ID: 1184509903

View in Genome Browser
Species Human (GRCh38)
Location 22:44927282-44927304
Sequence CCGTTGGTTTGGAGTTTTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184509903_1184509911 -3 Left 1184509903 22:44927282-44927304 CCCCCAAAACTCCAAACCAACGG No data
Right 1184509911 22:44927302-44927324 CGGCCTGTGTGCCCCTGCCTGGG 0: 1
1: 0
2: 2
3: 23
4: 260
1184509903_1184509910 -4 Left 1184509903 22:44927282-44927304 CCCCCAAAACTCCAAACCAACGG No data
Right 1184509910 22:44927301-44927323 ACGGCCTGTGTGCCCCTGCCTGG 0: 1
1: 0
2: 3
3: 15
4: 218
1184509903_1184509919 25 Left 1184509903 22:44927282-44927304 CCCCCAAAACTCCAAACCAACGG No data
Right 1184509919 22:44927330-44927352 AGGTGCCCTGCAGCTCTTCAGGG 0: 1
1: 1
2: 0
3: 21
4: 205
1184509903_1184509918 24 Left 1184509903 22:44927282-44927304 CCCCCAAAACTCCAAACCAACGG No data
Right 1184509918 22:44927329-44927351 GAGGTGCCCTGCAGCTCTTCAGG 0: 1
1: 0
2: 3
3: 39
4: 177
1184509903_1184509913 5 Left 1184509903 22:44927282-44927304 CCCCCAAAACTCCAAACCAACGG No data
Right 1184509913 22:44927310-44927332 GTGCCCCTGCCTGGGACTCGAGG 0: 1
1: 0
2: 2
3: 22
4: 208

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184509903 Original CRISPR CCGTTGGTTTGGAGTTTTGG GGG (reversed) Intronic
No off target data available for this crispr