ID: 1184511162

View in Genome Browser
Species Human (GRCh38)
Location 22:44934126-44934148
Sequence GACCCAGTGGGTGGTCCTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 242
Summary {0: 1, 1: 1, 2: 3, 3: 20, 4: 217}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184511155_1184511162 -6 Left 1184511155 22:44934109-44934131 CCCTCCTGGGGACTGCTGACCCA 0: 1
1: 0
2: 2
3: 22
4: 226
Right 1184511162 22:44934126-44934148 GACCCAGTGGGTGGTCCTGGTGG 0: 1
1: 1
2: 3
3: 20
4: 217
1184511152_1184511162 0 Left 1184511152 22:44934103-44934125 CCCGTCCCCTCCTGGGGACTGCT 0: 1
1: 0
2: 2
3: 27
4: 312
Right 1184511162 22:44934126-44934148 GACCCAGTGGGTGGTCCTGGTGG 0: 1
1: 1
2: 3
3: 20
4: 217
1184511148_1184511162 21 Left 1184511148 22:44934082-44934104 CCTCTGACGTGGGCATGGCAGCC 0: 1
1: 0
2: 1
3: 21
4: 140
Right 1184511162 22:44934126-44934148 GACCCAGTGGGTGGTCCTGGTGG 0: 1
1: 1
2: 3
3: 20
4: 217
1184511156_1184511162 -7 Left 1184511156 22:44934110-44934132 CCTCCTGGGGACTGCTGACCCAG 0: 1
1: 0
2: 2
3: 31
4: 269
Right 1184511162 22:44934126-44934148 GACCCAGTGGGTGGTCCTGGTGG 0: 1
1: 1
2: 3
3: 20
4: 217
1184511153_1184511162 -1 Left 1184511153 22:44934104-44934126 CCGTCCCCTCCTGGGGACTGCTG 0: 1
1: 1
2: 3
3: 56
4: 480
Right 1184511162 22:44934126-44934148 GACCCAGTGGGTGGTCCTGGTGG 0: 1
1: 1
2: 3
3: 20
4: 217
1184511154_1184511162 -5 Left 1184511154 22:44934108-44934130 CCCCTCCTGGGGACTGCTGACCC No data
Right 1184511162 22:44934126-44934148 GACCCAGTGGGTGGTCCTGGTGG 0: 1
1: 1
2: 3
3: 20
4: 217
1184511146_1184511162 26 Left 1184511146 22:44934077-44934099 CCTCTCCTCTGACGTGGGCATGG 0: 1
1: 1
2: 2
3: 8
4: 143
Right 1184511162 22:44934126-44934148 GACCCAGTGGGTGGTCCTGGTGG 0: 1
1: 1
2: 3
3: 20
4: 217
1184511157_1184511162 -10 Left 1184511157 22:44934113-44934135 CCTGGGGACTGCTGACCCAGTGG 0: 1
1: 0
2: 2
3: 11
4: 218
Right 1184511162 22:44934126-44934148 GACCCAGTGGGTGGTCCTGGTGG 0: 1
1: 1
2: 3
3: 20
4: 217

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184511162 Original CRISPR GACCCAGTGGGTGGTCCTGG TGG Intronic
900745312 1:4356727-4356749 GCATCAGTGGGTGGTGCTGGAGG + Intergenic
901931388 1:12597949-12597971 GTCCCACTGGGTGTTCCTGTTGG - Intronic
902738649 1:18418680-18418702 GGACCAGTTGGTGGTCCAGGTGG + Intergenic
903500878 1:23799699-23799721 CACACCGTGGTTGGTCCTGGAGG + Intronic
904808398 1:33147503-33147525 GACCCAGTGGGTGATCGGGCTGG - Exonic
905633279 1:39530947-39530969 GAGCCAGTGGGCAGCCCTGGGGG + Intergenic
906214752 1:44032009-44032031 GACCAAGCCGGTGGTCCAGGAGG - Intergenic
906867038 1:49433038-49433060 GACCAAGTGGAGGTTCCTGGAGG + Intronic
908029838 1:59987523-59987545 CACCGACTGTGTGGTCCTGGAGG - Intronic
908407343 1:63828140-63828162 GAGCCTGTTGGTGGTCTTGGAGG + Intronic
908568721 1:65386313-65386335 GTGCCAGTGGGTGGTCATAGGGG + Intronic
912497622 1:110101700-110101722 GACCCAGCGGGTAGACCAGGAGG - Intergenic
913975101 1:143449732-143449754 GACCCTGTCGGTGATCATGGGGG - Intergenic
914069493 1:144275348-144275370 GACCCTGTCGGTGATCATGGGGG - Intergenic
914109662 1:144691006-144691028 GACCCTGTCGGTGATCATGGGGG + Intergenic
914915396 1:151816204-151816226 CAACCAGAGGGTGGTCGTGGGGG - Intronic
915014660 1:152721478-152721500 GACCCAGTTGGTGGTACAAGAGG - Intergenic
915553125 1:156646606-156646628 GACCGTCGGGGTGGTCCTGGAGG + Intronic
915734327 1:158075165-158075187 GAGCCAGTGGGTGGGAGTGGTGG + Intronic
915898150 1:159827209-159827231 GAGCCAGTGGGTGATACTGCTGG + Intronic
915912732 1:159924604-159924626 GGCCCAGGGTGTGGTCGTGGGGG - Intronic
917864752 1:179183219-179183241 GACTCAGTGGGTGGGGCGGGAGG + Intronic
924754688 1:246931112-246931134 GCCACAGTGAGTAGTCCTGGCGG - Intronic
1067940580 10:50651589-50651611 GAACCTGAGGGTTGTCCTGGGGG + Intergenic
1070152082 10:73811377-73811399 GACCCTGCGGGTGGTGATGGTGG + Intronic
1072566612 10:96621670-96621692 GATGCAGTGGGAGGGCCTGGGGG - Intronic
1072758321 10:98035836-98035858 GACCCAGTGACTGGAGCTGGGGG - Intergenic
1074550451 10:114437604-114437626 GACCCAGGAGGTGGGCATGGTGG - Intronic
1074746909 10:116543529-116543551 CACACAGTGGCTGGTCGTGGTGG - Intergenic
1076294492 10:129374084-129374106 GGCCCAGTGGTTGGTCCTGGAGG - Intergenic
1077183541 11:1226820-1226842 GGCCCAGGGGCTGGTGCTGGAGG + Exonic
1078563492 11:12393612-12393634 GACTCAGTGGGAGGTCTTGGGGG + Intronic
1080575801 11:33598003-33598025 TACACAGTAGGTGATCCTGGTGG + Intronic
1084123220 11:67081748-67081770 GGCTCAGTGGGTGGGGCTGGTGG - Intergenic
1085753064 11:79178740-79178762 GACCCTGTGGGTGGGTGTGGGGG - Intronic
1089603325 11:119627945-119627967 GACCCAGCGGGCTCTCCTGGTGG + Intronic
1090067899 11:123519101-123519123 CACCCAGATGGTGGGCCTGGAGG + Intergenic
1090875524 11:130785516-130785538 AACCCAATGGGTGGTCCTAATGG - Intergenic
1091654794 12:2337780-2337802 TCCCCAGTGGTGGGTCCTGGAGG - Intronic
1091972968 12:4803713-4803735 GAACCAGTGGGTGCTACTGCAGG + Intronic
1094069066 12:26393005-26393027 GATCCAGAAGGTGGCCCTGGAGG - Intronic
1099935842 12:89124429-89124451 GAGCCATTGGGTCCTCCTGGGGG - Intergenic
1101231663 12:102747726-102747748 GACCCAGTGGGAGATCATAGGGG - Intergenic
1101758215 12:107638243-107638265 TGCCCAGACGGTGGTCCTGGTGG - Intronic
1101945600 12:109134166-109134188 GACCGACTGGGTGGTGCTTGGGG - Intronic
1102345879 12:112161255-112161277 GATGCAGTGGGTGAGCCTGGAGG + Exonic
1102816218 12:115868533-115868555 GACCCAGTCCCTGGTCCTGGAGG + Intergenic
1104171631 12:126287171-126287193 GGCCCAGTGGGAGGTACTTGAGG - Intergenic
1104971388 12:132532463-132532485 GGCCAAGTGGGTGCTACTGGGGG - Intronic
1105704882 13:22962526-22962548 AACCCAGTCAGTGTTCCTGGGGG + Intergenic
1113599753 13:111560060-111560082 GACCCTGGAGGAGGTCCTGGAGG + Intergenic
1113672395 13:112183840-112183862 GTCCCATTGGGAGGTCCTGGGGG + Intergenic
1114037675 14:18645363-18645385 GGCATAGTGGGTGTTCCTGGAGG + Intergenic
1114120959 14:19669660-19669682 GGCATAGTGGGTGTTCCTGGAGG - Intergenic
1117200515 14:53385307-53385329 GCCCCATGGAGTGGTCCTGGAGG + Intergenic
1119113419 14:71996458-71996480 GAAACAGTGGGTGGAGCTGGGGG + Intronic
1119306536 14:73612512-73612534 GAGTCAGTGGGCGGGCCTGGCGG - Intronic
1122770364 14:104095080-104095102 GAACCAGCAGGTGATCCTGGAGG - Intronic
1123019202 14:105389749-105389771 GGCCCAGGCGTTGGTCCTGGGGG + Intronic
1123913574 15:24996987-24997009 GAACCAGTGGCTGGGCATGGTGG + Intergenic
1124874572 15:33579905-33579927 GACCCAGTGGGTGTTCATCAGGG + Intronic
1128743601 15:70099021-70099043 GACCAAGCGGGGGGTCCGGGGGG - Intergenic
1129458882 15:75690041-75690063 GGCCCAGGCGGTGTTCCTGGAGG + Exonic
1129724926 15:77896851-77896873 GGCCCAGGCGGTGTTCCTGGAGG - Intergenic
1130119090 15:81031351-81031373 GACCTAGTGGGAGGTCATGGGGG + Intronic
1132719155 16:1307454-1307476 GACCCTGTGGGAGGTGGTGGGGG + Intergenic
1132847426 16:2006963-2006985 GTCCCTGTGGGGGGTCTTGGGGG - Intronic
1134594195 16:15482424-15482446 CACCCACTGGATGGTTCTGGTGG - Intronic
1136293431 16:29289232-29289254 CACCCAGTGGTTGGGCCTGTGGG + Intergenic
1136550246 16:30979183-30979205 GGCCCAGCAGGTGGTTCTGGGGG - Exonic
1136551965 16:30986668-30986690 GGCCGAGTGGCTGGTCCTGGAGG + Exonic
1137779028 16:51081460-51081482 CAGCCAGTGGGAGATCCTGGTGG + Intergenic
1137912423 16:52391723-52391745 CACCCAGTGGGAGACCCTGGAGG + Intergenic
1138378648 16:56584799-56584821 GATTCAGTGGCTTGTCCTGGAGG - Intergenic
1139657725 16:68399170-68399192 GTCCCTGTGGGTGGGCTTGGGGG + Intronic
1140632309 16:76868095-76868117 GACCCAGTGTGTTGGCATGGAGG + Intergenic
1140992816 16:80230742-80230764 AACCCAGTGGGTGCTGGTGGGGG + Intergenic
1141166683 16:81665509-81665531 GCAGCTGTGGGTGGTCCTGGTGG + Intronic
1142066791 16:88067464-88067486 GACCCAGGGGCTTGTCCTGAGGG + Intronic
1142126070 16:88411345-88411367 GCCCCGGCGGGTGGTCCAGGGGG + Intergenic
1142961110 17:3553107-3553129 GTCCCGGTGGGAGGGCCTGGAGG - Intronic
1143187715 17:5020581-5020603 GGCTCAGAGGGCGGTCCTGGGGG - Exonic
1143270723 17:5672733-5672755 GCCCCAGTGGGTGCTGATGGGGG + Intergenic
1143441214 17:6975795-6975817 GACCCAGTGGCTGGGCGCGGTGG + Intronic
1144639320 17:16928832-16928854 GATGCGGTGGGTGATCCTGGAGG + Intergenic
1145183143 17:20770630-20770652 GACCCAGTGGTTGGACCTTCTGG + Intergenic
1146445471 17:32929374-32929396 AACCAAGTGGGTGGTCTTGGAGG + Intronic
1148213031 17:45819598-45819620 CACCCAGTGGGTTTTCATGGAGG - Intronic
1148450849 17:47777136-47777158 GGCCCAGTGGGTGAGGCTGGTGG - Intergenic
1148644105 17:49209553-49209575 TAGCCCTTGGGTGGTCCTGGGGG - Intronic
1151283039 17:73090747-73090769 GAGCTCGTGGGTGTTCCTGGTGG + Intronic
1151785705 17:76273922-76273944 TACCGAGTGGGCGGGCCTGGGGG + Intergenic
1151970074 17:77453159-77453181 GACCCACTGTGTGCGCCTGGGGG + Intronic
1152240868 17:79160280-79160302 CACCCAAGGGGTGGACCTGGGGG + Intronic
1152359655 17:79825736-79825758 GTCCCAGGGGTTGGTCCAGGAGG - Intergenic
1157724227 18:49951309-49951331 GAACCTGGGGGTGGTCCTGGGGG + Intronic
1159949102 18:74466810-74466832 GCCCCAGGAGGTGGTACTGGAGG - Intergenic
1159990373 18:74899786-74899808 GACCCAGTGGCTGTGGCTGGCGG - Intronic
1160402426 18:78620659-78620681 GACCCAGTGGGTGGCTTTGCAGG + Intergenic
1160711915 19:556013-556035 GACCCAGTGGGTGGGGTGGGTGG - Intergenic
1161195989 19:2987071-2987093 GAGCCAGTCGGAGGACCTGGTGG - Exonic
1162432568 19:10637806-10637828 GACCCACTGGGTGGGCATGGGGG - Intronic
1162904337 19:13814690-13814712 GCCACAGTGGGCGGCCCTGGGGG - Intronic
1164686753 19:30171957-30171979 CACCCAGTGGCTGCTCCTGCGGG + Intergenic
1166119025 19:40673854-40673876 GACACAGAGGGTGAGCCTGGGGG - Intronic
1166647169 19:44540865-44540887 GGACCAGTGGGTGGGCCTGCAGG - Intergenic
1166851407 19:45763224-45763246 GCTCCAGAGGGTGGTCTTGGAGG + Intronic
1167225014 19:48232236-48232258 GAGTCAGTGGGTGGTCCTGGTGG - Intronic
1168287692 19:55342632-55342654 GACTCACTGTGTGGTCTTGGGGG - Intronic
926160803 2:10487975-10487997 GCCTCAGTGGGTGGAACTGGAGG - Intergenic
926354015 2:12023242-12023264 GACCCAGTGGGAGGTAATTGAGG + Intergenic
929246610 2:39709494-39709516 AACCCAGTGGCTGGTCTTGAGGG - Intronic
929354387 2:41002035-41002057 CACCCTGTGTGTGTTCCTGGTGG - Intergenic
930780935 2:55224380-55224402 CACCCAGTGGATGGTCCTCCTGG + Intronic
931442458 2:62299890-62299912 GACCCAGTGAGAGGCCCTGGTGG - Intergenic
934290094 2:91684966-91684988 GACCCTGTCGGTGATCATGGGGG - Intergenic
935790519 2:106585817-106585839 GACCCAGAGGCTGGGCCAGGGGG + Intergenic
938230874 2:129657607-129657629 AACCTAGTAGGGGGTCCTGGGGG + Intergenic
938273298 2:129993700-129993722 GGCATAGTGGGTGTTCCTGGAGG - Intergenic
938442922 2:131352401-131352423 GGCATAGTGGGTGTTCCTGGAGG + Intronic
944432245 2:199645828-199645850 GAACAACTGGGTGGTGCTGGAGG - Intergenic
946147908 2:217744628-217744650 GACCCACTGGAAGGTGCTGGAGG + Intronic
946422148 2:219571121-219571143 GCTCAAGTGCGTGGTCCTGGGGG - Exonic
948368677 2:237474377-237474399 CAGCCAGTGGGTGGACCAGGTGG - Intergenic
948528842 2:238590038-238590060 GACACAGTGAGCGGGCCTGGCGG - Intergenic
948564512 2:238875361-238875383 GACCCAGTGGGTGGTGCTGTTGG - Intronic
948703045 2:239772681-239772703 GACTGACTGGGTGGTTCTGGTGG - Intronic
948913713 2:241019469-241019491 GACCCCACTGGTGGTCCTGGGGG + Intronic
949048077 2:241881428-241881450 GACCCAGTGTGGGGTCCAGGTGG - Intergenic
1169140624 20:3225521-3225543 GACCATGTGGGGGTTCCTGGAGG + Intergenic
1170378517 20:15730113-15730135 GACCCAGTGGCTGGACATGGTGG - Intronic
1170416191 20:16145118-16145140 TACCCAGTGGATGCTCCTGGAGG + Intergenic
1171099660 20:22371034-22371056 GGCCCTGTGTGTGGTCCAGGAGG + Intergenic
1171781997 20:29427838-29427860 GGCCCAGTGGGTGGGCGCGGGGG - Intergenic
1171978120 20:31608362-31608384 GACCCCGTGGGTGGGCTTGCAGG - Intergenic
1173475971 20:43360012-43360034 CAGCCAGTGAGTGGTCATGGAGG - Intergenic
1173681602 20:44885965-44885987 GGCCCAGTGGGTGGGCCCCGTGG + Intronic
1175511178 20:59527414-59527436 CACCCAGTGGGTGATCCAGTGGG + Intergenic
1175917441 20:62433284-62433306 GACCCTGTGTGTGGAACTGGGGG + Intergenic
1179488978 21:41728133-41728155 GGCCCTGTGGGTTTTCCTGGAGG - Intergenic
1179611940 21:42557636-42557658 CACCCAGTGGGTGGCCTTGGGGG - Intronic
1179912198 21:44456233-44456255 GGCCCAGTGGGTGGTCACTGCGG - Intronic
1180461804 22:15572405-15572427 GGCATAGTGGGTGTTCCTGGAGG + Intergenic
1181776785 22:25165863-25165885 GAGCCAGTGGGAGGGACTGGGGG + Intronic
1182041096 22:27239530-27239552 GACCCAGAGGATGGGCTTGGGGG + Intergenic
1183237446 22:36630244-36630266 GACCCAGTGGGAAGCCTTGGTGG + Intronic
1183362690 22:37390866-37390888 GGCCCAGGGGGAGGCCCTGGAGG + Intronic
1183458585 22:37936153-37936175 GCCCCTGGGGGTGGTCCTGTGGG + Intronic
1183520634 22:38294413-38294435 GCCCCCGTGGGTGGGCCAGGGGG + Exonic
1183931632 22:41238861-41238883 GACCCAGCGGCTGGACCTGCAGG - Exonic
1184147568 22:42620228-42620250 AACCCAGTGGGTGGACAGGGCGG + Intronic
1184281286 22:43438886-43438908 GAGCCAGTGGGTGGGCGAGGTGG - Intronic
1184368518 22:44068040-44068062 GACCCAGCAGGTGCTCCAGGCGG - Intronic
1184511162 22:44934126-44934148 GACCCAGTGGGTGGTCCTGGTGG + Intronic
1184565394 22:45288847-45288869 GATCCAGGGAGGGGTCCTGGGGG + Intronic
1184685343 22:46094343-46094365 GACCCTGTGGATGGACCTAGGGG + Intronic
1184950031 22:47834480-47834502 GACCCGGGGGGTGGTCCCAGTGG + Intergenic
1185335492 22:50269394-50269416 TGCCCACTGGGGGGTCCTGGTGG - Intronic
950768434 3:15291580-15291602 TACCCAGTGGGATGTCCTTGTGG - Intronic
954652934 3:52176263-52176285 GGCCCATGGGGTGATCCTGGTGG - Intergenic
957083495 3:75658559-75658581 GGCCCAGTGGGTGGGCGCGGGGG + Intergenic
961407070 3:126687153-126687175 GGCCTAGTGGGTGGTCATGGGGG - Intergenic
961451564 3:127004564-127004586 GACCCCTGGGGTGGTACTGGAGG + Intronic
961496038 3:127292272-127292294 GACCCTGTGGGATGTTCTGGTGG + Intergenic
961648610 3:128406047-128406069 GCCCCACTGGGGGGTCCTGGTGG - Intronic
962198102 3:133380418-133380440 GCCCCAGAGTGGGGTCCTGGGGG - Exonic
966911234 3:184561598-184561620 GACCCCGAGGGTGGGCCTGGCGG + Intronic
968132206 3:196198332-196198354 GACCCAGAGGTTGGGGCTGGGGG + Exonic
968261972 3:197332554-197332576 GACTGAGTGGGTGGTCCAAGGGG + Intergenic
968486795 4:866809-866831 GACCCCGAGGCTGCTCCTGGGGG + Intronic
968556450 4:1248509-1248531 GACCCCGTGGCTGGGCCTGCGGG - Intronic
968655044 4:1774805-1774827 GGCCCAGTGTGGGGGCCTGGAGG + Intergenic
968689569 4:1983730-1983752 GATGCAGGAGGTGGTCCTGGCGG - Intronic
968752661 4:2398263-2398285 GACCCGATGGGTGGTCATGGTGG + Intronic
968930307 4:3575460-3575482 GGCCCAGGGGCTGGTGCTGGGGG - Intergenic
969829475 4:9782917-9782939 GACCCTGTCGGTGATCATGGGGG + Exonic
974953820 4:68614843-68614865 GCCCCAGAGTGTGGGCCTGGAGG + Intronic
977339354 4:95738897-95738919 GCAACTGTGGGTGGTCCTGGTGG + Intergenic
978761666 4:112359810-112359832 GCCCCAGTGGGTGCCCATGGAGG + Intronic
984160296 4:176244620-176244642 GACCCAGGGGTTGGGCCTGGTGG + Intronic
985488761 5:166679-166701 GTACCAGTCGGTGGCCCTGGGGG + Intronic
985881461 5:2641791-2641813 GCCCAGGTGGGTGGTCCAGGGGG - Intergenic
985883478 5:2658082-2658104 GCTCCACTGGGAGGTCCTGGAGG - Intergenic
986168014 5:5292657-5292679 GAGGCAGTGGCAGGTCCTGGAGG - Intronic
988539672 5:32097746-32097768 GACCCTCTGGATGGTCCTGAAGG - Intronic
996460550 5:123736079-123736101 GACCCTGTGGGGAGTTCTGGAGG + Intergenic
996788955 5:127271600-127271622 GACCCAGTGGGTGGTCATGGGGG + Intergenic
998427278 5:142039589-142039611 GAGCCAGGGTGTGGCCCTGGGGG + Intergenic
999386449 5:151157364-151157386 GAGCCAGGGGCTGGTCCTGCCGG - Intronic
999448269 5:151658754-151658776 AACTCAGTGGGTGGACTTGGAGG + Intergenic
1000957332 5:167558790-167558812 GACCCAGTGGATGGTGGTGGTGG - Intronic
1001164835 5:169354936-169354958 GAGCCCGTGGGCAGTCCTGGGGG + Intergenic
1001345758 5:170896931-170896953 GACCCAGTTGGTGGTCATACTGG + Intronic
1001964325 5:175899859-175899881 GCCCCAGTGTGAGGCCCTGGTGG - Intergenic
1003241180 6:4347068-4347090 TTCCCAGTGGGGGCTCCTGGTGG + Intergenic
1006449929 6:34099860-34099882 GCCCCAATGTGTGGCCCTGGAGG - Intronic
1008521245 6:52363198-52363220 GACCCGGTGCGGGGACCTGGAGG + Intronic
1010538625 6:77063430-77063452 GACCCAGGTGGTCGTACTGGTGG + Intergenic
1011151298 6:84276317-84276339 GACACTGTGCTTGGTCCTGGGGG + Intergenic
1012419275 6:99044996-99045018 GATCCTGTGGGTGTTGCTGGTGG - Intergenic
1013641509 6:112087410-112087432 GACCCAGTCGGTGGTCGTACAGG - Exonic
1018984337 6:168624983-168625005 GACCCAGATGGTGCTGCTGGTGG - Intronic
1019951934 7:4380248-4380270 CACCCAGTGGGTACTCCTGTTGG - Intergenic
1019983885 7:4641584-4641606 GCCTCTGTGGGTGGTCGTGGAGG - Intergenic
1021696550 7:23281859-23281881 GTCCCAGTGGGTGGTCTTCAGGG - Intergenic
1022028819 7:26473123-26473145 GACACAGTGGGTGGGCCAGGAGG - Intergenic
1022623872 7:32014056-32014078 GACCACGTGGGTGGCCCTGTGGG + Intronic
1023122742 7:36925899-36925921 GGCCAAGGGGGTGGTGCTGGGGG - Intronic
1023802059 7:43843726-43843748 GAGCCAGTGGCTGGACGTGGTGG + Intergenic
1025254992 7:57378788-57378810 GGCCCAGTGTCTGATCCTGGGGG + Intergenic
1025651673 7:63475570-63475592 GCCCCAGCGGGTGCTCCTTGGGG - Intergenic
1026389805 7:69888859-69888881 TCCCCAATGGGTGGGCCTGGTGG - Intronic
1026986309 7:74557195-74557217 GACACAGGGGATGGGCCTGGCGG - Intronic
1028480666 7:91301197-91301219 GACCCAGTGGGGGGGCTTGCTGG + Intergenic
1029110618 7:98211541-98211563 GACCCAGGGGCAGGACCTGGCGG + Intronic
1029750941 7:102542063-102542085 GACCATGTGGGTGGAGCTGGAGG - Intronic
1029768894 7:102641174-102641196 GACCATGTGGGTGGAGCTGGAGG - Intronic
1032239538 7:130149985-130150007 GAGCCCGTGGGAGTTCCTGGAGG - Intergenic
1033271954 7:139940008-139940030 GCACCAGTGGGTGCTCCTGAAGG + Intronic
1035482367 7:159197793-159197815 GACCCAGTGGCTGAGCCGGGAGG - Intergenic
1037596426 8:20358141-20358163 GACCCAGTGTGTGGGCTTTGAGG + Intergenic
1038589287 8:28821578-28821600 AACCCACTGGGTGGTGGTGGTGG - Intronic
1047449720 8:124954075-124954097 GACCCAGACTGTGGGCCTGGAGG - Intergenic
1049236381 8:141514446-141514468 GGCCCAGAGGGTGGCCCTGCAGG + Intergenic
1049462872 8:142738260-142738282 GAACCAGTGCCTTGTCCTGGCGG + Intergenic
1049820416 8:144629946-144629968 GACACTGTGGGGGGCCCTGGGGG + Intergenic
1053241897 9:36502615-36502637 GAGTCGGGGGGTGGTCCTGGAGG - Intergenic
1054459797 9:65456454-65456476 GGCCCAGGGGCTGGTGCTGGGGG + Intergenic
1055072712 9:72183425-72183447 GCCCCAGCAGGTGGGCCTGGTGG - Intronic
1056932675 9:90891870-90891892 GTTCCAGGGTGTGGTCCTGGAGG + Intronic
1057704295 9:97386663-97386685 GGCCCGGTGGGGGGTGCTGGAGG + Intergenic
1058061061 9:100496525-100496547 GTCCCACTGGCTGGGCCTGGTGG - Intronic
1060527431 9:124328446-124328468 CACACAGGGGGTGGGCCTGGGGG - Intronic
1062108877 9:134771214-134771236 GACCTAGTGGGTGGATCTGCAGG - Intronic
1062495848 9:136831329-136831351 GACCCTGTGGCTGGTCCTCCAGG - Intronic
1192272628 X:69597118-69597140 GACCCAGTGGCTGGGCGCGGTGG - Intergenic
1192481822 X:71492591-71492613 GAGCCAGAGGGTGGAGCTGGTGG - Intronic
1196780707 X:119381577-119381599 AACCCAGTGGGGAGTTCTGGAGG - Intergenic
1198794296 X:140379210-140379232 GGCCCAGTGGCTGGGCATGGTGG + Intergenic
1199285124 X:146046474-146046496 GAGCCAGTGCGTGTTCCGGGTGG - Intergenic
1201417709 Y:13763988-13764010 GGCCCAGAGGGTGTGCCTGGTGG + Intergenic
1201427067 Y:13863231-13863253 AAACCAGTGGGTGGGCATGGTGG - Intergenic