ID: 1184510978

View in Genome Browser
Species Human (GRCh38)
Location 22:44932970-44932992
Sequence TGCCCACAAGCCCCTCAAAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 154}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184510969_1184510978 22 Left 1184510969 22:44932925-44932947 CCACCGTGCAGACCAAGATACAG 0: 1
1: 0
2: 0
3: 10
4: 113
Right 1184510978 22:44932970-44932992 TGCCCACAAGCCCCTCAAAGGGG 0: 1
1: 0
2: 0
3: 16
4: 154
1184510973_1184510978 -7 Left 1184510973 22:44932954-44932976 CCAGCAACCCTAGAGGTGCCCAC 0: 1
1: 1
2: 1
3: 9
4: 119
Right 1184510978 22:44932970-44932992 TGCCCACAAGCCCCTCAAAGGGG 0: 1
1: 0
2: 0
3: 16
4: 154
1184510971_1184510978 10 Left 1184510971 22:44932937-44932959 CCAAGATACAGAACATTCCAGCA 0: 1
1: 0
2: 5
3: 30
4: 203
Right 1184510978 22:44932970-44932992 TGCCCACAAGCCCCTCAAAGGGG 0: 1
1: 0
2: 0
3: 16
4: 154
1184510970_1184510978 19 Left 1184510970 22:44932928-44932950 CCGTGCAGACCAAGATACAGAAC 0: 1
1: 0
2: 7
3: 46
4: 253
Right 1184510978 22:44932970-44932992 TGCCCACAAGCCCCTCAAAGGGG 0: 1
1: 0
2: 0
3: 16
4: 154
1184510968_1184510978 30 Left 1184510968 22:44932917-44932939 CCAAGTAACCACCGTGCAGACCA 0: 1
1: 0
2: 0
3: 14
4: 86
Right 1184510978 22:44932970-44932992 TGCCCACAAGCCCCTCAAAGGGG 0: 1
1: 0
2: 0
3: 16
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184510978 Original CRISPR TGCCCACAAGCCCCTCAAAG GGG Intronic
901783693 1:11610703-11610725 TGGCAACATGCCCCTCACAGTGG - Intergenic
903976358 1:27152987-27153009 TGCCCAGAAGTCCCTGAAAGTGG - Intronic
905891167 1:41519246-41519268 TGCCTACAAAGCCCTCAGAGGGG + Intronic
911774174 1:101786815-101786837 TGACCACCAGCCTCTCACAGAGG - Intergenic
912579515 1:110707481-110707503 TGCCCAAGAGCCCCTTGAAGAGG + Intergenic
919925427 1:202189494-202189516 TGCCCACAAGACCCACACACGGG - Intergenic
921511916 1:216042512-216042534 TACCCACAAGCCACTCAGTGTGG + Intronic
923176566 1:231472241-231472263 TTCCTACAAGCCCCTAAGAGAGG + Intergenic
1064118330 10:12597613-12597635 TCCCCACAACGCCCTCAATGAGG - Intronic
1065443650 10:25775544-25775566 GGCCCACAGGCCCCTAAGAGGGG - Intergenic
1067560966 10:47304114-47304136 GGCCCACCTGCCCTTCAAAGTGG - Intronic
1069699583 10:70412266-70412288 TGCCCACAAGCCCTCCAAAAAGG - Intronic
1070215235 10:74371921-74371943 TGACCACCAGCCTCTCACAGAGG + Intronic
1072913316 10:99522198-99522220 TCCCCTCAAGCGCGTCAAAGGGG + Intergenic
1073633883 10:105177565-105177587 TCCCTAAAAGCCCCTTAAAGTGG + Intronic
1076102580 10:127794778-127794800 GTCCCACAAGTCCCACAAAGGGG + Intergenic
1077172621 11:1174718-1174740 TGCCCTCAAGCCCAGCACAGAGG - Intronic
1078437955 11:11340920-11340942 AGCCCACAAGCCCTACACAGAGG - Exonic
1078765414 11:14292215-14292237 TGCCCACTAGAACCCCAAAGAGG - Intronic
1078848164 11:15140418-15140440 GGCCCACCAGCACCTCAGAGTGG - Intronic
1081500807 11:43664717-43664739 TGCCCACAAGTCCCTAAGAGGGG + Intronic
1085923882 11:80991171-80991193 TGCCCACATGTCCCTCTCAGAGG - Intergenic
1086501716 11:87460561-87460583 GGCCCACCAACCCCTCCAAGGGG - Intergenic
1088469369 11:110177007-110177029 TGCCCAAAAGACCCTCTGAGAGG + Intronic
1091782854 12:3224858-3224880 CCCCCACAAGCCCCTCAAGAGGG - Intronic
1094892504 12:34979109-34979131 TTCCAACGAGGCCCTCAAAGAGG - Intergenic
1096718111 12:53503073-53503095 GGCCCTCAAACACCTCAAAGGGG + Exonic
1097488458 12:60235076-60235098 AGCCGAAAAGCCCCGCAAAGTGG + Intergenic
1099470481 12:83042005-83042027 TGCAAACAAGAACCTCAAAGTGG - Intronic
1102977992 12:117220351-117220373 TGCCCACAAGCCCCTGAGTCAGG - Intronic
1107114146 13:36728284-36728306 TGCCTAAAAGCACTTCAAAGTGG + Intergenic
1107938954 13:45367557-45367579 TGCCCACAAGCCTTTGAGAGAGG - Intergenic
1110794742 13:79623244-79623266 GGCCAACAAGCCCCTAAGAGGGG - Intergenic
1113474162 13:110568157-110568179 TGCCCAGCAGCCCCATAAAGAGG - Intergenic
1113643485 13:111975767-111975789 TGCCCACATGCACCTCACACAGG - Intergenic
1114325364 14:21583404-21583426 TGGCCACAATCCCCTACAAGAGG - Intergenic
1119046462 14:71321629-71321651 TGTCCCCAAGACCCCCAAAGGGG - Intronic
1119686351 14:76635254-76635276 TGACCACCAGCCTCTCACAGAGG - Intergenic
1119781012 14:77276890-77276912 TGCCCTCAAGGCCCTCTCAGAGG + Exonic
1120174348 14:81277394-81277416 TGCCCACCACCACCACAAAGTGG - Exonic
1122319569 14:100845618-100845640 TGCCCGCCAGCCCCTCCACGAGG - Intergenic
1122322058 14:100861149-100861171 TGCCCACTGGGCTCTCAAAGGGG + Intergenic
1125517497 15:40330634-40330656 TGACCACAACCCCACCAAAGTGG - Intergenic
1130652955 15:85772635-85772657 TGCCCATAACCCCCTCCAAAGGG - Intronic
1132491691 16:235139-235161 AGCCCACATGTTCCTCAAAGCGG + Intronic
1132686558 16:1164714-1164736 GGCCCTCAAGCCCCGCAGAGGGG + Intronic
1133278988 16:4654619-4654641 TGCCCCCAAGCCACTCAGCGGGG - Intronic
1133319188 16:4902545-4902567 TGCCAACCAGCCCCACTAAGTGG - Intronic
1133398181 16:5464932-5464954 TGCCCTCAAGCTCCTAAAGGAGG - Intergenic
1133510134 16:6450083-6450105 TCCCCACCACCTCCTCAAAGAGG - Intronic
1134211528 16:12281428-12281450 TGCCCACCAGCCATTTAAAGAGG - Intronic
1134410617 16:14000624-14000646 TGTCCACAAGCCCTGCAGAGAGG - Intergenic
1135840752 16:25873883-25873905 TGTCCACATGACCCTTAAAGAGG - Intronic
1137612526 16:49828581-49828603 TCTCCCCAAGTCCCTCAAAGTGG - Intronic
1141558820 16:84853532-84853554 TGCCCACAGGCCCCTCGGTGAGG + Intronic
1142709914 17:1717349-1717371 TCCCCGCAAGTCCCCCAAAGAGG + Intronic
1147637875 17:41974900-41974922 TGCCCACCAGCCCCTGTTAGAGG - Exonic
1151317808 17:73334849-73334871 TGCCCACCAGCCCCTCACCCAGG + Exonic
1152866415 17:82726395-82726417 TACCCACAAGCATCTCAAAGTGG - Intronic
1154326071 18:13391270-13391292 TGCCCAAAACCCTCTTAAAGAGG - Intronic
1154410553 18:14139143-14139165 TGCCCAGAAGCCCCTGAATCTGG - Intergenic
1157888477 18:51391823-51391845 TGCCCACAGTCCCCTCAGAGGGG + Intergenic
1161010069 19:1955643-1955665 CGCCCACGACCCCCTCAGAGGGG + Intronic
1161266173 19:3365870-3365892 TGCACACAAGCCCCTCTAGCTGG + Intronic
1161562501 19:4981360-4981382 TTCTCACAAGCCCCTCAGGGAGG - Intronic
1162767555 19:12929164-12929186 TCCCCACAAGCCCCGGAAAGAGG + Intronic
1163144083 19:15369118-15369140 TGCTCAGAAGCCTCTCAAAAGGG + Intronic
1163248743 19:16113184-16113206 AGCTCACAAGCCACTCAAATAGG - Intronic
1163592216 19:18200479-18200501 TGCACATAAGGCCCTCGAAGAGG + Intronic
1167497295 19:49827117-49827139 GGCCCTCAAGACCCTCAGAGGGG + Intronic
925227296 2:2194566-2194588 TCCCCACTGGCCTCTCAAAGTGG - Intronic
925591791 2:5517163-5517185 TGCCCACAGTCATCTCAAAGTGG - Intergenic
925885937 2:8393749-8393771 AGGCCAGAAGCCCCTCAAGGCGG - Intergenic
926342308 2:11913845-11913867 TGGACACAGGCCCTTCAAAGAGG - Intergenic
927451785 2:23215085-23215107 GGCCCACAAGCCCCTCCTATGGG - Intergenic
928600058 2:32895870-32895892 TGCCCACCTGACCCTGAAAGAGG + Intergenic
929872834 2:45773098-45773120 TGCTCAAAAGCCCCTCGGAGGGG - Intronic
931610159 2:64090418-64090440 TGCCTAAATGCCCCTCTAAGTGG + Intergenic
932473930 2:71988287-71988309 TGCCCAGACTCCCCTTAAAGGGG - Intergenic
933802194 2:85970736-85970758 GTCCCACAAGCCCCTAAAACAGG + Intergenic
934471140 2:94538233-94538255 TTCCCACGAACTCCTCAAAGCGG + Intergenic
934935253 2:98460631-98460653 GGCCCACAATCCCCTAAAACTGG - Intronic
939956487 2:148531819-148531841 TGCTCAGAGGCCCCTCAGAGCGG - Intergenic
940064251 2:149609044-149609066 TACTCACAAGCCCCCCAAATAGG - Intergenic
940338767 2:152557414-152557436 TCCCCTCAAGCGCCTCAGAGAGG - Intronic
942250460 2:174043394-174043416 TGACCACCAGCCCCTCACAGAGG + Intergenic
942469223 2:176242493-176242515 TGACCACCAGCCCCTCACAGAGG + Intergenic
944842483 2:203637678-203637700 TCCCCACAACCTCCTTAAAGGGG - Intergenic
944846106 2:203669557-203669579 ACCCCAGAAGCCCCACAAAGAGG + Intergenic
944928571 2:204491957-204491979 TGCCTAGAAGACCCTCAAAGAGG + Intergenic
947385626 2:229587541-229587563 TGCCCGCAGGCCCCTTAAAAGGG + Intronic
947522888 2:230862152-230862174 TGCCACCATGCCCCTCCAAGAGG + Intergenic
947533958 2:230929303-230929325 TGCCCCCAAGCCCCCCAACTCGG + Intronic
947588788 2:231372820-231372842 TGCCCACAGACCCTTCAATGGGG + Intronic
948854727 2:240724858-240724880 TGCCCACAAGGCACTGAAGGAGG - Intronic
948854789 2:240725033-240725055 GGCCCTCAAGTCCCTCATAGTGG + Intronic
1169315624 20:4588277-4588299 GCCCCTCAAGCCCCTTAAAGAGG + Intergenic
1171565490 20:26181529-26181551 TGCCCCCAAGGCCCTAAATGGGG + Intergenic
1172740121 20:37160070-37160092 TGCCCACACGCCCCTTACACGGG - Intronic
1173259867 20:41424358-41424380 TGCCCAGGAGCCCCTCATAATGG - Intronic
1175234997 20:57503653-57503675 TCCCCACAGGCCCCTGAGAGGGG - Intronic
1175491367 20:59383063-59383085 AGCCTAGAACCCCCTCAAAGAGG - Intergenic
1180636997 22:17269448-17269470 TGCCCCCAAGCTCCTCAGGGTGG - Intergenic
1181513896 22:23400886-23400908 TGCCCACGTGCCCATCAAAGAGG - Intergenic
1183314689 22:37130360-37130382 TGCCCACAATGCCCTGAAAGGGG + Intronic
1184004487 22:41698283-41698305 TGCCCCCCAGCTCCTCACAGTGG + Intergenic
1184510978 22:44932970-44932992 TGCCCACAAGCCCCTCAAAGGGG + Intronic
950341144 3:12245814-12245836 TGCCCAAATGCTCCTCAAAGTGG - Intergenic
953649391 3:44786857-44786879 TTCCCAGAAGCCCCTCAAACAGG - Intronic
959277583 3:104296330-104296352 AGCCCACAGGCCCCTAAGAGGGG - Intergenic
959622111 3:108409697-108409719 TGCCAAACAGCCCTTCAAAGAGG - Intronic
961381228 3:126497722-126497744 TGACAGAAAGCCCCTCAAAGCGG - Intronic
961612947 3:128154932-128154954 TGCCAAAATGCCCCACAAAGAGG + Intronic
962846147 3:139275418-139275440 AGCACACAAGCCCCTCACATAGG - Intronic
965484907 3:169267009-169267031 TCCAGAAAAGCCCCTCAAAGGGG + Intronic
967479267 3:189955571-189955593 TGCCAACAAGCTCTTCACAGTGG + Intergenic
968764559 4:2461510-2461532 TGCCCACCAGCTCCCCAAGGTGG + Intronic
983324374 4:166234443-166234465 TGCCTACAAGTTCCTTAAAGGGG + Intergenic
985412110 4:189695910-189695932 TGCCCACAAGCCCCGGGCAGTGG - Intergenic
985826808 5:2198137-2198159 TGCCCAGAGGCCCCTGAATGGGG + Intergenic
985952214 5:3230994-3231016 TGCCCAGAAGCACCACAGAGCGG - Intergenic
986348062 5:6852869-6852891 TGTCCACAACCAGCTCAAAGTGG - Intergenic
987676047 5:21073634-21073656 TGCACACATGGCCTTCAAAGGGG - Intergenic
989482823 5:41951786-41951808 TGACCACAAGCCTCTCATAGAGG - Intergenic
993363933 5:87012485-87012507 TATCCACAAGCCACTGAAAGCGG - Intergenic
995098822 5:108273045-108273067 TGCCCACAAGCCACAAAAACCGG + Intronic
995597574 5:113764285-113764307 TTCCCACAAGCCCCTAAGAAGGG - Intergenic
996541752 5:124637421-124637443 TTCCCATAAGCCCCTCAGAAAGG - Exonic
998530571 5:142880688-142880710 TGCCCAAAAGCCCCTGCAGGTGG - Intronic
999090617 5:148932797-148932819 TGCCCACAAGCAGCTGAGAGTGG + Intronic
1001034399 5:168287198-168287220 TGTCCACAAGACCCCCCAAGGGG - Intergenic
1001350474 5:170958253-170958275 TTCCCAGCAGCTCCTCAAAGAGG - Intronic
1002356209 5:178631147-178631169 TGCCCAAACGCCCTTGAAAGAGG + Intergenic
1003269874 6:4598868-4598890 TGTCCACAAGCCCATTGAAGTGG + Intergenic
1006151497 6:31992517-31992539 GTCCCACAAGCCCCTCAACATGG + Exonic
1006157798 6:32025255-32025277 GTCCCACAAGCCCCTCAACATGG + Exonic
1006362241 6:33593076-33593098 CCCCCACAAGCCCCTCATATGGG - Intergenic
1006407050 6:33851528-33851550 TGCCCCAGAGCCCCTGAAAGTGG - Intergenic
1006410571 6:33871066-33871088 GCCCCACAAACCCCTCAGAGGGG - Intergenic
1009256812 6:61417295-61417317 TTCCCACAAAGGCCTCAAAGAGG - Intergenic
1010747000 6:79574894-79574916 TCCACACAAGCCCCTCTAGGTGG + Intergenic
1010882358 6:81193728-81193750 TCCCCACACTCCCTTCAAAGAGG + Intergenic
1011218184 6:85027832-85027854 TGCCCCCAACTCCATCAAAGTGG + Intergenic
1011482775 6:87811712-87811734 GGCCCACAGGCCCCTAAGAGGGG - Intergenic
1013301361 6:108808084-108808106 TGCCCACAACCCCCCCACAGAGG + Intergenic
1016853996 6:148648182-148648204 TGACCACCAGCCTCTCACAGAGG - Intergenic
1020833983 7:13126230-13126252 GGCCGACAAGCACCTCAAACAGG - Intergenic
1023110781 7:36808608-36808630 TGCCCACAGGCCCCTAAGAAGGG + Intergenic
1024617593 7:51128707-51128729 GCCCCTCAAGCCCCTCAAGGAGG + Intronic
1024755894 7:52530505-52530527 TGCCTAAAAGCTTCTCAAAGTGG + Intergenic
1026264269 7:68782846-68782868 CGCCCACAAGTGCCTCAGAGGGG - Intergenic
1027249795 7:76391936-76391958 TGCCCATAATCCCCTGAAAGTGG - Intronic
1028045286 7:86110061-86110083 TGCCCACAGGCTCCTAAGAGGGG - Intergenic
1032609815 7:133400744-133400766 GGCACAAGAGCCCCTCAAAGGGG - Intronic
1038234360 8:25737532-25737554 TGCCCCCAAGCCCTTGCAAGAGG - Intergenic
1038680057 8:29658489-29658511 TTCCCAAAAACACCTCAAAGGGG - Intergenic
1044559045 8:93594664-93594686 TGCCCAGAATCCTTTCAAAGCGG - Intergenic
1044914182 8:97094646-97094668 TGCCCTCAAGCAACTCAAACTGG + Intronic
1046020550 8:108659730-108659752 TGCCCAGATACCCCTCAAGGAGG + Intronic
1047378211 8:124325589-124325611 GGCCCATAAGCCCCTGAAACTGG + Intronic
1047914241 8:129565112-129565134 TCCCCACATGCCCCCCAGAGTGG - Intergenic
1051973607 9:22921927-22921949 TGACCAGAAGTCCCTCACAGGGG + Intergenic
1060762258 9:126264895-126264917 TGCCCAAATGCCCTTGAAAGTGG + Intergenic
1203670484 Un_KI270755v1:7071-7093 TGCCCACAAGCCCCGGGCAGTGG + Intergenic
1185473638 X:400163-400185 TGCCCACAATCCCAGCACAGTGG + Intergenic
1187651891 X:21419044-21419066 TGCCTACAGGCACCTCAAAAGGG - Intronic
1188468318 X:30508136-30508158 TGCCCAGGAGCCCCTCTAAAAGG + Intergenic
1196616216 X:117769421-117769443 TGCCCACTAGTCCCGCAAGGCGG - Intergenic
1197226300 X:123960031-123960053 GGGCCACAGGCCCCTCACAGGGG + Intergenic
1197872597 X:131073516-131073538 CACCCCCAAGCCCCTCCAAGGGG - Intronic
1198137014 X:133763182-133763204 TGACCACCAGCCTCTCACAGAGG + Intronic