ID: 1184512368

View in Genome Browser
Species Human (GRCh38)
Location 22:44941231-44941253
Sequence GGTCTCTGGAATCTCCCTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 198
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 179}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184512368 Original CRISPR GGTCTCTGGAATCTCCCTCT GGG (reversed) Intronic
901082530 1:6591692-6591714 GGTCTGTGCAAACTCCCTCAGGG - Exonic
901626010 1:10625522-10625544 GGTCCCAGGAATCTCCCCCCTGG + Intronic
901712424 1:11126136-11126158 GGGCTCTGGAATTTCCCTTGGGG - Intronic
901721167 1:11199137-11199159 GCTCTGTGAAATCTGCCTCTGGG - Intronic
902704073 1:18192308-18192330 GGTCTCTGGAGTCTGTATCTTGG + Intronic
903689650 1:25163832-25163854 GGGCTCTGGTCTGTCCCTCTTGG - Intergenic
903812658 1:26043513-26043535 GGTCTCTGTACTGTCCATCTGGG - Exonic
904919454 1:33995522-33995544 GGTCTCTGCAACCGGCCTCTGGG + Intronic
905050624 1:35047776-35047798 GGTCTCAGGAGGCTCTCTCTGGG + Intergenic
906786429 1:48619889-48619911 GGTGTCTGGAATCGCCCTTGGGG + Intronic
909997538 1:82299014-82299036 GGTCTCTGGGATGTCCCTCCAGG - Intergenic
910528417 1:88208063-88208085 GGGCTCACGAATCCCCCTCTAGG + Intergenic
916036325 1:160925772-160925794 GGTCTCTTGAGTCACCCACTTGG + Intergenic
920578465 1:207081807-207081829 GGTGTCTGGAATCATTCTCTGGG + Intronic
920996072 1:210993004-210993026 GCTCTCAGAAGTCTCCCTCTAGG + Intronic
1063094321 10:2896200-2896222 GGTCTGTGGAATTTCCCTTTGGG + Intergenic
1069777955 10:70937757-70937779 GGGCTCTCCACTCTCCCTCTGGG + Intergenic
1070798804 10:79232973-79232995 GGAATCTGGAGGCTCCCTCTTGG + Intronic
1072051476 10:91708210-91708232 GGTCTGTTAACTCTCCCTCTGGG + Intergenic
1072274841 10:93812940-93812962 GGTTTCTGGAATGTACTTCTAGG - Intergenic
1073678570 10:105677722-105677744 GGTCTCTGAAATGGCCCCCTTGG + Intergenic
1074525657 10:114261023-114261045 GGTCTTTGGAACCTCCTTCTAGG + Intronic
1076075653 10:127531868-127531890 GCTCTCTGGAATTTTCCTCAGGG + Intergenic
1076282060 10:129255163-129255185 GGTCTCTCATATCCCCCTCTTGG + Intergenic
1076567972 10:131411891-131411913 GGCCCCTAGAATCTCCCTTTGGG + Intergenic
1078410236 11:11108695-11108717 GATCTCTGGAAGATGCCTCTGGG + Intergenic
1079147217 11:17863979-17864001 GGCCTCTAGAATCCCCATCTGGG - Intronic
1079188379 11:18256988-18257010 GGTCTCTTGATTCTCCATCTAGG + Intergenic
1080188573 11:29520384-29520406 GGGCTCTGGTTCCTCCCTCTGGG - Intergenic
1081029155 11:38055971-38055993 GATCTCTGAAGTCACCCTCTTGG + Intergenic
1081993425 11:47349596-47349618 GGCCTCCGGGATCTCCCTGTGGG + Intronic
1083223264 11:61267372-61267394 GGTCTCTGGATTTTGCCTCTGGG + Intronic
1084539369 11:69776458-69776480 GGTCCCAGGAATCTCCCTGTGGG - Intergenic
1085386728 11:76161947-76161969 GGACCCTGGAATCTCACTTTTGG + Intergenic
1088518098 11:110660325-110660347 GGTCTCTTGACTCACCCTTTAGG - Intronic
1088684216 11:112271525-112271547 TATCTCAGGAATCTGCCTCTTGG + Intergenic
1089113102 11:116072487-116072509 GGTCTGGGGCATCTCTCTCTAGG + Intergenic
1091099608 11:132858556-132858578 GGCCTCTGGGAAATCCCTCTTGG - Intronic
1091964213 12:4724283-4724305 GTTTTCTGGAACCTCCCTCAGGG + Intronic
1095450095 12:42321303-42321325 GGGCTCTGAAATCTCACTGTTGG + Intronic
1095478214 12:42607811-42607833 GGTCACTGTCATCTCCATCTTGG - Intergenic
1099588682 12:84556118-84556140 GATCCCTGAAATCTCCCTCATGG - Intergenic
1101950364 12:109169845-109169867 CATCTCTGGAATCTCCCCGTTGG + Intronic
1108660938 13:52585485-52585507 GCTCACTGCAATCTGCCTCTTGG - Intergenic
1108920223 13:55664145-55664167 GGCTTCTGGAATTTGCCTCTAGG - Intergenic
1113729825 13:112633305-112633327 GGTCACTGCAATCTGCCTCCTGG + Intergenic
1114402413 14:22422050-22422072 GTTCACTGCAAACTCCCTCTAGG - Intergenic
1114690129 14:24573795-24573817 GGCCTCCGGAATCCCCCTGTAGG + Exonic
1114693320 14:24605641-24605663 GGTCTCAGGCATCACCTTCTGGG - Intergenic
1117194339 14:53324462-53324484 GGAATCTGGAGTCTCCCTTTAGG + Intergenic
1118327749 14:64793026-64793048 GGTGTCTGGCATTTCCATCTCGG + Exonic
1120879232 14:89401845-89401867 GGTGTGTGGGATTTCCCTCTGGG - Intronic
1124600983 15:31132591-31132613 GGGTTCTGGACTCTCCTTCTGGG + Intronic
1127856815 15:62960221-62960243 GGTCTCTGGGTTCTCAATCTTGG + Intergenic
1128513387 15:68327162-68327184 GGGCTCTGGGATCCCCCTCAGGG + Intronic
1129510245 15:76116315-76116337 GGAGTCTGGCATCTGCCTCTGGG - Intronic
1129796711 15:78383179-78383201 GGTCAGTGGAGTCTCTCTCTGGG - Intergenic
1130049069 15:80468233-80468255 GGCCTCAGGAATCTCCCTGCTGG + Intronic
1131070074 15:89460653-89460675 GTTCTCTGGGATGTCCCTTTGGG - Intergenic
1132609902 16:810476-810498 GGTCTCTGCAAGATCCATCTGGG - Intronic
1132988305 16:2779491-2779513 GGTGTGTGGAGACTCCCTCTAGG - Intergenic
1133756435 16:8765733-8765755 GGTCTCTGGGTTGTGCCTCTAGG + Intronic
1134141248 16:11721364-11721386 GCTCACTGGAATCTGCCTCCCGG - Intronic
1134199877 16:12189076-12189098 CCTCTCTGTAATCACCCTCTTGG - Intronic
1135151110 16:20006807-20006829 GTTCTTTGGAATCCCCCTCTTGG + Intergenic
1135608428 16:23843307-23843329 GGTCTCTGGGGTCTGCTTCTGGG - Intronic
1136186658 16:28592417-28592439 GATCTTTTGAATCTCCCTTTTGG + Exonic
1136317750 16:29464164-29464186 GATCTTTTGAATCTCCCTTTTGG - Exonic
1136377082 16:29872096-29872118 GGTCTCTGGAATCTCTGTCTTGG - Intronic
1136432325 16:30203509-30203531 GATCTTTTGAATCTCCCTTTTGG - Exonic
1137560535 16:49499400-49499422 GGAAGTTGGAATCTCCCTCTAGG - Intronic
1138347906 16:56331276-56331298 GGTTTCTGGGACCTGCCTCTAGG - Intronic
1139660779 16:68419354-68419376 GGTCTCTGGAACCTTCCTTTGGG + Intronic
1141513826 16:84529683-84529705 GGTTTCTGGAATGTACATCTGGG + Intronic
1141550311 16:84802570-84802592 GGGCTCTGGACTCACCCTATGGG - Intergenic
1142532350 17:589667-589689 GGTCTCTGGAATTTTCCACCAGG - Intronic
1143397398 17:6612114-6612136 GGTCTCCGGAAGCTCCGTATCGG + Exonic
1143519573 17:7437726-7437748 GGTTTCTGGAAGCTGCCCCTGGG - Intergenic
1143563443 17:7708325-7708347 GGGCACTGGGATCTCCCTCTTGG - Intronic
1146159699 17:30553285-30553307 GGTCTCTGGAGTCTCCAGCAGGG - Intergenic
1148805028 17:50259666-50259688 GGCCTCTGGGCTCTTCCTCTGGG + Intergenic
1150897084 17:69224471-69224493 GGTCTCTGGACTCTCCATAGAGG - Intronic
1152095336 17:78268963-78268985 GGTCCAGGGAATCTCCCTCTTGG - Intergenic
1155158381 18:23176858-23176880 GCTCCCTGGAGTCTCCCCCTTGG - Intronic
1155904364 18:31430953-31430975 GATCTCTAGAATCTCCCTTGGGG + Intergenic
1156475283 18:37402091-37402113 GGCATCTGGACTCTACCTCTGGG + Intronic
1157257159 18:46149570-46149592 GGTCCCTGGCCCCTCCCTCTAGG - Intergenic
1157814450 18:50720754-50720776 GGGCTCTGGAAGCCCCCTGTGGG - Intronic
1160295088 18:77630379-77630401 GGTTTCTGGAGTCACCTTCTGGG + Intergenic
1160849612 19:1184014-1184036 CTTCTCTGGAATTTCCCTCGGGG - Intronic
1164013296 19:21228621-21228643 GGTCTCAGTAGTGTCCCTCTGGG + Intronic
1167348774 19:48962627-48962649 GGTCTCTGGCACCCCCCTCTGGG + Intergenic
925315294 2:2918246-2918268 GGTCTCTGAACTCCCACTCTTGG - Intergenic
925415461 2:3667171-3667193 GGGCTCAGGAACCTCCCTTTAGG - Intronic
927026492 2:19073768-19073790 GGACTCAGGAAGCTCCCACTTGG - Intergenic
927727921 2:25442191-25442213 CCTCTCTGTAATCTGCCTCTTGG - Intronic
928135745 2:28686244-28686266 TGACTTTGGAATCTCCCCCTTGG + Intergenic
930720706 2:54634929-54634951 TGTGGCTGGAATTTCCCTCTTGG - Intronic
932036487 2:68252006-68252028 GGTCTCTGGAATTTTCCACGGGG + Intronic
935639291 2:105275379-105275401 GCTCTCTGGATTCTAGCTCTAGG - Intronic
937223613 2:120356018-120356040 AATCTCTATAATCTCCCTCTTGG + Intergenic
944551386 2:200847585-200847607 GCTCTCTGGCAGCTCCCTGTTGG - Intergenic
947120443 2:226808677-226808699 CCTCTCTAGAAGCTCCCTCTTGG - Intergenic
947260638 2:228218310-228218332 GGTCTCTGTGATTTCCTTCTGGG + Intergenic
947271329 2:228338723-228338745 GATTTCTGGAAACTGCCTCTAGG - Intergenic
947599827 2:231439947-231439969 GGTCTCTTGAGTCGCCCGCTTGG + Intergenic
948980643 2:241492725-241492747 GGTGCCTGGAATGTCACTCTAGG + Exonic
1170104687 20:12741016-12741038 GGTCTCTGGAAAATTCCACTTGG + Intergenic
1170367390 20:15612731-15612753 GGTCTGTAGAATGTGCCTCTGGG + Intronic
1171437453 20:25134397-25134419 GCCCTCTGGTCTCTCCCTCTAGG - Intergenic
1172778238 20:37420411-37420433 GGGCTCTGGGACCTTCCTCTGGG + Intergenic
1173539146 20:43838378-43838400 GGTATTTGGAGACTCCCTCTGGG + Intergenic
1174368906 20:50073230-50073252 GGGCACTAGAATCTCCCACTGGG + Intergenic
1174402880 20:50285380-50285402 GGTCTCTGGCCTCTCCCACGGGG + Intergenic
1175099673 20:56570109-56570131 GGTTTCTGGAGGCTCACTCTTGG - Intergenic
1176081938 20:63277871-63277893 GGGCTCTGCACTCTCCCTGTTGG - Intronic
1178014586 21:28329210-28329232 GGTCTCTGAAATAGCCCCCTTGG - Intergenic
1178738277 21:35172113-35172135 GCTCTCTGGAGTCACCCTCCAGG + Intronic
1179003153 21:37482768-37482790 GGTCTCTGAAATGGCCCCCTTGG - Intronic
1179897356 21:44370109-44370131 GGACTCTGGTATCTCCCTCAAGG + Intronic
1181475708 22:23166748-23166770 GGGCTCTGGCCTCGCCCTCTTGG - Intergenic
1181859545 22:25807574-25807596 GGTCTCAGGTCTCTCCCTGTGGG + Intronic
1184512368 22:44941231-44941253 GGTCTCTGGAATCTCCCTCTGGG - Intronic
1185011082 22:48315075-48315097 GGTCTCTGGCAAGTCCCTCCTGG - Intergenic
949461777 3:4302464-4302486 GTTCTCTGAAATTTACCTCTTGG - Intronic
950328643 3:12138003-12138025 GGGCTCTGGAATCACAATCTGGG - Intronic
950436650 3:12984223-12984245 GTTGTCTAGAATCTCCCTCCAGG - Intronic
951550945 3:23874546-23874568 GGTGTCTGGAATCTGCCTTATGG - Intronic
952325643 3:32318251-32318273 TGTCCCTGGAATCACCCTTTGGG - Intronic
952723906 3:36561898-36561920 GATCTCTGCCATCTCCCACTGGG + Intergenic
953544237 3:43851579-43851601 TGTCTATGCAATCTCCTTCTGGG + Intergenic
954921427 3:54194497-54194519 TCTCTCTGGAATCTTCCTCCTGG + Intronic
955926069 3:64006383-64006405 GGTCTTAGGAATCTCCTTCCAGG + Intergenic
959477402 3:106827816-106827838 TGACTCTGGAATCTGGCTCTAGG - Intergenic
961368041 3:126413773-126413795 GGCCTCTGGAGTCTCCCTTATGG - Intronic
962600313 3:136986672-136986694 GTTCTCTGAAAACTCCCTGTAGG + Intronic
965473114 3:169119991-169120013 AGTCTCTGGCATCTCCATGTTGG + Intronic
966012409 3:175097023-175097045 AGTCTCTGGAACCTTCCTTTGGG - Exonic
966782736 3:183598536-183598558 GGGTTCTGGAATTTCCATCTAGG + Intergenic
969617353 4:8261594-8261616 AGCCTGTGGAATCACCCTCTGGG + Intergenic
969662416 4:8538010-8538032 GGTCTCTGGAACATTCCTCCTGG - Intergenic
969872338 4:10112385-10112407 GTTCACTGGAATCCCCTTCTTGG + Intronic
970428064 4:15963588-15963610 GCTCCCTGGAATCCCCATCTTGG + Intronic
970800719 4:19970123-19970145 GGTTTCTGATTTCTCCCTCTGGG - Intergenic
974975622 4:68887782-68887804 GATATCTTGAATCTCCCTTTAGG + Intergenic
977386590 4:96347915-96347937 GGTGTCTGGAATTTCCCTTGAGG + Intergenic
980818501 4:137980796-137980818 AGACTATGGAATGTCCCTCTGGG + Intergenic
980838077 4:138222163-138222185 GGGCTCTAAAATCTCCCACTAGG + Intronic
981125167 4:141097563-141097585 GGACTCTGGATTCTCTCTCATGG - Intronic
982584088 4:157215255-157215277 GGTGTCTGGAATTTTCCTGTTGG + Intronic
986066603 5:4240495-4240517 GATCTCTCGAATCACCCACTTGG + Intergenic
993378235 5:87175250-87175272 ATTCTCTTGAACCTCCCTCTTGG - Intergenic
996090167 5:119342902-119342924 GGTGTCTGGAATTCCCATCTGGG + Intronic
998174945 5:139895965-139895987 GGGCTCTGGGATCCCCTTCTTGG - Intronic
998496626 5:142595788-142595810 GGACTCTAGAATCTCCCACTGGG + Intronic
998585192 5:143419936-143419958 GGTCTCTGAAATGGCCCCCTTGG - Intronic
1001338228 5:170819293-170819315 GGTCTCTTGACTCTCATTCTTGG - Intergenic
1006428829 6:33982774-33982796 GGTCTCTGGGTCTTCCCTCTTGG + Intergenic
1007069909 6:39028901-39028923 TGTTTCTGGAATCCCCCTGTGGG - Intronic
1013175214 6:107670691-107670713 TGTGTCTGGACTCTCCTTCTAGG + Intergenic
1013618616 6:111867990-111868012 GGTCTGTGCATTCGCCCTCTGGG + Intronic
1016311215 6:142735653-142735675 AGTCTCTGGAAGGTCCTTCTCGG + Intergenic
1017311927 6:152984636-152984658 GGTCTCTGTAAACTCCCTAAAGG - Intergenic
1019605002 7:1905677-1905699 GGGCTCTGTGACCTCCCTCTGGG + Intronic
1019920954 7:4163112-4163134 GGCCTCAGGAACCTCCCTGTGGG - Intronic
1020837833 7:13176813-13176835 GGTCTCTGGCATTGCCCTCTAGG - Intergenic
1021695679 7:23273585-23273607 TGTCACTGTGATCTCCCTCTTGG + Exonic
1021906467 7:25338898-25338920 GGTCACTGGAAACTCACTTTGGG + Intergenic
1025994368 7:66518744-66518766 GGTCCCTGGAATCCCTCTCTGGG - Intergenic
1026033630 7:66815919-66815941 GGTCCCTGGAATCCCTCTCTGGG + Intergenic
1026948210 7:74329737-74329759 GGTCCCTGCAAGGTCCCTCTTGG + Intronic
1026985982 7:74555433-74555455 GGTCCCCGGAATCCCTCTCTGGG - Exonic
1030201542 7:106910765-106910787 GCTCACTGGAATCTCCATTTGGG + Intergenic
1030232184 7:107220462-107220484 GGCCTCTGGAAACTGACTCTGGG + Intronic
1035078196 7:156194966-156194988 GGTCTCAGGCACCTCCCTGTCGG + Intergenic
1036654179 8:10665115-10665137 TTTCTCTGGAATGTTCCTCTTGG + Intronic
1038049612 8:23796444-23796466 GGTCTCTGAAATCTCTATATTGG + Intergenic
1040841345 8:51788588-51788610 GGAGTCTGGAATCTCTCTCAGGG + Intronic
1041027633 8:53703416-53703438 GGCCTATGGAATCTGCTTCTAGG + Intergenic
1041081794 8:54221516-54221538 AGACTCTGCAGTCTCCCTCTTGG + Intergenic
1041494839 8:58474242-58474264 GGTCTCTGGATCTACCCTCTGGG - Intergenic
1042575608 8:70215322-70215344 GGTCTCTGAGCCCTCCCTCTGGG - Intronic
1044572283 8:93733995-93734017 GGTGCCTGAAATCTTCCTCTCGG + Exonic
1044741888 8:95336043-95336065 GGTGTCTAGAATGTTCCTCTTGG - Intergenic
1048002898 8:130394299-130394321 GGTCTCTGAAATGGCCCCCTTGG + Intronic
1049326837 8:142025970-142025992 GGGCTCTGCAATCTCTCCCTGGG + Intergenic
1053008236 9:34618569-34618591 GGTCACTGGAATAGCCCTTTGGG - Intronic
1057936023 9:99239589-99239611 CTTCCCTGGAATGTCCCTCTTGG + Intergenic
1185453645 X:296521-296543 GGGCACTGGAACCTACCTCTGGG + Intronic
1186418663 X:9405935-9405957 GGTATCTGGAATCTTCCTGGAGG + Intergenic
1186419225 X:9410704-9410726 GGTATCTGGAATCTTCCTGGAGG + Intergenic
1186419455 X:9412681-9412703 GGTATCTGGAATCTTCCTGGAGG + Intergenic
1186547357 X:10464483-10464505 GGTCTTTGCATTCTCACTCTGGG + Intronic
1187088552 X:16068538-16068560 GGTTTCTGGAATCTCCAAATTGG - Intergenic
1189194477 X:39141070-39141092 GGACTCAGGAAGCTCCATCTAGG + Intergenic
1196047504 X:111271574-111271596 GGTCTCTGAGATCTCCTTCTTGG + Intergenic
1199358934 X:146894717-146894739 GTTCTCTGGCTTCTCCTTCTAGG - Intergenic
1200752059 Y:6955171-6955193 GGACTCTTTATTCTCCCTCTTGG + Intronic