AAGGGAAAGGAGAAGGGAGAAGG + Intronic
1019410793 7:905803-905825 AGGAGAAAGGAGAAGGGAGAAGG + Intronic
1019410935 7:906523-906545 AAGGGAAAGGAGAAAGGAGAAGG + Intronic
1019543095 7:1560246-1560268 CAGGGACAGGAGCAGGGAGGTGG - Intronic
1019779294 7:2930105-2930127 CAGAGAAAGGAGAAGGGGGCCGG + Intronic
1019862603 7:3674304-3674326 CATGGTAATGAGAAGGAAGGAGG + Intronic
1020208539 7:6139699-6139721 CAGGGCAGGGAGAATGCAGAGGG - Intronic
1020577731 7:9955454-9955476 CTGGGGAAAGAAAAGGGAGAAGG + Intergenic
1020641512 7:10759705-10759727 GTGGCTTAGGAGAAGGGAGAAGG + Intergenic
1020660490 7:10974956-10974978 CTGGGAAAGGGGAAGAGAGAAGG - Intronic
1020963012 7:14829471-14829493 CAGGGAAACTAGAAGGGAGGAGG + Intronic
1020986212 7:15137834-15137856 TAGGTTAAGGAGGAGAGAGAGGG + Intergenic
1021052959 7:16012173-16012195 GAGGGTTAGGAGGAGGGTGAGGG - Intergenic
1021157846 7:17234178-17234200 CAGGGGAAGGAGATGAGACAGGG - Intergenic
1021159817 7:17259332-17259354 CAGGGTAAGGAGAACAAAAAAGG + Intergenic
1021594057 7:22296002-22296024 CAGGGTAAGGAGAACAAAGGAGG + Intronic
1021647706 7:22802545-22802567 CAGGGGGAGGAGAAGGGGGCTGG - Intergenic
1021740207 7:23679261-23679283 AAGGGTACCGAGAAGGGAGGTGG + Intergenic
1021919345 7:25468382-25468404 GTGGGTAAGGATGAGGGAGAAGG + Intergenic
1022175626 7:27869506-27869528 CATGGGGAGGAGAAGGGGGATGG - Intronic
1022200345 7:28110557-28110579 AAGGGAAAGGAAAAGGGAAAGGG + Intronic
1022274423 7:28841817-28841839 AAGGGGAAGGAGAAGGGGAAGGG + Intergenic
1022357052 7:29625786-29625808 AAGGGGAAGGAGAAGGGGAAGGG + Intergenic
1022359971 7:29648588-29648610 CAGGATTTGAAGAAGGGAGAAGG - Intergenic
1022593300 7:31687113-31687135 CAGGGCAAGGGGGATGGAGAAGG - Exonic
1022801247 7:33779492-33779514 CAGTGTAGGGGGAAGGGGGAGGG + Intergenic
1023156457 7:37256753-37256775 AAGGGAAGGGAGAAGGGAGGAGG + Intronic
1023215429 7:37857558-37857580 CAGGGAAAGGAAAAGTAAGATGG + Intronic
1023879908 7:44312449-44312471 AAGTGAAAGGAGAAAGGAGAGGG + Intronic
1024611295 7:51066434-51066456 CAGAGTAGGGAGGAGGGATATGG + Intronic
1024658654 7:51473203-51473225 CAGGGATGAGAGAAGGGAGATGG + Intergenic
1024725479 7:52189404-52189426 GAGGGGGAGGAGAAGGGAGAGGG + Intergenic
1024737686 7:52323366-52323388 AAGGGAAGGGAGAAGGGAAAGGG - Intergenic
1024737701 7:52323406-52323428 AAGGGAAGGGAGAAGGGAAAGGG - Intergenic
1024915721 7:54497381-54497403 AAGGGTCAGGAGAAGAGAGATGG + Intergenic
1025858028 7:65301201-65301223 CAAGATAAGGAGAAGAGGGAAGG - Intergenic
1026191915 7:68136515-68136537 GAGGGGAAGGAGGAGGGAGGAGG + Intergenic
1026191923 7:68136534-68136556 GAGGGGAAGGAGGAGGGAGGAGG + Intergenic
1026395215 7:69945782-69945804 AAGGGCAAGGACAAGGGAAATGG - Intronic
1026736302 7:72950844-72950866 AAGAGTAAGGGAAAGGGAGAGGG + Exonic
1026743755 7:72995403-72995425 GAAGGGAAGGAGAAGGGAAAGGG + Intergenic
1026959480 7:74399239-74399261 CAGTGTAAGAAGAAGGGTGCTGG + Intronic
1026994568 7:74606971-74606993 CAGGGGAAGGGGGTGGGAGAGGG - Intergenic
1027029865 7:74880101-74880123 GAAGGGAAGGAGAAGGGAAAGGG + Intergenic
1027099980 7:75369674-75369696 GAAGGGAAGGAGAAGGGAAAGGG - Intergenic
1027107431 7:75414218-75414240 AAGAGTAAGGGAAAGGGAGAGGG - Intergenic
1027232555 7:76281398-76281420 CAGGGCACGGAGGGGGGAGAGGG - Intronic
1028535459 7:91886850-91886872 CAGGGGGAGGGGGAGGGAGAGGG - Intergenic
1028611524 7:92717368-92717390 AAGGGGAAGGAGAAGGGGAAAGG + Intronic
1028757617 7:94455965-94455987 AAGGGTAAGGGAAAGGGAAAGGG + Intergenic
1029177298 7:98674033-98674055 GAAGGTAAGGAAAAGGGAGCTGG + Intergenic
1029412850 7:100426865-100426887 CAGGGAAGGGAGGAGGGGGAGGG - Intronic
1029903612 7:104068308-104068330 CAGGGTAGGAAGAATGGAGAGGG + Intergenic
1030131810 7:106207910-106207932 CAGAGCAAGGAGACAGGAGAAGG - Intergenic
1030684567 7:112471450-112471472 CAGGGAGAGGAGAAAGGAGATGG - Intronic
1030862903 7:114658815-114658837 CAGGTGGGGGAGAAGGGAGAAGG - Intronic
1031327545 7:120420604-120420626 CGGGGTGAGGAGTAGGGGGAAGG + Intronic
1031859519 7:126961986-126962008 GAAGGTTAGGAGAGGGGAGAAGG - Intronic
1031863845 7:127015094-127015116 AAGGAGAAGGAGAAGGAAGAAGG + Intronic
1031863849 7:127015122-127015144 AAGGAGAAGGAGAAGGAAGAAGG + Intronic
1031865989 7:127039624-127039646 AAGGGGAAGGAGAAGGGGAAGGG + Intronic
1031919952 7:127593199-127593221 CTGGGTAAGGAGAAGGGCCTAGG - Intronic
1031955396 7:127937446-127937468 GAGGGAGAGGAGAAGGGAGAAGG - Intronic
1032090492 7:128909297-128909319 CAGAGAGAGGAGGAGGGAGAGGG + Intronic
1032182458 7:129692074-129692096 CAGGGGAATGTGGAGGGAGAGGG - Intronic
1032551386 7:132787404-132787426 CATGGGAAGAAAAAGGGAGATGG + Intronic
1032855569 7:135830761-135830783 CAGAGAAAGGAGAAAGCAGAAGG + Intergenic
1033237880 7:139652772-139652794 CAGAGTTGAGAGAAGGGAGAGGG + Intronic
1033359198 7:140626234-140626256 CAGGGGACGGAGAAGGGGAAGGG - Intronic
1033426888 7:141252881-141252903 CAGGGCAAGGAGAATGGAGCTGG - Intronic
1033529107 7:142245237-142245259 TGGGGTGAGGAGAAGGGAGCTGG + Intergenic
1033529917 7:142251490-142251512 CAGGGTGAAGTGAAGAGAGAAGG + Intergenic
1033804327 7:144937422-144937444 AAGGGTAAGGAGAAGGGGAAGGG - Intergenic
1033904663 7:146187611-146187633 GAAGGTAAGAAAAAGGGAGAGGG - Intronic
1034170670 7:149060662-149060684 TGGGTTAAGGAGATGGGAGAGGG - Intergenic
1034286248 7:149885110-149885132 CATGGCCAGGAGCAGGGAGAGGG - Intergenic
1034416874 7:150969965-150969987 CAGGGTCAGTAGAAGAGGGAGGG - Intronic
1034422278 7:150996170-150996192 CAGGGGTGGGAGAGGGGAGAGGG - Intronic
1034620310 7:152451729-152451751 TAGGGTAAGAATGAGGGAGATGG + Intergenic
1034937556 7:155209838-155209860 CAGGGTAGGGGGAAGGGAGCGGG - Intergenic
1035389716 7:158496675-158496697 CAGGGAAGGGGGAAGGGGGAAGG - Intronic
1035419704 7:158717345-158717367 CAGGAGGAGGAGAAGGAAGAAGG - Intergenic
1035441727 7:158907551-158907573 AAGGGAAAGGAAAAGGGAAAGGG - Intronic
1035856955 8:2985960-2985982 AAGGGGAAGGGGAAGGGAAAGGG + Intronic
1035856960 8:2985972-2985994 AAGGGAAAGGGGAAGGGAAAGGG + Intronic
1036180016 8:6576493-6576515 AAGGGGAAGGGGAAGGGAAAGGG - Intronic
1036256123 8:7208131-7208153 CAGGTGAAGAAGCAGGGAGAGGG + Intergenic
1036361361 8:8079368-8079390 CAGGTGAAGAAGCAGGGAGAGGG - Intergenic
1036454625 8:8895664-8895686 CTGGGTAAGGAGACTGGAGTAGG + Intergenic
1036633837 8:10533963-10533985 AAGGGAAAAGAGAAAGGAGAAGG + Intronic
1036718038 8:11144888-11144910 AAGGGGAAGGAGAAGGGGAAGGG + Intronic
1036889613 8:12587655-12587677 CAGGTGAAGAAGCAGGGAGAGGG + Intergenic
1037719129 8:21427917-21427939 ATGGGAATGGAGAAGGGAGAAGG - Intergenic
1037950626 8:23016957-23016979 GAGGCGAAGGATAAGGGAGAAGG - Intronic
1038596431 8:28890497-28890519 CAGGAAGAGGAGAAGGGGGAGGG - Exonic
1038722259 8:30047422-30047444 CAGGGCAGGAAGAAGAGAGAAGG + Intergenic
1038913304 8:31991757-31991779 TTGGGGAAGGAGGAGGGAGAAGG - Intronic
1038954382 8:32451385-32451407 CAGGGCAATGAGAAAGGAAATGG + Intronic
1041067041 8:54092087-54092109 GAGGAAAAGGAGAAGGAAGAGGG + Intronic
1041273525 8:56132970-56132992 CAGGGTGAGGGGAATGGATAAGG + Intergenic
1041284835 8:56249551-56249573 AAGGGGAAGGGGAAGGGAAAGGG - Intergenic
1041289421 8:56294625-56294647 CAGGGCAGTGAGAAGGGAGCAGG + Intergenic
1041387654 8:57321090-57321112 CAGGGTTGGGGGACGGGAGAGGG - Intergenic
1041417574 8:57628877-57628899 CAGGATAAGCAGAAGGGAAGAGG - Intergenic
1041567274 8:59293115-59293137 CAGGCCAAGAAGAAGGGGGAAGG + Intergenic
1041931732 8:63294958-63294980 CAAGGTAGGGAGCAGGGAGTGGG - Intergenic
1042482216 8:69316978-69317000 CATGCTAAGGACAAGGGACATGG + Intergenic
1042632632 8:70836342-70836364 CAGGGTAGGGAGCAAGGACATGG - Intergenic
1042722692 8:71842531-71842553 CAGGGAAAGGGGAAGGGTCAAGG + Exonic
1042749837 8:72146723-72146745 CTGGGAAAGGGGAAGGGATAGGG + Intergenic
1043296384 8:78668158-78668180 TAGGGGAGGGAGAGGGGAGAAGG - Intronic
1043619040 8:82165020-82165042 CAGGTAAAGAAGATGGGAGAAGG + Intergenic
1043938288 8:86167979-86168001 AAGGGGAAGGGGAAGGGGGAGGG + Intergenic
1044035589 8:87299279-87299301 CATGGCCAGGAGAAGGGACAGGG - Intronic
1044402234 8:91786155-91786177 AAGGGGAAGGAGAAGGGGAAGGG - Intergenic
1044426637 8:92059049-92059071 GAATGTAAAGAGAAGGGAGAGGG + Intronic
1044537646 8:93375612-93375634 CCTGGTGAGGAGATGGGAGAAGG - Intergenic
1044805621 8:96005555-96005577 GAAGGGAAGGAGAAGGTAGATGG + Intergenic
1044918156 8:97137977-97137999 CAGTCTGAGGAGAAGTGAGAGGG - Intronic
1044932020 8:97260133-97260155 CAGGAGAAGGAGGAGGGGGAGGG + Intergenic
1045474642 8:102542575-102542597 TAGGGGGAGGAGGAGGGAGAGGG - Intergenic
1045697134 8:104822251-104822273 AATGGTAAGGGGATGGGAGAGGG - Intronic
1046015602 8:108601132-108601154 AAGGAGAAGGAGGAGGGAGAGGG + Intergenic
1046126074 8:109910226-109910248 AAGGGAAAGGGGAAGGGAGAGGG - Intergenic
1046751033 8:117926686-117926708 CAGGATAAGGAAAAGCAAGAAGG + Intronic
1047137748 8:122100609-122100631 CATGGAAAGGGGAAGAGAGAGGG + Intergenic
1047523727 8:125615292-125615314 AAGGGGAAGGAGAAGGGGAAGGG - Intergenic
1047537683 8:125734488-125734510 CAGGAAGAGGGGAAGGGAGAGGG - Intergenic
1048303433 8:133267467-133267489 CAGAGAGGGGAGAAGGGAGATGG - Intronic
1048338247 8:133519044-133519066 AAGGGTAAGCAGAAGAGACATGG + Intronic
1048498709 8:134956920-134956942 CAGGGCAAACAGAAGGGAGGTGG + Intergenic
1048879166 8:138859016-138859038 CTGGGGACCGAGAAGGGAGATGG - Intronic
1049065989 8:140314589-140314611 GATGGTTGGGAGAAGGGAGATGG - Intronic
1049468823 8:142766115-142766137 CTGGGAAAGGAGGAGAGAGAAGG - Intronic
1049528613 8:143142412-143142434 CTGGGGAAGGAGGAGGGACAGGG - Intergenic
1050487832 9:6153398-6153420 TAAGTTTAGGAGAAGGGAGAGGG + Intergenic
1050886141 9:10768755-10768777 CAGAGTAGGGGGCAGGGAGATGG - Intergenic
1051053580 9:12957693-12957715 GAGGATAAGGAAAAGTGAGAAGG - Intergenic
1051299769 9:15636196-15636218 CTGGGTATGGAGTAGGTAGATGG + Intronic
1051667430 9:19478199-19478221 CAGGGGAAGGAACCGGGAGAGGG + Intergenic
1051765962 9:20524024-20524046 CAGGGGAAGTGGCAGGGAGAAGG + Intronic
1051942676 9:22527853-22527875 GAGGGTCAGGAGAGGTGAGAAGG + Intergenic
1051967189 9:22843497-22843519 TAGGGTAAGAAGAAAAGAGAAGG + Intergenic
1052640129 9:31156942-31156964 CAGGGTAATCAGGAAGGAGAAGG - Intergenic
1052738437 9:32369654-32369676 GAGGAGAAGGAGAAGGGAGGAGG + Intergenic
1052951856 9:34219822-34219844 GAGGGGAAGGGGAAGGGAGAGGG - Intronic
1052951870 9:34219851-34219873 AAGGGGGAGGGGAAGGGAGAGGG - Intronic
1053361895 9:37493972-37493994 CAGGGCACAGAGGAGGGAGAAGG + Intronic
1053463083 9:38285576-38285598 CAAGGTGAGGAGAATGAAGAAGG - Intergenic
1053575555 9:39355555-39355577 GAGGGGGAGGAGGAGGGAGAGGG - Intergenic
1053691114 9:40588027-40588049 CAGGGTCAGGACAAGGGGCAGGG - Intergenic
1054273690 9:63049464-63049486 CAGGGTCAGGACAAGGGGCAGGG + Intergenic
1054302374 9:63388998-63389020 CAGGGTCAGGACAAGGGGCAGGG - Intergenic
1054359523 9:64100260-64100282 GAGGGAGAGGAGGAGGGAGAGGG - Intergenic
1054434755 9:65199818-65199840 CAGGGTCAGGACAAGGGGCAGGG - Intergenic
1054495634 9:65821863-65821885 CAGGGTCAGGACAAGGGGCAGGG + Intergenic
1055197772 9:73617597-73617619 TAGGGAGAGGAAAAGGGAGAAGG - Intergenic
1055369032 9:75577022-75577044 GAGGCTAAGGAGAAGGCAGATGG - Intergenic
1055441286 9:76338905-76338927 CAGGGGAAGGAGAAGAGTCAAGG - Intronic
1055568848 9:77595952-77595974 CAGGATAAGGAGAATAGAGATGG + Intronic
1055581437 9:77711048-77711070 GAGGGGAAGGAGGAGGGGGAGGG - Intergenic
1055656888 9:78459570-78459592 GAGGGTTGGGAGAAGGGAAAGGG + Intergenic
1055712102 9:79074628-79074650 CAGGGTAATGAGGCAGGAGAAGG - Intergenic
1055862182 9:80764977-80764999 CAGGTTAAGGAGTAGGTAGCAGG - Intergenic
1055913824 9:81379954-81379976 CAGATTAGGGAGAAGGGAAAGGG + Intergenic
1056300359 9:85233736-85233758 GAGGGAAAGGAGATGGGAGAAGG - Intergenic
1056380834 9:86055777-86055799 CAGGGATAGGAGAGGGGGGAGGG + Intronic
1056428663 9:86504847-86504869 CAAGGTGAGCAGAAGGTAGAGGG - Intergenic
1056468147 9:86879126-86879148 CAGGGTCATCAGAAGGCAGAGGG + Intergenic
1056551629 9:87657891-87657913 AAGTTTCAGGAGAAGGGAGATGG + Intronic
1056587691 9:87939032-87939054 GAGGATTAGGAGAAGGAAGAGGG - Intergenic
1056609180 9:88113907-88113929 GAGGACTAGGAGAAGGGAGAGGG + Intergenic
1056832738 9:89929860-89929882 CAGGGGCAGAGGAAGGGAGAAGG + Intergenic
1057394251 9:94665586-94665608 CATGGTAAGAAGGAGGGAGATGG + Intergenic
1057489546 9:95510785-95510807 AAGGGGGAGGAGCAGGGAGAAGG + Intronic
1057857713 9:98614742-98614764 GGGGGAAAGGAGAATGGAGAAGG + Intronic
1058171547 9:101687048-101687070 CTGGGTAAGGAGGAGGAAGTCGG + Exonic
1058234836 9:102476964-102476986 CAGGGTACAGAGCAGGGAGTGGG - Intergenic
1058640519 9:107079585-107079607 AAGGGGAGGGAAAAGGGAGAGGG + Intergenic
1059048065 9:110892709-110892731 AAGGGAAAGGGGAAGGGAAAGGG + Intronic
1059352947 9:113678500-113678522 AAGGGGAAGGGGAAGGGAAACGG - Intergenic
1059473152 9:114522553-114522575 CAAGCAAAGGAGAGGGGAGAAGG - Intergenic
1059671652 9:116497714-116497736 CAGGCTGGGGAGAAGGGGGAGGG + Intronic
1059783119 9:117550914-117550936 CAAGGTGAGGAGAAGGTAAATGG + Intergenic
1060293296 9:122324347-122324369 CAGGGCAAGGTTGAGGGAGAGGG + Intergenic
1060471681 9:123953001-123953023 CAGGGTCCGGGGAAGAGAGACGG - Intergenic
1060736205 9:126067960-126067982 CAGAGCAAGGAGAGGGGAGCAGG + Intergenic
1061108224 9:128548965-128548987 CAAGGTAAGCAGGAGGGACACGG + Intergenic
1061366901 9:130176941-130176963 GAGGAGAAGGAGAAGGGAGGAGG - Intronic
1061386914 9:130295825-130295847 CAGGGCAAGTAGGAGGAAGATGG - Intronic
1061405976 9:130393306-130393328 CAGGGTATGGAGCAGGGGGTGGG + Intronic
1061637117 9:131919095-131919117 AAGAGTAGGGAGTAGGGAGAAGG + Intronic
1061652859 9:132065365-132065387 CAGGGAAAGGAGAAGAGCGGCGG + Intronic
1062050502 9:134444396-134444418 GAGGGGAAGGAGGAGGGAGGGGG - Intergenic
1062118192 9:134820418-134820440 CAGGGCATGGAGCTGGGAGACGG - Intronic
1062425965 9:136506403-136506425 CAGGGTGAGGAGGAGGATGAAGG + Intronic
1062536902 9:137025091-137025113 CCGGGTCAGGAGAGGGGACAGGG - Intronic
1062564522 9:137158256-137158278 CAGGAGAAGGAGCAGGGAGAAGG + Intronic
1062571458 9:137187643-137187665 CAGAGTAAGAGGAAGGGGGAAGG - Exonic
1062592876 9:137281838-137281860 TAGGGGAAGGAGCTGGGAGAAGG + Exonic
1062638398 9:137503540-137503562 AAGGAGAAGGAGGAGGGAGAAGG + Intronic
1062638407 9:137503575-137503597 AAGGAGAAGGAGGAGGGAGAAGG + Intronic
1062738052 9:138149558-138149580 AAGGGGAAGGGGAAGGGAGAAGG - Intergenic
1203621767 Un_KI270749v1:134135-134157 CAGGGTCAGGACAAGGGGCAGGG - Intergenic
1185511526 X:668006-668028 AAGGGGAAGGAGAGGGGAGGAGG - Intergenic
1185537306 X:872790-872812 GAGGGGAAGGGGAGGGGAGAGGG - Intergenic
1185537315 X:872808-872830 GAGGGGAAGGGGAGGGGAGAGGG - Intergenic
1185661981 X:1735376-1735398 CAGGATAAGAAGAAAGGAGGAGG - Intergenic
1185688325 X:1948435-1948457 GAGGAGAAGGAGAAGGGAGGAGG + Intergenic
1185688603 X:2133957-2133979 GAGGAGAAGGAGAAGGGAGGAGG + Intergenic
1185777841 X:2819957-2819979 CATGGTAAGGGGAGAGGAGAAGG + Intergenic
1185839491 X:3375420-3375442 CAGGGCAAAGAGGAAGGAGAAGG + Intergenic
1185943571 X:4348774-4348796 AAGGGAAAAGAGAAGGGAGGTGG - Intergenic
1186156645 X:6733043-6733065 CAGGGTGATGAGAAGGGGCATGG + Intergenic
1186471160 X:9823075-9823097 AAGGAGGAGGAGAAGGGAGAAGG - Intronic
1186471165 X:9823094-9823116 AAGGAGAAGGAGAAGGGAGAAGG - Intronic
1186471169 X:9823113-9823135 AGGGAGAAGGAGAAGGGAGAAGG - Intronic
1186471172 X:9823126-9823148 AAGGAGAAGGAGAAGGGAGAAGG - Intronic
1186551186 X:10507305-10507327 CAGGGTTGTGGGAAGGGAGAGGG + Intronic
1186588102 X:10898150-10898172 AAGGGGAAAGGGAAGGGAGAAGG + Intergenic
1187425650 X:19175327-19175349 ACGGGCAAGGAGAGGGGAGAGGG - Intergenic
1187537336 X:20154420-20154442 CATGGTAAGGAGATGGGTGAAGG - Exonic
1187565332 X:20443964-20443986 CATGGCAAGGAGAGGGAAGAAGG + Intergenic
1187569082 X:20482838-20482860 AAGGGGAAGGGGAAGGGAAAGGG - Intergenic
1187576197 X:20559084-20559106 AAGGGGAAGGAGAAGGGAAGGGG - Intergenic
1187576203 X:20559101-20559123 AAGGGGAAGGAGAAGGGAAGGGG - Intergenic
1188085287 X:25895507-25895529 CAGGGAAAGGAAAGGGGAGAAGG + Intergenic
1189145707 X:38652707-38652729 CCAGGAAAGGAGAAGGGAAAAGG + Intronic
1189377139 X:40474886-40474908 CAGGGGCAGGAAGAGGGAGAAGG + Intergenic
1189587812 X:42478461-42478483 AAGGGTAGGGAGGAGAGAGAAGG + Intergenic
1189937633 X:46086565-46086587 CAGGTTCAGGAGATGGGAAAGGG + Intergenic
1190561950 X:51694980-51695002 AAGGGGAAGGAGAAGGGGAAGGG + Intergenic
1190575507 X:51832607-51832629 GAGGGGAAAGAGAAGGGAAAAGG + Intronic
1190726191 X:53192501-53192523 CAGGGGAAGGGAGAGGGAGAAGG + Exonic
1190827233 X:54028790-54028812 CAGGGTATAGTGGAGGGAGAGGG - Intronic
1191890611 X:65936269-65936291 CAGGGTAATGAGGCAGGAGAAGG - Intergenic
1192016739 X:67339413-67339435 CTGGGGAAGCAGAAGAGAGAGGG + Intergenic
1192091225 X:68158651-68158673 CAGGGGAAGGGGGAGGGAGCAGG - Intronic
1192324655 X:70122423-70122445 GAGGGGGAGGGGAAGGGAGAGGG - Intergenic
1192446778 X:71216817-71216839 CAGGGGAAGGGGAAGAGAGCTGG + Intronic
1192448957 X:71230897-71230919 AAGGGGAAGGGGAAGGAAGAGGG + Intergenic
1192924219 X:75738510-75738532 AAGGATAAGGAGAAAGGAGAAGG - Intergenic
1192936002 X:75859054-75859076 CAGGCTAAGGGGAAGGGGAATGG + Intergenic
1193038824 X:76982747-76982769 CAGGGCAATGAGGCGGGAGAAGG + Intergenic
1193797936 X:85899252-85899274 GGGGGTAAGGAGAAAGAAGAGGG + Intronic
1193799023 X:85913394-85913416 AAAGGAAAGGAGAAAGGAGACGG + Intronic
1193847790 X:86496560-86496582 CAATGTAAAGAGAAGGGAGGGGG + Intronic
1194701290 X:97118287-97118309 TAGGGAAAGGAGAAGGAAAATGG - Intronic
1194933931 X:99924472-99924494 GAGGGTAAGCAATAGGGAGAGGG - Intergenic
1195234926 X:102887840-102887862 AAGGGAAAGGGGAAGGGAAAGGG - Intergenic
1195318449 X:103701142-103701164 AAGGAAAAGGAGGAGGGAGAGGG - Intergenic
1195367292 X:104138711-104138733 CGGGGGAACCAGAAGGGAGATGG + Intronic
1195401411 X:104465208-104465230 GAGGGTGAGGAGAAAGGAGAGGG - Intergenic
1195973964 X:110505155-110505177 AAGGAGAAGGAGAAGGGAAAGGG - Intergenic
1196031509 X:111098638-111098660 CTGGGTAAGGAGAGGGCAGTGGG + Intronic
1196198361 X:112858439-112858461 TAGGGTAAACAGAGGGGAGAAGG + Intergenic
1196237448 X:113299785-113299807 CAGGGGATGGGGAGGGGAGAGGG - Intergenic
1196558154 X:117115959-117115981 CAGGGGATGGAGAAAGCAGAAGG - Intergenic
1196904271 X:120416672-120416694 GAGGTTAAGGAGAATGGAGAGGG - Intergenic
1197536593 X:127696323-127696345 TATGGGAAGGAGTAGGGAGAGGG + Intergenic
1197734826 X:129843176-129843198 CAGGGAAACGAGAAGGTAGAAGG + Intronic
1197773428 X:130105318-130105340 CAGGGTGAGGAGGAGGGTCAGGG - Intronic
1198024343 X:132690524-132690546 CAGGCTAAGGAGAAAGGAAGAGG - Intronic
1198416883 X:136429380-136429402 CAGGGGCAGGAGCAGGGAGGTGG - Intergenic
1198510118 X:137341935-137341957 TAGTTTAAGGAGAAAGGAGAAGG + Intergenic
1198520667 X:137449246-137449268 CAGTGAAAGGAAAAGGGAGAAGG - Intergenic
1198556695 X:137801205-137801227 CTGGGTAATGAGAAGGCATAGGG - Intergenic
1199649896 X:149940180-149940202 GAGGGGTAGGAGAAGCGAGACGG + Intergenic
1199669794 X:150134508-150134530 CAGGGCAATGAGGCGGGAGAAGG + Intergenic
1199753281 X:150841395-150841417 AACGGTCAGGGGAAGGGAGAGGG + Intronic
1199904955 X:152216635-152216657 CTGGGGAAGGAGAAGAGAGAGGG + Intronic
1200136139 X:153875664-153875686 CAGGGTCCGGAACAGGGAGAAGG + Intronic
1200152008 X:153955774-153955796 CAGGGCAAGGGGAAGGCAGGAGG + Intronic
1200838455 Y:7755770-7755792 CAGGGTAAGGAGAATGGCAGGGG + Intergenic
1201041665 Y:9839717-9839739 CAGGGCAATTAGAAAGGAGAAGG - Intergenic
1201236321 Y:11915443-11915465 CAGGGCAAAGAGGAAGGAGAAGG - Intergenic
1201626479 Y:16020425-16020447 CAGGGTAATCAGACAGGAGAAGG - Intergenic
1202038623 Y:20660298-20660320 CAGGGAAAGGAAAGGGGACAAGG + Intergenic
1202583824 Y:26405245-26405267 CAGGGTCAGGACAAGGGGCAGGG + Intergenic