ID: 1184512912

View in Genome Browser
Species Human (GRCh38)
Location 22:44943496-44943518
Sequence TAGCTGAGCCTGCTGGAGAT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 242
Summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 218}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184512912_1184512916 -2 Left 1184512912 22:44943496-44943518 CCGATCTCCAGCAGGCTCAGCTA 0: 1
1: 0
2: 1
3: 22
4: 218
Right 1184512916 22:44943517-44943539 TACATCTCCGTCTCCTCGTGGGG No data
1184512912_1184512921 26 Left 1184512912 22:44943496-44943518 CCGATCTCCAGCAGGCTCAGCTA 0: 1
1: 0
2: 1
3: 22
4: 218
Right 1184512921 22:44943545-44943567 GGCAGCTGCACGCTTCCTCCAGG 0: 1
1: 0
2: 2
3: 20
4: 207
1184512912_1184512914 -4 Left 1184512912 22:44943496-44943518 CCGATCTCCAGCAGGCTCAGCTA 0: 1
1: 0
2: 1
3: 22
4: 218
Right 1184512914 22:44943515-44943537 GCTACATCTCCGTCTCCTCGTGG 0: 1
1: 0
2: 0
3: 2
4: 65
1184512912_1184512919 5 Left 1184512912 22:44943496-44943518 CCGATCTCCAGCAGGCTCAGCTA 0: 1
1: 0
2: 1
3: 22
4: 218
Right 1184512919 22:44943524-44943546 CCGTCTCCTCGTGGGGACACGGG 0: 1
1: 0
2: 0
3: 8
4: 108
1184512912_1184512917 4 Left 1184512912 22:44943496-44943518 CCGATCTCCAGCAGGCTCAGCTA 0: 1
1: 0
2: 1
3: 22
4: 218
Right 1184512917 22:44943523-44943545 TCCGTCTCCTCGTGGGGACACGG 0: 1
1: 0
2: 2
3: 5
4: 94
1184512912_1184512915 -3 Left 1184512912 22:44943496-44943518 CCGATCTCCAGCAGGCTCAGCTA 0: 1
1: 0
2: 1
3: 22
4: 218
Right 1184512915 22:44943516-44943538 CTACATCTCCGTCTCCTCGTGGG 0: 1
1: 0
2: 1
3: 6
4: 58

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184512912 Original CRISPR TAGCTGAGCCTGCTGGAGAT CGG (reversed) Intronic
901061623 1:6474391-6474413 TGGCGGAGCCTCCTGGAGATGGG - Intronic
902938309 1:19780687-19780709 TAGCTGAGCCCACTGCAGAGGGG - Exonic
903499213 1:23792394-23792416 GACCTGAGCTTGCTGGAGACAGG - Intronic
904305343 1:29585308-29585330 GAGCTCGGCCTGCTGGAGAGGGG - Intergenic
904830610 1:33304166-33304188 TCTCTGAGCATGCTGGAGAAAGG + Intergenic
907280575 1:53344425-53344447 TAGATGAGGCTGCTGAAGCTGGG - Intergenic
908514445 1:64877840-64877862 CAGCTGAGCCTTCTGGCTATTGG - Intronic
910244316 1:85122441-85122463 GCTCTGAGCCTGCTAGAGATAGG - Intronic
911051496 1:93675527-93675549 CAGCTGAGCCTGCTGGTGTATGG - Intronic
915366464 1:155319647-155319669 AAGAAGATCCTGCTGGAGATGGG + Exonic
917673010 1:177291899-177291921 TAGCTAAGAATGTTGGAGATGGG - Intergenic
917980819 1:180267887-180267909 TAGGTGAGCCAGCTGGAGCTGGG + Intronic
918743090 1:188161926-188161948 TAGCTGGGCGTGCTGGTGAGTGG + Intergenic
919684129 1:200466160-200466182 AAGCTGAGTCTGGTGGAGAAAGG - Intergenic
921054513 1:211534042-211534064 TAGCTGAGCATGGTGGTGCTCGG + Intergenic
921071320 1:211660550-211660572 AAGAAGATCCTGCTGGAGATGGG - Intronic
922751785 1:228073492-228073514 TAGCTGGGCCTGCAGGTGATGGG + Intergenic
1063157809 10:3396293-3396315 AACCTGAGCCTGCTGCAGACAGG + Intergenic
1064966594 10:21020788-21020810 TAGGGGAGCCTGCAGGAGACAGG - Intronic
1065918570 10:30371792-30371814 AGGCAGATCCTGCTGGAGATGGG - Intronic
1066565957 10:36722424-36722446 AAGCTGAGCCTCCAGGAGTTGGG - Intergenic
1069798864 10:71070126-71070148 CAGCTGGGCCTGTTGGAGCTGGG + Intergenic
1070680755 10:78447532-78447554 GAGGTGAGCTTGCTGGAGTTAGG + Intergenic
1074153677 10:110780869-110780891 CAGTTGAGCCAGCTGGAGACTGG - Exonic
1074326705 10:112457577-112457599 CAGGTGGGCCTGGTGGAGATGGG + Intronic
1074430045 10:113386718-113386740 GAACTCAGCCTGCTGGAGAAAGG - Intergenic
1077232676 11:1465042-1465064 CAGCGGGGCCTGCTGGAGAGCGG + Intergenic
1078937246 11:15962927-15962949 GTGGGGAGCCTGCTGGAGATGGG + Intergenic
1080840211 11:35977085-35977107 TTTCAGAGCCTGCTGGAGGTAGG + Intronic
1083388985 11:62334253-62334275 TAGCTGAGACTGGTGGGGATGGG + Intergenic
1083675843 11:64324221-64324243 TGGCTGAGCTTGCTGGAGTGAGG + Intergenic
1083677666 11:64335657-64335679 TAGCTGGGCGTGGTGGTGATGGG + Intergenic
1086330595 11:85750031-85750053 AAGCTGAGCCTGCTGGCAAGTGG - Intronic
1086566406 11:88231484-88231506 TAGGAGAGCCTCCTGGACATGGG - Intergenic
1088971785 11:114780381-114780403 GAGCTGTGCCTGCAGGAAATGGG + Intergenic
1091171090 11:133520333-133520355 AAGCTGAGCCTGCTGGATTAGGG + Intronic
1094495982 12:30989634-30989656 AAGCTGAGCATGTTGGAGGTGGG - Intronic
1097177596 12:57152308-57152330 TAGCTGCGCCAGCTGGTGCTGGG + Intronic
1097450189 12:59728577-59728599 TAGCTGAGCGTGGTGGAGCATGG + Intronic
1098060438 12:66555178-66555200 GTGCTGAGCCACCTGGAGATGGG - Intronic
1102016893 12:109654154-109654176 TAGCTGAGGCTGGGGGAGGTGGG + Intergenic
1103204654 12:119119002-119119024 TAGCTGACACTTTTGGAGATGGG + Intronic
1103795250 12:123498902-123498924 TAGCTGATGATGCTAGAGATGGG + Intronic
1104915149 12:132260599-132260621 TACCCGAGCCTGCTGGAGTCAGG + Intronic
1104943757 12:132406573-132406595 TAGCTGAGCCGCCTTGAGCTGGG + Intergenic
1105776827 13:23670031-23670053 CAGCTGAGCCTGCTCCAGAGGGG + Intronic
1106339639 13:28816639-28816661 TACATGAGCATACTGGAGATTGG + Intergenic
1106667326 13:31865352-31865374 TAGCTGATCCAGGTGGAGCTTGG + Intergenic
1106771775 13:32968336-32968358 GTGCTGAGCCTGTAGGAGATGGG - Intergenic
1107976512 13:45693603-45693625 CAACTGAACCTGCTGGGGATAGG + Intergenic
1108451669 13:50572731-50572753 TTCCTGAGCGTGGTGGAGATGGG + Intronic
1108705068 13:52977896-52977918 GAGCTGAGCCTCCAAGAGATTGG - Intergenic
1113213225 13:108007058-108007080 TAGAAGAGCCTGCTGCATATGGG - Intergenic
1114306558 14:21429030-21429052 TATCTGAGCCTGCTGTACAGAGG + Exonic
1115707179 14:36011323-36011345 TAGGAGAGCATGCTGGAGAGTGG - Intergenic
1115879188 14:37895644-37895666 TAGCTAAGCCTGCTCTAGCTTGG - Intronic
1118384304 14:65243069-65243091 GAGCTGAGCCTGATGTAAATAGG + Intergenic
1118774424 14:68964827-68964849 GAGATGAGCCTGCAGGAGAGAGG - Intronic
1121312824 14:92944359-92944381 TGGCTGAGCCTGGCGGAGACTGG - Intronic
1121985897 14:98505192-98505214 TATCTGAGATTGCTGGAGGTAGG - Intergenic
1122393383 14:101406216-101406238 GAGCTGGGCCTGCTGGAGAAAGG + Intergenic
1122437508 14:101710083-101710105 CAGCTGAGGCTGCAGGAGAGAGG + Intergenic
1122837210 14:104436171-104436193 GAGCTGAGCCTCCTGCAGATGGG + Intergenic
1122977936 14:105178613-105178635 GGGCTGAGCGTGCCGGAGATGGG - Intronic
1123111968 14:105876199-105876221 GTTCTGAGCCTCCTGGAGATGGG + Intergenic
1124208069 15:27740259-27740281 AAGCTGGCCCTGCTGGAAATAGG - Intergenic
1125591096 15:40854822-40854844 AAGCTGAGCCATCTGGAGAACGG - Intronic
1125854950 15:42939669-42939691 AAGAAGATCCTGCTGGAGATGGG - Intergenic
1125875490 15:43140510-43140532 AAGAAGATCCTGCTGGAGATGGG - Intronic
1126061881 15:44790789-44790811 TAGCAGAGTCTACTGGGGATTGG - Intergenic
1126699294 15:51353492-51353514 TAGCTGAGCCAGTCGGAGAGTGG - Intronic
1126990933 15:54374586-54374608 TTTCTGAGCCTGCTGAAGAAGGG + Intronic
1128330065 15:66749891-66749913 CAGTGGAGCCTGCTGCAGATTGG + Intronic
1128620125 15:69141690-69141712 GAGCTGTGCCTGCTGTACATGGG - Intergenic
1128649739 15:69401745-69401767 TAACAGAGTCTGCTGGAGGTGGG + Intronic
1130349971 15:83082949-83082971 AGGCTGAGCCAGCTGGAGAGTGG + Intergenic
1131095021 15:89649301-89649323 GTGCTGAGCCTCCTGGAGATGGG - Exonic
1134704275 16:16291280-16291302 AAGCTGTGCCTGCTGGGGCTTGG + Intronic
1134963268 16:18420834-18420856 AAGCTGTGCCTGCTGGGGCTTGG - Intronic
1134967563 16:18503433-18503455 AAGCTGTGCCTGCTGGGGCTTGG - Intronic
1135877248 16:26214211-26214233 TAGCTTTGACTGGTGGAGATTGG + Intergenic
1136246722 16:28980462-28980484 CTGCTGAGCCTGCAGGAGACTGG + Intronic
1136389051 16:29950847-29950869 TTGCTGAGCTTCCTGGAGCTAGG + Intronic
1137023291 16:35451329-35451351 TGGCTGTGCGTGCTGGAGTTTGG - Intergenic
1137559469 16:49493464-49493486 CAGCTGTGCCTGCTGGGGATTGG - Intronic
1139472737 16:67186922-67186944 GATCTGACCCTGCTGGAGATGGG + Intronic
1141374762 16:83520387-83520409 TAGGAAAGCCTGCTGGAGACTGG + Intronic
1143522329 17:7451849-7451871 TAGCTGAGCTTGCTGGAGTGAGG - Intronic
1145308543 17:21688778-21688800 CAGCTGAGCCTGGGGGTGATGGG - Intergenic
1146180951 17:30697881-30697903 GAGCTGAGCGTGTTTGAGATGGG - Intergenic
1147299646 17:39515775-39515797 TAGCTGAGCCAGTTCCAGATTGG - Exonic
1148831156 17:50432470-50432492 AAGGTGGGGCTGCTGGAGATGGG + Intronic
1149567325 17:57649609-57649631 TGGCTGGGCTTGCGGGAGATGGG - Intronic
1149613351 17:57975291-57975313 TAGCCTGGCCTGCTGGAGGTTGG - Intronic
1153228349 18:2914389-2914411 GAGCTGTGTCTGCTGGAGATTGG - Exonic
1153770592 18:8412472-8412494 TTGATGAGCCTGTTGGAGAGGGG - Intergenic
1155226856 18:23736900-23736922 TGGCTGAGCATTCTGGAGAGGGG - Intronic
1156294683 18:35778745-35778767 CAGCTGAGACTGCTGAAGAAGGG - Intergenic
1157297165 18:46454316-46454338 TAGCTGACCCTGCTAGAAAAAGG - Intronic
1157365091 18:47057561-47057583 TAGCTAACTCTGATGGAGATGGG - Intronic
1160224323 18:77000616-77000638 GAGCTCCGCCTGCTGGTGATGGG - Intronic
1162977632 19:14217651-14217673 GAGCTGAGCGTGTTTGAGATGGG + Intergenic
1163653320 19:18531646-18531668 TGGTTGAGCCAGCTGGAGCTGGG - Intergenic
1166662911 19:44658813-44658835 TTTCTGATCCTGCTGGGGATCGG + Exonic
1167277979 19:48550345-48550367 CAGCTCAGCCTCCTGGAGACGGG + Intergenic
1167582040 19:50350737-50350759 GAGCTGAGCCACCTGGAGGTGGG + Intronic
925794177 2:7524953-7524975 TGGCTGAGCCAACTGGACATGGG - Intergenic
927436597 2:23071865-23071887 AAGCTGAGCACGCTGGAGGTGGG - Intergenic
928633197 2:33215472-33215494 TAGCTGAGCCTTCTGTGGTTTGG + Intronic
928898936 2:36297132-36297154 GAGCTGACCTTGCTGGAGCTAGG - Intergenic
929959457 2:46485368-46485390 TAGCTGAACCTGGTGGACAAGGG + Intergenic
930179485 2:48338545-48338567 TAGCTGGGCCTGGTGGCGAGCGG - Intronic
930346522 2:50189351-50189373 CACCTGAGCCTGCTGGGGGTTGG + Intronic
931641144 2:64382141-64382163 TAGCAGAGACTGGGGGAGATGGG - Intergenic
931855654 2:66299453-66299475 TAGCTGAGCCTCCTGCAGAATGG + Intergenic
937934405 2:127230999-127231021 CAGCTGTGCCTGCAGGAAATTGG + Intergenic
941353917 2:164465868-164465890 TAGCTGAGCCTAGTGGGGATGGG - Intergenic
942457649 2:176149116-176149138 CTGCTGAGCCGGCTGGAGACCGG - Intergenic
942849577 2:180468028-180468050 TTGCTGAGCCTGTGGGGGATGGG - Intergenic
947545901 2:231010099-231010121 TAGCTGAGCCTGCAAGTTATAGG + Intronic
948711865 2:239830222-239830244 TCCCTGGCCCTGCTGGAGATGGG - Intergenic
948883791 2:240873158-240873180 TCCCTGGGCCTGGTGGAGATGGG - Intronic
948924154 2:241083144-241083166 CAGGAGAGCCTGCTGGGGATGGG + Intronic
1168910615 20:1443903-1443925 TCGCTGATCCTGCAGGAGTTGGG + Exonic
1170851423 20:20008303-20008325 TTGCTGAGTTTGCTGGAGAGTGG + Intergenic
1171416218 20:24982468-24982490 AAGCAGAGCCTACTGGGGATTGG - Intronic
1172578944 20:36031537-36031559 GTGCTGAGGCTGCTGGAGACAGG - Intergenic
1174146964 20:48458947-48458969 TAGCAGCGCCTGATGGAGTTGGG - Intergenic
1174423403 20:50415604-50415626 TAGCTCAGCTGGCTGGAGAGTGG - Intergenic
1174532176 20:51222690-51222712 CAGCTGCACCTGCTGGAGCTGGG - Intergenic
1178476795 21:32944250-32944272 ATGCTGAGCCAGCTTGAGATTGG - Intergenic
1181313414 22:21957532-21957554 TCGCTGAGCATGCTGGGCATCGG - Exonic
1181346520 22:22223604-22223626 TCGCTGAGCATGCTGGGCATCGG - Intergenic
1182234979 22:28867902-28867924 TAGCTGAGCCTGGAAGAGAGGGG + Intergenic
1182627671 22:31659907-31659929 TCTCTGAGCCTGCTGTAGTTTGG - Intronic
1184512912 22:44943496-44943518 TAGCTGAGCCTGCTGGAGATCGG - Intronic
1185103395 22:48853733-48853755 GAGCTGGGCCTGCTGGGGATGGG + Intergenic
950248438 3:11443185-11443207 CAGCTGAGCAGGCTGGAGGTGGG - Intronic
950362366 3:12458838-12458860 CAGTTGAGCTTGATGGAGATGGG - Intergenic
950454660 3:13085537-13085559 CAGCAGAGCCTGCAGGAGACGGG + Intergenic
951607328 3:24450716-24450738 AAGCTGAGCCTACTATAGATTGG - Intronic
951827836 3:26888041-26888063 CAGCTGGGCCTGCTGGAGGGTGG + Intergenic
952526400 3:34215119-34215141 TAGCAGAGTCTACTGGGGATTGG + Intergenic
952746703 3:36788273-36788295 TAGCTGAGACTACTAGTGATGGG + Intergenic
953093274 3:39750288-39750310 TTGCTGGGCCTCCTGGAGAAGGG + Intergenic
954007213 3:47601421-47601443 TGGCTGAGTCTCCTGGAGAATGG + Intronic
954414451 3:50386257-50386279 CAGTTGAGGCTGCTGGAGGTAGG + Intronic
956314084 3:67914754-67914776 GAGCTGAGCCTTCTGGAGGGTGG - Intergenic
960994568 3:123332425-123332447 GAGCAGAGCCTGCTGGTGATGGG - Intronic
961396672 3:126598174-126598196 TAGCTGGGCCTGCTTGTGGTGGG - Intronic
963996052 3:151709696-151709718 GTGCTGAGCCTCCTGGAGCTAGG - Intergenic
964411955 3:156407192-156407214 CAGGTGAGTCTGCTGGAGTTTGG - Intronic
967110447 3:186288733-186288755 TACCTGTCCCTGCTGGAGACGGG - Exonic
967993322 3:195148020-195148042 TAGCGGGGGCTGCTGAAGATCGG - Intronic
969939982 4:10722376-10722398 CAGCTGAGCTAGCGGGAGATGGG - Intergenic
970158963 4:13170224-13170246 TAGCTGAGCCTGAAGGACAGTGG + Intergenic
970541277 4:17082359-17082381 TTGCGGAGCCAGCTGGGGATGGG - Intergenic
971459033 4:26874081-26874103 TAGCTGAGCGAGCTGCAGCTTGG + Intronic
977111971 4:92968152-92968174 TAGCTGAGCCTCATGAACATAGG - Intronic
978584730 4:110265132-110265154 GAGCTGAGACTGCTGAAGCTGGG + Intergenic
978884453 4:113750364-113750386 TAGGTGAGCCTGCTAGAGAAGGG - Intronic
980857048 4:138453113-138453135 CAGACTAGCCTGCTGGAGATGGG + Intergenic
981235055 4:142405908-142405930 AAGCTAAGCCTGGAGGAGATGGG + Intronic
982335837 4:154236643-154236665 TAGCTCAGGCTGCTGAAGTTTGG + Exonic
982827479 4:160019134-160019156 AAGCTGAGCCTGCTGGAAATGGG - Intergenic
985109891 4:186538163-186538185 TAGCTGGGGCTGTGGGAGATGGG - Intronic
985934055 5:3080843-3080865 TAGATGAGTCAGATGGAGATAGG + Intergenic
988721718 5:33885743-33885765 TGACTGAGACTGCTGGAGATGGG + Intronic
989812699 5:45696340-45696362 AAGCTGAGGCTGCCGGAGCTAGG + Intergenic
992684820 5:79189043-79189065 TAGCTGGGCATGGTGGAGAAAGG - Intronic
992968195 5:82025505-82025527 GTGCTGAGCCTGGGGGAGATAGG + Intronic
994891174 5:105639162-105639184 TAGCTGTAGCTGCTGGAGACAGG - Intergenic
994957096 5:106546050-106546072 AAGCTGAGACTGCTGCAGAGTGG + Intergenic
995101452 5:108311968-108311990 TAGCTGAAGCTACAGGAGATGGG - Intronic
996531530 5:124532623-124532645 CAGGAGATCCTGCTGGAGATAGG - Intergenic
996634057 5:125669245-125669267 TACCTGAGCCTGCTTAGGATTGG - Intergenic
998419520 5:141970757-141970779 GAGCTGAGACTGCTGAAGCTGGG - Exonic
998566765 5:143222818-143222840 TAGCTAAGCCTGCTGGGGCTGGG + Exonic
999393860 5:151214157-151214179 TAGCTGAGCCTGTAGGGGAGAGG + Intronic
1001777519 5:174339732-174339754 TAGGTGAGCCTGCTGGGAGTGGG - Intergenic
1002319178 5:178364888-178364910 TGGCTGTGCCTGCTGGAGGCTGG - Intronic
1006018477 6:31102507-31102529 TTGCTGAGCCACCTGGAGCTGGG + Intergenic
1006925568 6:37652432-37652454 TAGCTGGCCCTTCTGGGGATAGG + Intronic
1007402066 6:41608545-41608567 CTGCTGAGTCTGCTGGAGAAGGG - Intergenic
1009191978 6:60640087-60640109 TAGCTTAGCCTGTTAAAGATTGG + Intergenic
1009350995 6:62678464-62678486 TAGCTGAGTCCACTGGGGATTGG + Intergenic
1009911684 6:69937663-69937685 TGGCTGAGCCAGATGGGGATGGG + Intronic
1013673325 6:112429564-112429586 GTGCTGAGCTTCCTGGAGATGGG + Intergenic
1014879477 6:126704975-126704997 TAACTGAACCTGCTGGAGTTGGG + Intergenic
1016778356 6:147930863-147930885 TAGCTGTGCCTGCAGCCGATTGG + Intergenic
1018391311 6:163343804-163343826 TTCCTGAGCCTCCTGCAGATAGG + Intergenic
1019351734 7:557166-557188 CTGCTGATCCTGGTGGAGATGGG - Intronic
1021412226 7:20341663-20341685 CAGCATAGCCAGCTGGAGATTGG + Intronic
1030491486 7:110240555-110240577 TATCTGAGCCTCCAGGAGGTTGG - Intergenic
1031160173 7:118157031-118157053 TAGGTCAGCCTGCTCTAGATTGG + Intergenic
1032237209 7:130135787-130135809 AAGCTGAGCCTGGTGGAGGTGGG - Intergenic
1033676498 7:143545304-143545326 GAGCTGATCCTTCTGGAGAAAGG + Intergenic
1033695335 7:143784135-143784157 GAGCTGATCCTTCTGGAGAAAGG - Intergenic
1035459278 7:159029355-159029377 TTGCTGAGCCAGCTGCAGAAGGG - Exonic
1036645729 8:10610760-10610782 CAGCTGAGCCTCCTGGCCATGGG + Exonic
1036652594 8:10654860-10654882 TGGCTGACCCTGCGGGACATAGG + Intronic
1037725250 8:21478093-21478115 AAGCTGAGGCAGCTGGACATAGG + Intergenic
1037873931 8:22528149-22528171 TAGCTAAGCCTGTTGGACGTAGG + Intronic
1038216261 8:25564380-25564402 AAGCTGAGCCTGTTGGACAGAGG - Intergenic
1039327160 8:36498227-36498249 TTGCTGAGCCTGCAGGTGACAGG - Intergenic
1040391342 8:46953304-46953326 GAGCTGCGCCTGCTGGATACAGG - Intergenic
1042715403 8:71766529-71766551 TAGCAGAGTCTTCTGGAAATGGG + Intergenic
1043870407 8:85425533-85425555 CAGCTGAGACATCTGGAGATGGG - Intronic
1046294034 8:112197497-112197519 TAGCTTAGCCTGGTGAAGAGGGG - Intergenic
1048203311 8:132394947-132394969 GAGCTGGGCCTGCTGGTAATGGG + Intronic
1049788022 8:144460465-144460487 TAGCTGGACCTGGTGGTGATGGG - Intronic
1050061225 9:1711789-1711811 GAGCTGAGCTGGATGGAGATGGG + Intergenic
1051071394 9:13172529-13172551 TAGCTGAGCGTGGTGGTGGTGGG - Intronic
1051391525 9:16569860-16569882 TGGCTGAGGCAACTGGAGATTGG - Intronic
1051465180 9:17368627-17368649 TTGCTGAGCCTTCTGGAGCTGGG - Intronic
1051893409 9:21965686-21965708 CAGCGGAGCCTGCTGGCGAGTGG + Intronic
1057694820 9:97315642-97315664 GAGCTGAGCTTGCTGGAAAAGGG + Intronic
1059723671 9:116985779-116985801 GAGCTGAGCCTGCCGGTGAGAGG + Intronic
1186691898 X:11986172-11986194 GTGCTGAGCCTCCTGGAGCTGGG - Intergenic
1187636735 X:21237782-21237804 TTGCTGAGCCACCTGGAGCTAGG - Intergenic
1187636939 X:21239067-21239089 TCGCTGAGCCACCTGGAGCTGGG - Intergenic
1189776705 X:44476382-44476404 AAGAAGATCCTGCTGGAGATGGG - Intergenic
1190009416 X:46771129-46771151 TGGCTGAGCCTCAGGGAGATAGG - Intergenic
1190304119 X:49072782-49072804 CAGATGGGCCTGCTGGAGATAGG - Intronic
1191793118 X:64992304-64992326 AATCTGAGCCTGTCGGAGATTGG - Intronic
1192413225 X:70953630-70953652 TAGCTTCTCCTGCTGGAGCTGGG - Intergenic
1192930873 X:75804670-75804692 TAGGTGAGCCTCCTGAAGACAGG - Intergenic
1194387890 X:93278949-93278971 GTGCTGAGCTTCCTGGAGATGGG - Intergenic
1195698613 X:107685122-107685144 TACCTGAGCTTGGTTGAGATTGG + Intergenic
1196793266 X:119482921-119482943 TAGCTGAGCTTGGTGGAAAGCGG - Intergenic
1198770462 X:140125467-140125489 GTGCTGAGCCTCCTGGAGCTGGG + Intergenic
1199576655 X:149318978-149319000 TTGCTGAGCCTAATGGATATCGG - Intergenic
1199711842 X:150475032-150475054 TTGCTTAGCCTGCTGGAAGTGGG - Intronic
1200686867 Y:6265762-6265784 CAGTTGAGCCTGCTGGGGACCGG - Intergenic
1200989744 Y:9336678-9336700 CAGTTGAGCCTGCTGGGGACCGG - Intergenic
1200992412 Y:9357011-9357033 CAGTTGAGCCTGCTGGGGACCGG - Intergenic
1200995064 Y:9377289-9377311 CAGTTGAGCCTGCTGGGGACCGG - Intronic
1200997729 Y:9397635-9397657 CAGTTGAGCCTGCTGGGGACCGG - Intergenic
1201000239 Y:9466169-9466191 CAGTTGAGCCTGCTGGGGACCGG - Intergenic
1201002900 Y:9486481-9486503 CAGTTGAGCCTGCTGGGGACCGG - Intronic
1201008219 Y:9527094-9527116 CAGTTGAGCCTGCTGGGGACCGG - Intergenic
1202197035 Y:22307177-22307199 GAGGTAAGCCTGCTGGACATAGG + Intergenic