ID: 1184513303

View in Genome Browser
Species Human (GRCh38)
Location 22:44945580-44945602
Sequence ATCCCCTGCACCTGGGCTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 461
Summary {0: 1, 1: 0, 2: 2, 3: 37, 4: 421}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184513298_1184513303 -8 Left 1184513298 22:44945565-44945587 CCCCACACTGCTCAGATCCCCTG 0: 1
1: 0
2: 1
3: 25
4: 300
Right 1184513303 22:44945580-44945602 ATCCCCTGCACCTGGGCTGCAGG 0: 1
1: 0
2: 2
3: 37
4: 421
1184513290_1184513303 17 Left 1184513290 22:44945540-44945562 CCTGGCTCCAGCCCCAGCCCCAA 0: 1
1: 7
2: 52
3: 442
4: 1615
Right 1184513303 22:44945580-44945602 ATCCCCTGCACCTGGGCTGCAGG 0: 1
1: 0
2: 2
3: 37
4: 421
1184513296_1184513303 -1 Left 1184513296 22:44945558-44945580 CCCAAATCCCCACACTGCTCAGA 0: 1
1: 0
2: 1
3: 21
4: 261
Right 1184513303 22:44945580-44945602 ATCCCCTGCACCTGGGCTGCAGG 0: 1
1: 0
2: 2
3: 37
4: 421
1184513292_1184513303 6 Left 1184513292 22:44945551-44945573 CCCCAGCCCCAAATCCCCACACT 0: 1
1: 0
2: 6
3: 63
4: 568
Right 1184513303 22:44945580-44945602 ATCCCCTGCACCTGGGCTGCAGG 0: 1
1: 0
2: 2
3: 37
4: 421
1184513297_1184513303 -2 Left 1184513297 22:44945559-44945581 CCAAATCCCCACACTGCTCAGAT 0: 1
1: 0
2: 1
3: 21
4: 226
Right 1184513303 22:44945580-44945602 ATCCCCTGCACCTGGGCTGCAGG 0: 1
1: 0
2: 2
3: 37
4: 421
1184513293_1184513303 5 Left 1184513293 22:44945552-44945574 CCCAGCCCCAAATCCCCACACTG 0: 1
1: 0
2: 2
3: 53
4: 428
Right 1184513303 22:44945580-44945602 ATCCCCTGCACCTGGGCTGCAGG 0: 1
1: 0
2: 2
3: 37
4: 421
1184513299_1184513303 -9 Left 1184513299 22:44945566-44945588 CCCACACTGCTCAGATCCCCTGC 0: 1
1: 0
2: 3
3: 22
4: 256
Right 1184513303 22:44945580-44945602 ATCCCCTGCACCTGGGCTGCAGG 0: 1
1: 0
2: 2
3: 37
4: 421
1184513289_1184513303 18 Left 1184513289 22:44945539-44945561 CCCTGGCTCCAGCCCCAGCCCCA 0: 1
1: 10
2: 45
3: 468
4: 1818
Right 1184513303 22:44945580-44945602 ATCCCCTGCACCTGGGCTGCAGG 0: 1
1: 0
2: 2
3: 37
4: 421
1184513295_1184513303 0 Left 1184513295 22:44945557-44945579 CCCCAAATCCCCACACTGCTCAG 0: 1
1: 0
2: 4
3: 31
4: 372
Right 1184513303 22:44945580-44945602 ATCCCCTGCACCTGGGCTGCAGG 0: 1
1: 0
2: 2
3: 37
4: 421
1184513294_1184513303 4 Left 1184513294 22:44945553-44945575 CCAGCCCCAAATCCCCACACTGC 0: 1
1: 0
2: 3
3: 48
4: 565
Right 1184513303 22:44945580-44945602 ATCCCCTGCACCTGGGCTGCAGG 0: 1
1: 0
2: 2
3: 37
4: 421
1184513300_1184513303 -10 Left 1184513300 22:44945567-44945589 CCACACTGCTCAGATCCCCTGCA 0: 1
1: 0
2: 3
3: 25
4: 327
Right 1184513303 22:44945580-44945602 ATCCCCTGCACCTGGGCTGCAGG 0: 1
1: 0
2: 2
3: 37
4: 421
1184513291_1184513303 10 Left 1184513291 22:44945547-44945569 CCAGCCCCAGCCCCAAATCCCCA 0: 1
1: 0
2: 21
3: 191
4: 1235
Right 1184513303 22:44945580-44945602 ATCCCCTGCACCTGGGCTGCAGG 0: 1
1: 0
2: 2
3: 37
4: 421

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184513303 Original CRISPR ATCCCCTGCACCTGGGCTGC AGG Intronic
900217800 1:1490924-1490946 AGCCCGGGCACCTGGGATGCTGG - Intronic
900362287 1:2294878-2294900 ATCCCCTGTGCCTGGGTTGGAGG + Intronic
900424823 1:2571905-2571927 ATCGCTTGAACCTGGGATGCAGG + Intergenic
901418991 1:9137446-9137468 CTCCTCTTCACCTGGGCAGCTGG - Intergenic
901859132 1:12063187-12063209 GCCCGCCGCACCTGGGCTGCGGG - Intergenic
902440197 1:16424501-16424523 ATCCCCTGAGCCTGGGGTCCAGG - Intronic
902763837 1:18601742-18601764 GTCTCCTGGACCAGGGCTGCAGG - Intergenic
902774849 1:18668026-18668048 AACCCCTGCTCCTGGGCTCCTGG - Intronic
903259947 1:22126221-22126243 CTCCCCTGCTCCTGGCCTGGAGG - Intronic
903879152 1:26497007-26497029 ACTCCCTGCAGCTGGGCAGCAGG - Intergenic
903890805 1:26569245-26569267 ATCCACTGCACCTCGGCGGGTGG - Intronic
904291858 1:29491559-29491581 ATCCCTTGAACCTGGGAGGCAGG - Intergenic
904504874 1:30943579-30943601 ATCCCCTGCTCATGGTCTTCTGG + Intronic
904625880 1:31801880-31801902 AGCCACTGCACCTGGCCTGATGG - Intronic
905478391 1:38244892-38244914 AGTCCCTGCACCTGGGCAGGGGG + Intergenic
905790455 1:40786494-40786516 ATGCCCTGGCCCTGGGCTCCCGG - Intronic
907530341 1:55089189-55089211 AGCCACTGCACCTGGCCTACCGG + Intronic
907673604 1:56498717-56498739 ATCCCTTGAACCTGGGTGGCAGG - Intronic
907838283 1:58132128-58132150 ATCTCCTGCACCTGGCTTGGAGG - Intronic
909358049 1:74732037-74732059 ATCCCCCACAGCTGGGCTGTGGG + Intronic
909358074 1:74732136-74732158 ATCCCCTACAGCTGGGCTGTGGG + Intronic
909358111 1:74732286-74732308 ATCCCCCACAGCTGGGCTGTGGG + Intronic
909358150 1:74732435-74732457 ATCCCCTACAGCTGGGCTGTGGG + Intronic
909887558 1:80961898-80961920 ATTCACTGCACCTGGGCTGCAGG - Intergenic
912497652 1:110101858-110101880 ATCTCCTCCTCCTGGGATGCTGG + Intergenic
914350538 1:146835982-146836004 CTCTCCTGCAGCAGGGCTGCAGG + Intergenic
915030928 1:152879868-152879890 AGCCCCTGGACCTGGGCTCCAGG + Intronic
915073689 1:153292477-153292499 ACACCCTGCCCCAGGGCTGCGGG - Intergenic
915335453 1:155138360-155138382 ACCCACTGCACCTGGGAAGCTGG - Exonic
916224014 1:162472115-162472137 AGCCACTGCACCTGGCCAGCAGG - Intergenic
916568000 1:165998566-165998588 CTACCCTGCACGTGTGCTGCTGG - Intergenic
916724021 1:167506980-167507002 ATCACTTGAACCTGGGATGCAGG - Intronic
917556008 1:176089205-176089227 ATCACTTGAACCAGGGCTGCAGG + Intronic
917995877 1:180437952-180437974 GTCCCCAACCCCTGGGCTGCAGG + Intronic
918125977 1:181584022-181584044 ACCCTCTTCACCTGGGCTGGAGG + Intronic
918451280 1:184661534-184661556 ATAGCCTGCACCTGAGCTCCTGG + Intergenic
920054100 1:203180408-203180430 ATCACCTTCCCCAGGGCTGCTGG + Intronic
920311061 1:205048525-205048547 CACCCCTGCACCAGGGCAGCTGG + Intronic
922217542 1:223532633-223532655 ACCCTCTGCACCTGGGTTACAGG - Intergenic
922693410 1:227712600-227712622 AGCCACTGCACCTGGCCTGATGG - Intergenic
923150822 1:231231820-231231842 ATCCCCTGCACCTTGGCTGTGGG + Intronic
923456556 1:234170050-234170072 AGCCACTGCACCTGGCCTCCAGG + Intronic
924504801 1:244672045-244672067 AGCCACTGCACCTGGCCTGGAGG - Intronic
924586940 1:245368372-245368394 ATCCCCTGCATCAGGGGTGTGGG + Intronic
1064230349 10:13524556-13524578 ATCGCCTGAACCTGGGAGGCAGG + Intronic
1064430775 10:15268152-15268174 ATCCCCTGGCCCTGGGCCTCTGG - Intronic
1066298321 10:34075446-34075468 CTCCCAGGGACCTGGGCTGCTGG + Intergenic
1066555202 10:36605109-36605131 ATCACTTGAACCTGGGCGGCAGG - Intergenic
1066648979 10:37637981-37638003 ATGCCCTGCACATGGGGTGCAGG - Intergenic
1067040561 10:42951247-42951269 AGCCCCTTCACCTGGGCCTCGGG - Intergenic
1067100814 10:43333177-43333199 ATCCCCTCCAACAGGACTGCTGG + Intergenic
1067174208 10:43931042-43931064 ATGCATTGCACCTGGGCTGCTGG + Intergenic
1067548191 10:47211913-47211935 ATCCCTTGAACCTGGGAGGCGGG - Intergenic
1069383697 10:67865161-67865183 AGCCATTGCACCTGGCCTGCAGG - Intergenic
1070640322 10:78164228-78164250 GTCCCAGGCACCTGGGCTTCAGG + Intergenic
1070951047 10:80430981-80431003 ATCCCTTGAACCTGGGAGGCTGG - Intronic
1071289358 10:84177261-84177283 GTTCCCTGCACAGGGGCTGCAGG + Intronic
1072121296 10:92407586-92407608 ATCCCTTGAACCTGGGAGGCGGG - Intergenic
1072508101 10:96090306-96090328 AGCGGCTGCAGCTGGGCTGCTGG + Intergenic
1072924663 10:99606440-99606462 GTCTCCTGTATCTGGGCTGCTGG + Intergenic
1073033742 10:100548603-100548625 CCCCACTGCATCTGGGCTGCAGG + Exonic
1074357613 10:112799871-112799893 CACCCCTCCACCTGGGCTGGGGG + Intronic
1075071722 10:119324339-119324361 AGCCACTGCACCTGGCCGGCAGG - Intronic
1076475426 10:130748510-130748532 CGCTCCTGCATCTGGGCTGCAGG + Intergenic
1076553999 10:131310704-131310726 TTCCCCTGCCCCAGGCCTGCCGG - Intronic
1076675818 10:132147271-132147293 ATCCCCTGAAGCTGAGCTCCAGG - Intronic
1076829171 10:132985715-132985737 ACCCCCTGCACCCCCGCTGCTGG - Intergenic
1077247344 11:1546192-1546214 CCGCCCTGCACCTGGGCTGGGGG + Intergenic
1077328264 11:1972959-1972981 ATCCCCGGGTCCTGGGCTCCTGG - Intronic
1078507703 11:11964945-11964967 AGGTCCTGCCCCTGGGCTGCGGG - Intronic
1080431598 11:32204709-32204731 AGCCACTGCACCTGGCCTGGAGG + Intergenic
1082085831 11:48048706-48048728 ATCTCCTGAACCTGGGAGGCAGG + Intronic
1083411120 11:62493096-62493118 ATCCCTTGAACCTGGGAGGCTGG - Intronic
1083993905 11:66262814-66262836 ATCCCCTCCTCCTGGGCTAGGGG - Exonic
1084048581 11:66585662-66585684 ATCCCTTGAACCTGGGAGGCAGG - Intergenic
1084168771 11:67390235-67390257 TTCCCCTTCCCCTGGGCTTCCGG - Intronic
1084291826 11:68176188-68176210 AGCCACTGCGCCTGGCCTGCAGG + Intronic
1084927046 11:72522303-72522325 TTCCCTTGGACCTGGGCTGCTGG + Intergenic
1085153187 11:74268437-74268459 AGCCCCAGGACCTGGGGTGCAGG - Intronic
1088876593 11:113941581-113941603 ACCCCCTGCATCTGTGCTCCTGG + Intronic
1088952327 11:114584383-114584405 ATCACCTGCATTTGGACTGCAGG - Intronic
1089375866 11:117994212-117994234 AACGCGTGCACCTGGGATGCTGG + Intronic
1089900179 11:121974300-121974322 AGCCACTGCACCTGGCCAGCTGG - Intergenic
1090027916 11:123183514-123183536 AGCCACTGCACCTGGCCTGAGGG + Intronic
1090457574 11:126863170-126863192 TTCTGCAGCACCTGGGCTGCTGG + Intronic
1091237224 11:134030498-134030520 ATCCCCTGCACCTGGTGTTCTGG + Intergenic
1091755233 12:3047031-3047053 GTCCCCAACCCCTGGGCTGCAGG + Intergenic
1092028977 12:5268228-5268250 ATCCCCTACCCATGGGCTCCTGG + Intergenic
1092117236 12:6018356-6018378 CTCCCCTGCACCTGGTATGCTGG - Exonic
1094829271 12:34292477-34292499 ATACTCTACACATGGGCTGCTGG + Intergenic
1095096940 12:38153994-38154016 AGCCCCTGCACCTGGCCAGGGGG + Intergenic
1095412003 12:41934661-41934683 AGCCACTGCATCTGGCCTGCTGG - Intergenic
1095460463 12:42438685-42438707 ATCACCTGAACCTGGGAGGCAGG - Intronic
1096807337 12:54148756-54148778 CTTCCCTCCACCTTGGCTGCTGG + Intergenic
1097292628 12:57931801-57931823 AGCCACCGCACCTGGCCTGCTGG - Intergenic
1097938361 12:65278429-65278451 CTCCTCTGCCCCAGGGCTGCCGG - Intergenic
1099227904 12:79991902-79991924 AGCCACTGCACCTGGTCTGTAGG - Intergenic
1101044882 12:100794701-100794723 CTCCCCTGCACCTGGGGAGGGGG + Intronic
1101130641 12:101687684-101687706 AGACCCAGCAGCTGGGCTGCAGG - Intergenic
1101304897 12:103518569-103518591 CTCCCTTGTACCTGGGATGCAGG - Intergenic
1101875473 12:108594098-108594120 ATCTCCAGCACCTGGGCCTCAGG + Intronic
1102387178 12:112519876-112519898 AGATCCTGCACCAGGGCTGCAGG + Intergenic
1102680035 12:114684931-114684953 CTCCCCTGCGTCTGGGCTGGGGG + Intergenic
1103704875 12:122866008-122866030 ATCCTCTGCCCCTGGGTGGCTGG - Exonic
1103922114 12:124404475-124404497 AGCCCCTGCACCTAGGCTGGTGG + Intronic
1104062494 12:125280557-125280579 CTCCCCTGGACCTAGGCTGCCGG + Intronic
1104823475 12:131692525-131692547 TTCCCATGCACCTGAGCTGGAGG - Intergenic
1105243685 13:18628926-18628948 CTCCCCTGCACCTAGGGTCCGGG - Intergenic
1105406441 13:20136311-20136333 AGCCACTGCGCCTGGCCTGCCGG + Intergenic
1105430903 13:20336554-20336576 ATCACTTGAACCTGGGATGCGGG - Intergenic
1108036408 13:46294553-46294575 ACCCCAGGAACCTGGGCTGCAGG + Intergenic
1109235565 13:59813765-59813787 ATCACTTGAACCTGGGATGCAGG + Intronic
1109745891 13:66622365-66622387 GGCTCCTGCACCGGGGCTGCAGG - Intronic
1111012964 13:82336441-82336463 AGCCACTGCACCTGGCCTTCTGG - Intergenic
1111995998 13:95166899-95166921 AGCCACTGCACCTGGCCTGTGGG - Intronic
1113199876 13:107855276-107855298 ACCCCCGGCCCGTGGGCTGCTGG + Intronic
1113847231 13:113399322-113399344 GGCCACTGCACCTGGGCCGCGGG - Intergenic
1115689654 14:35829225-35829247 AGCCACTGCACCTGGCCTGTTGG + Intronic
1118425578 14:65657305-65657327 ATACCCAGCAGCTGGGTTGCTGG - Intronic
1119422824 14:74517656-74517678 AACCACTGCACCTGGCCTCCTGG + Intronic
1119598100 14:75955271-75955293 AGCTCCTGCACCTGGGGAGCGGG + Intronic
1119601720 14:75981166-75981188 TTGCCCTCCACCTGGCCTGCTGG - Exonic
1119619934 14:76124488-76124510 ACTCCCTGCACCTGGGCAGATGG - Intergenic
1121768420 14:96507959-96507981 ATCACTTGAACCTGGGATGCAGG - Intronic
1121821300 14:96969627-96969649 AACCACTGCACCTGGCCAGCAGG - Intergenic
1121829323 14:97035905-97035927 ATCCCTTGCTCCTGGGCTTCAGG - Intergenic
1122151025 14:99726336-99726358 AACCCCTGCTCTGGGGCTGCTGG + Intronic
1122177720 14:99933459-99933481 AGCCACTGCACCTGGCCTGATGG + Intronic
1122371158 14:101229801-101229823 TTCCCCTGGAGTTGGGCTGCTGG + Intergenic
1122997534 14:105273435-105273457 ATCCCCTGCACCTGCCCAGAGGG + Intronic
1123035559 14:105470463-105470485 ACCCCGTGCCCCTGTGCTGCGGG + Exonic
1123125618 14:105943998-105944020 AGCCACTGCACCCGGGCTCCAGG + Intergenic
1123218957 14:106839243-106839265 GTCCTCTGGTCCTGGGCTGCCGG + Intergenic
1126004090 15:44240096-44240118 ATCTCCTGAACCTGGGAGGCAGG + Intergenic
1126392318 15:48172112-48172134 AGCCACTGCACCTGGCCTGGAGG - Intronic
1127175041 15:56345423-56345445 TTCACCTGAACCTGGGATGCAGG - Intronic
1127264071 15:57347020-57347042 TTCCCTTGTACCTGAGCTGCTGG + Intergenic
1127393219 15:58523194-58523216 ATTCTCTGCACCTTGGCTTCCGG + Intronic
1128738872 15:70069891-70069913 ATCCCCTGCAACACGTCTGCTGG + Intronic
1128874535 15:71191361-71191383 ATCTCCTAGACCTGGGCTGTTGG + Intronic
1129845626 15:78766540-78766562 ACCCCCTCCTCCTTGGCTGCAGG + Exonic
1130919132 15:88329334-88329356 ATTCTCTGCACCTCTGCTGCTGG - Intergenic
1131200272 15:90389600-90389622 AGCCACTGCACCTGGCCTGAAGG + Intronic
1132881153 16:2162279-2162301 GTTCCCTGCACCTGAGCTCCTGG - Intronic
1135146064 16:19963737-19963759 CTTCCTTGCACCTGGGCGGCTGG + Intergenic
1135280933 16:21153014-21153036 GGCTCCTGCACCGGGGCTGCAGG - Intronic
1135294749 16:21269625-21269647 ATCCCCTCCATCAGGGCTTCTGG + Intronic
1136421804 16:30139065-30139087 AGCCACTGCACCTGGCCGGCCGG + Intergenic
1136653463 16:31693558-31693580 ACCCACTGCACTTGGTCTGCTGG + Intergenic
1137645102 16:50066579-50066601 CTCCCCCGCGTCTGGGCTGCGGG + Intronic
1138562966 16:57812934-57812956 ATCCCTTGCACCTGTGCACCTGG - Intronic
1138882283 16:61030972-61030994 ATCACATTCACCTGGACTGCTGG + Intergenic
1139409088 16:66744643-66744665 ATCGCTTGAACCTGGGCAGCAGG - Intronic
1139547615 16:67657010-67657032 AACCCTTGCACCTGGTCTTCTGG - Intronic
1139958484 16:70704598-70704620 ATGCCCTGCTCCAGGCCTGCAGG - Intronic
1140538153 16:75730072-75730094 AGCCACTGCGCCTGGCCTGCAGG + Intronic
1140682131 16:77395439-77395461 ATTCCCTCCACTGGGGCTGCTGG + Intronic
1141082305 16:81062958-81062980 AGCCACTGCGCCTGGTCTGCAGG - Intronic
1141445216 16:84053505-84053527 ATCACCTGCCCCTAGGCTGCTGG - Intergenic
1141764563 16:86049912-86049934 AGCCACTGCCCCTGAGCTGCTGG + Intergenic
1142244423 16:88963023-88963045 ATCCTCAGCACCTGAGCTGCAGG + Intronic
1142418002 16:89953633-89953655 ATCCCCTGCTCCTGGGCATGGGG + Intronic
1142509340 17:384781-384803 ATCCTCTGCAGCCTGGCTGCTGG - Intronic
1142736874 17:1906584-1906606 ATCACCTGCACCTGGTTTACTGG - Intergenic
1143316651 17:6038071-6038093 AGCCACTGCACCTGGCCTGAAGG + Intronic
1143648558 17:8248324-8248346 ATCCCTTGAACCTGGGAGGCGGG - Intronic
1143821594 17:9568782-9568804 AGCCCCTGCACCTGGCCTTAAGG + Intronic
1144409624 17:14988040-14988062 AGCCCCTGCCCCTTGGCTACAGG - Intergenic
1144872231 17:18378378-18378400 ATGCCCTGCACCCAGGCTCCAGG - Intronic
1145063777 17:19748437-19748459 ATCCCCAAAACCTGGGCTGTAGG - Intronic
1146015627 17:29231171-29231193 ATCCCTTGAACCTGGGAGGCAGG + Intergenic
1146183616 17:30711412-30711434 ATCCCCTGCCCCCGGGCCGTGGG - Intergenic
1146371694 17:32268468-32268490 ATGCCCTACACCTGGACTCCAGG - Intronic
1146708641 17:35021378-35021400 TTCTCCTGAACCTGGGCTGGGGG + Exonic
1147915303 17:43882141-43882163 GTCAGCTGCCCCTGGGCTGCAGG + Intronic
1148090881 17:45021930-45021952 GTCCTCTGAGCCTGGGCTGCGGG - Intergenic
1148851338 17:50556926-50556948 ATCCCCTCCAGATGGGCTGGTGG - Intergenic
1149499447 17:57140818-57140840 AGCCACTGCACCTGGCCTCCAGG - Intergenic
1149686606 17:58539132-58539154 CTCCCAAGCAGCTGGGCTGCTGG - Exonic
1150226990 17:63529653-63529675 ATGCCCTGCTCCTGTGATGCAGG - Intronic
1151365168 17:73612272-73612294 CCCAGCTGCACCTGGGCTGCAGG + Intronic
1151365186 17:73612336-73612358 CCCAGCTGCACCTGGGCTGCAGG + Intronic
1151404528 17:73878016-73878038 ATCCCCTGCCCCTGTGCCCCAGG + Intergenic
1152097716 17:78281540-78281562 AGTCCCTTCCCCTGGGCTGCAGG - Intergenic
1152575667 17:81139779-81139801 CTCCTCTGCAACTGGGCTGGAGG + Intronic
1152643884 17:81460113-81460135 GGCCCCCGCTCCTGGGCTGCAGG + Intronic
1152844579 17:82591826-82591848 ATCTCCTGTCTCTGGGCTGCAGG + Intronic
1154445257 18:14430959-14430981 CTCCCCTGCACCTAGGGTCCGGG + Intergenic
1156335624 18:36169008-36169030 ATCGCCTGAACCTGGGAGGCGGG - Intronic
1156360176 18:36377860-36377882 AGGCCCTGGACCTGGGCTTCTGG + Intronic
1157583029 18:48784267-48784289 AGTCCCAGCACCTGGGCTGGGGG + Intronic
1157749272 18:50163575-50163597 GTATCCAGCACCTGGGCTGCTGG - Intronic
1157810521 18:50692226-50692248 ATGCCCAGGACCTGGGCTACAGG - Intronic
1158207434 18:55008995-55009017 ATCGCTTGAACCTGGGCGGCAGG - Intergenic
1159670084 18:71212339-71212361 AGATCCTGCACCGGGGCTGCAGG + Intergenic
1160156362 18:76436780-76436802 AGCCACTGCACCTGGCCTGGAGG - Intronic
1160424963 18:78773341-78773363 AGCCCCTGCAGCAGGGCTGTGGG - Intergenic
1160579591 18:79875999-79876021 AGCTCCTGCCACTGGGCTGCTGG - Intronic
1160707863 19:537940-537962 AGCCACTGCACCTGGCCTGGTGG + Intronic
1160879340 19:1312483-1312505 TTCCCCAGCACCTGGGAGGCAGG - Intergenic
1160968973 19:1759084-1759106 ATCCCATCCACCTGGGGTGGGGG - Intronic
1161266151 19:3365781-3365803 CTCCCCTGCCCCTTGGGTGCTGG + Intronic
1161376636 19:3942448-3942470 AGCCACTGCACCTGGCCTGACGG - Intergenic
1162319810 19:9964737-9964759 AGCCACCGCACCTGGCCTGCAGG - Intronic
1162473558 19:10886743-10886765 ATCACTTGAACCTGGGCAGCAGG + Intronic
1162814651 19:13186647-13186669 GTATCCTGCACCGGGGCTGCAGG + Intergenic
1163239407 19:16050927-16050949 ACACCCTGCACATGGGCTGGGGG + Intergenic
1163251160 19:16127139-16127161 AGCCCCCGCACCTGGGATGCTGG - Intronic
1163363439 19:16862517-16862539 TCCCACTGCACTTGGGCTGCTGG - Exonic
1163675207 19:18652302-18652324 AGCCACCGCACCTGGCCTGCTGG - Intronic
1164142591 19:22486410-22486432 GTCCACTGGTCCTGGGCTGCTGG + Intronic
1165258855 19:34596638-34596660 ATCCCCTGTCCCTGCCCTGCTGG - Intronic
1165331353 19:35142657-35142679 ATCCCCAGCTCCTGGGCAGGTGG - Intronic
1165389723 19:35531488-35531510 AACCCCTACCCCGGGGCTGCAGG + Intergenic
1166101769 19:40575789-40575811 ACCCCCAGCACCTGGGGTGGGGG - Exonic
1167101935 19:47409068-47409090 CCACCCTGCACCTGGGCAGCAGG + Intronic
1167309162 19:48726942-48726964 ATGCCCTGCACCTGGGGACCTGG - Intronic
1168384090 19:55948519-55948541 ATCACCTGTACCTGGGAGGCGGG - Intronic
1168636283 19:57999803-57999825 CTCACCTGAACCTGGGCTGCTGG + Exonic
1168701015 19:58439683-58439705 ATCCCCTCTATCTGGGCTTCAGG + Intronic
925036391 2:690086-690108 CTCCTCTGCCCCGGGGCTGCCGG + Intergenic
926224181 2:10955567-10955589 CTGCCCTGCACCTGGGCTCCAGG + Intergenic
926560883 2:14416051-14416073 ATCCACTCCACCTGGACTTCTGG + Intergenic
927102601 2:19799526-19799548 ATTCCCTGTTCCAGGGCTGCAGG - Intergenic
927838904 2:26424470-26424492 ATCCCCTGTGGCTGGGCTGGAGG - Intronic
930728513 2:54706269-54706291 ATCTCTTGAACCTGGGATGCGGG - Intergenic
931416838 2:62089566-62089588 AGCCACTGCACCTGGCCTGCAGG + Intronic
931770406 2:65492350-65492372 AGCCACTGCACCTGGCCTGCAGG - Intergenic
932040500 2:68294379-68294401 AACCACTGCACCTGGCCAGCAGG - Intronic
932169556 2:69541314-69541336 ATCACTTGCACCTGGGAGGCAGG - Intronic
933266771 2:80189237-80189259 AGCCACTGCACCTGGCCTGGTGG + Intronic
934073620 2:88408701-88408723 AGCCACTGCACCTGGCCTGTTGG + Intergenic
934738233 2:96701026-96701048 AGCCACTGCACCTGGCCTGTGGG - Intergenic
936871621 2:117140100-117140122 AGCCACTGCACCTGGCCTGAAGG - Intergenic
937120574 2:119437610-119437632 GGCCTCTGCACCTGGTCTGCAGG + Exonic
937870345 2:126781861-126781883 AGCCACTGCACCTGGCCCGCTGG + Intergenic
938108985 2:128551758-128551780 AGAACCTGAACCTGGGCTGCTGG - Intergenic
939489828 2:142864095-142864117 ATCACTTGAACCTGGGCAGCGGG - Intergenic
944522628 2:200587166-200587188 CTCCCCAGTAGCTGGGCTGCAGG - Intronic
945120504 2:206452519-206452541 AGCCACTGCACCTGGCCTCCTGG - Intronic
946186552 2:217983808-217983830 ATCTCCAGGACCTGGGCTGGAGG + Intronic
946320765 2:218953261-218953283 CTCCCCTGCAGGTGGGCTGAGGG + Intergenic
946427085 2:219605113-219605135 AGCCACTGCACCTGGCCGGCTGG + Intronic
948191340 2:236061676-236061698 CTCCCCTGCACCTGGCAAGCAGG - Intronic
948330795 2:237162787-237162809 AGCCACTGCACCTGGCCTGAAGG + Intergenic
948577585 2:238964717-238964739 CTCTCCGGCTCCTGGGCTGCCGG - Intergenic
948601815 2:239111750-239111772 GTCTCCCGCCCCTGGGCTGCAGG + Intronic
948743845 2:240070667-240070689 AACCACTGCACCTGGCCTGGAGG + Intergenic
948888640 2:240896437-240896459 ATACCCGGCCCCTGGGCTGTGGG - Intronic
948904446 2:240971779-240971801 ATCCCCTGGACCTGTCCTCCTGG + Intronic
949015983 2:241711032-241711054 AGCCGCTGCACCTGGCCTCCAGG + Intronic
949025338 2:241765148-241765170 ATCCCCAGCACCTGGTCGGATGG - Intronic
949028130 2:241775759-241775781 ATGCCAGGCCCCTGGGCTGCAGG + Intergenic
1169068724 20:2708817-2708839 ATGACCGGCATCTGGGCTGCTGG + Intronic
1169491888 20:6077963-6077985 AGCCACTGCACCCGGCCTGCAGG + Intronic
1169570486 20:6900253-6900275 AGCCACTGCGCCTGGCCTGCAGG + Intergenic
1170829507 20:19827909-19827931 ATACCCTTCTCCTGGGCTGTAGG + Intergenic
1171382493 20:24744115-24744137 TTCCCCTCCTCCTGGGCTGTGGG + Intergenic
1171769492 20:29311507-29311529 AGCCACTGCACCTGGACTCCGGG - Intergenic
1172095577 20:32458513-32458535 AGCCCCTGCACCTGAGGTCCAGG + Intronic
1173012933 20:39199011-39199033 ATACCTGGCACCTGGGCTGAGGG + Intergenic
1173333552 20:42095440-42095462 AACACCTGCACCCAGGCTGCAGG - Intronic
1174747758 20:53080772-53080794 GTCCCCAGCCCCTGGGCCGCGGG - Intronic
1174754259 20:53142203-53142225 AACCCTTGCACCTGGCCTGAAGG - Intronic
1174769760 20:53288113-53288135 AGCCACTGCACCTGGCCTACCGG - Intronic
1175263221 20:57687775-57687797 AGCCTCTGCACCTGTGCTACAGG + Intronic
1175366815 20:58461447-58461469 TGCCCCTGCACCTGGGCGGCTGG - Exonic
1175404163 20:58716281-58716303 AACCCCTGAACCTGGGCTCCAGG + Intronic
1175585674 20:60137642-60137664 ATCACCTGCACCTGCCCTGGTGG - Intergenic
1176031725 20:63016088-63016110 CACCCCTGCATCTGGGCTGCTGG + Intergenic
1176109548 20:63405182-63405204 CTCCCCTGCACTTGCTCTGCAGG + Intergenic
1176218953 20:63961047-63961069 AGCACCTGCAGCAGGGCTGCTGG + Intronic
1178875360 21:36410047-36410069 ATCCCTTGAACCTGGGAGGCAGG - Intronic
1179460056 21:41528555-41528577 ACCCCCTGCATCTGCTCTGCAGG + Intronic
1179984265 21:44912341-44912363 AAGCCCTGCACCTGTGCTGGGGG + Intronic
1180244041 21:46534436-46534458 TTGCCATGTACCTGGGCTGCTGG + Intronic
1180258802 21:46651833-46651855 CTCCCCTGCACCTGTGCGTCTGG + Intronic
1180552573 22:16552525-16552547 ATCCCCAGCAAGTGGGCAGCAGG - Intergenic
1180568670 22:16696769-16696791 CTCCCCTGCCCCTGGTATGCTGG - Intergenic
1180969814 22:19809332-19809354 TTCCCCTGGAGTTGGGCTGCTGG - Intronic
1181024831 22:20122208-20122230 AGGCCCTGCATGTGGGCTGCAGG + Intronic
1181329296 22:22076728-22076750 CTTTCCTGCACCTGGGCTGAAGG + Intergenic
1181473883 22:23156973-23156995 TTCCTCTGCACCTTGGCTGAAGG - Intronic
1181889770 22:26052257-26052279 ATTCCCTCCAACTTGGCTGCAGG + Intergenic
1182633923 22:31709336-31709358 ATCCCTTGAACCTGGGAGGCCGG - Intronic
1184176598 22:42792704-42792726 ACCCCCTCCTCCTTGGCTGCAGG + Intergenic
1184264224 22:43338293-43338315 CTGCCCTGCACCTGGGGTGCTGG - Intronic
1184296346 22:43527706-43527728 CTCCCCTCCACCTGGGCCCCAGG - Intergenic
1184407833 22:44310044-44310066 TTCGCCTGCAGCTGGGGTGCCGG + Intronic
1184513303 22:44945580-44945602 ATCCCCTGCACCTGGGCTGCAGG + Intronic
1184594202 22:45504048-45504070 CTCCCCTGGACCTGGGCCACTGG - Intronic
1184823337 22:46929859-46929881 GTCCCCTGGACCTGGTGTGCTGG + Intronic
1184864750 22:47195884-47195906 CTGCCCTCCCCCTGGGCTGCAGG + Intergenic
949719705 3:6974605-6974627 ATCTCATGCACCTGGACTCCAGG - Intronic
950192977 3:10991219-10991241 ATCCCCTGCATGTGTGCTCCTGG + Intergenic
950197819 3:11021708-11021730 AGCCCAGGCAGCTGGGCTGCGGG + Intronic
950393746 3:12717830-12717852 ATTCCCAGAACCTGGGTTGCTGG + Intergenic
951914930 3:27790584-27790606 ATCCCTTGAACCTGGGAGGCGGG + Intergenic
952679492 3:36074404-36074426 AGCCACTGCACCTGGCCTGCAGG - Intergenic
953605496 3:44410725-44410747 AGCCACTGCACCTGGCCTGAGGG - Intergenic
954447243 3:50553339-50553361 AGCCCCTCCAGCTGGACTGCAGG + Intergenic
954509164 3:51106591-51106613 TGCCCCTGCACCAGGGGTGCTGG + Intronic
954663326 3:52237593-52237615 ATCTCCTCCACCAGGGCTGGAGG + Intronic
955019888 3:55109654-55109676 AGCCGCCGCACCTGGCCTGCAGG + Intergenic
956482513 3:69687393-69687415 ACCACCTGCTCCTTGGCTGCAGG + Intergenic
957443600 3:80286490-80286512 AGCCACTGCACCTGGTCTGCAGG - Intergenic
958615197 3:96484812-96484834 ATCTCTTGAACCTGGGCAGCTGG - Intergenic
959291038 3:104474834-104474856 TGCCCCTGCACCAGGGTTGCTGG + Intergenic
959961904 3:112306955-112306977 ATCCACTGATCCTGGGCTGCTGG - Intergenic
960512022 3:118561288-118561310 AGCCACTGCACCTGGGCTGTAGG + Intergenic
960991732 3:123315868-123315890 AGCCACTGCACCTGGCCTCCAGG + Intronic
961379024 3:126485404-126485426 ATCCCCTGCACATGGGCAGAAGG + Intronic
961654431 3:128433393-128433415 AGCCCCTGCTCCAGGGCTCCAGG - Intergenic
962760660 3:138510345-138510367 ATCGCCTGAACCTGGGAGGCAGG + Intronic
963742848 3:149097664-149097686 GGATCCTGCACCTGGGCTGCAGG + Intergenic
968063939 3:195747906-195747928 GTCAGCTGCACCTGGGCGGCAGG + Intronic
968170443 3:196505362-196505384 AGCCACTGCACCTGGCCTTCAGG + Intergenic
968222581 3:196949212-196949234 AGCCACTGCACCTGGCCCGCAGG + Intronic
968283105 3:197491896-197491918 CACCCCTGCACCTGGGCCTCTGG - Intergenic
968761133 4:2443149-2443171 ACCCCCTGCACCTGTGCTCATGG + Exonic
968785594 4:2619974-2619996 AGCCACTGCACCTGGCCTGGGGG + Intronic
968789256 4:2648172-2648194 AGCCACTGCGCCTGGCCTGCTGG + Intronic
968840628 4:3002616-3002638 ATCGCTTGAACCTGGGCGGCGGG + Intronic
969656029 4:8499076-8499098 AGCCCCTCCTCCTGGGCTGAAGG - Intergenic
970814000 4:20131473-20131495 TTCCCCTGTAGCTGGTCTGCTGG + Intergenic
971417631 4:26447691-26447713 ATCGCCTGAACCTGGGAGGCGGG - Intergenic
971905117 4:32716168-32716190 GGCTCCTGCACCGGGGCTGCAGG + Intergenic
972617981 4:40718683-40718705 ATCTCCTGCACCTGGATGGCAGG + Intergenic
973618214 4:52701935-52701957 AGCCACCGCACCTGGCCTGCTGG - Intergenic
974484711 4:62491840-62491862 GGATCCTGCACCTGGGCTGCAGG + Intergenic
974976567 4:68901318-68901340 GTCCACTGGTCCTGGGCTGCCGG + Intergenic
975128974 4:70813611-70813633 AGCCACTGCACCTGGCCTACTGG - Intergenic
977489498 4:97694521-97694543 AGCCACTGCACCTGGCCTGTTGG - Intronic
978027831 4:103899867-103899889 AGCCACTGCACCTGGCCTGTTGG - Intergenic
980060293 4:128121092-128121114 AGCCACTGCACCTGGCCTGAGGG + Intronic
980300447 4:130984446-130984468 ATCTCTTGCACCTGTGCTCCAGG - Intergenic
980928270 4:139160050-139160072 AGCCACTGCGCCTGGCCTGCAGG - Intronic
980994035 4:139763460-139763482 GTTCCCTGCACCAGGGCTTCTGG + Intronic
981244066 4:142513690-142513712 AGCCACTGCACCTGGCCTGGGGG + Intronic
982713403 4:158781598-158781620 ATCACCTGAACCTGGGAGGCGGG - Intronic
983039274 4:162906022-162906044 AGCCACTGCACCTGGCCTGGAGG + Intergenic
983587052 4:169367109-169367131 AGCCACTGCACCTGGCCTGAAGG - Intergenic
985489437 5:170848-170870 ATCCCCAACACCAGGGCTCCAGG - Intronic
985531639 5:437061-437083 AGCCACTGCGCCTGGCCTGCAGG - Exonic
988521714 5:31951351-31951373 AGCCACTGCACCTGGCCTTCAGG + Intronic
990006362 5:50947968-50947990 CTCCCCTACACCTAGGCTGTAGG - Intergenic
992269704 5:75052737-75052759 AGCCCCCGCCCCTGGGCTTCGGG - Intergenic
992694317 5:79270015-79270037 AACCACTGCACCTGGCCTGGAGG + Intronic
993630515 5:90280752-90280774 CTCTCCTGAACCTTGGCTGCTGG - Intergenic
995568744 5:113457561-113457583 GGATCCTGCACCTGGGCTGCAGG - Intronic
996233030 5:121088969-121088991 ATTCCCTGCACCTGGGGGTCTGG + Intergenic
996570472 5:124928285-124928307 ACACCCTTTACCTGGGCTGCAGG + Intergenic
996739715 5:126787834-126787856 AGCCACTGCACCTGGCCTACTGG + Intronic
996792169 5:127304778-127304800 ATCCACTGCAACTGGCCTGGAGG + Intronic
997413202 5:133705646-133705668 GTCCCATGCCCCTAGGCTGCTGG - Intergenic
997606936 5:135181903-135181925 ATCCCTTGAACCTGGGAGGCGGG + Intronic
997885701 5:137628080-137628102 ATCCTCTGCATCTAGGTTGCAGG + Intronic
998919092 5:147048021-147048043 ATCCCCTGGAACTGGGCCCCAGG - Intronic
999366596 5:151027610-151027632 CTCCCCTGCTCCTGGGCTCTTGG + Intronic
999373359 5:151069552-151069574 ATCACCTGCTCCAGGGTTGCAGG - Intronic
999539548 5:152556671-152556693 ATCCCCAGCTCCTGGGCTAGGGG - Intergenic
1001799149 5:174528306-174528328 ATGCCAGACACCTGGGCTGCTGG + Intergenic
1001976341 5:176002892-176002914 AGCCACTGCACCTGGCCTGTTGG - Intronic
1002241082 5:177840876-177840898 AGCCACTGCACCTGGCCTGTTGG + Intergenic
1003574030 6:7276496-7276518 ATCCCTTGAACCTGGGAAGCGGG + Intronic
1004795618 6:19080138-19080160 ATCCCCAACCCCTGAGCTGCAGG + Intergenic
1005621079 6:27620882-27620904 ATCAGCTCCACCTGGGCAGCTGG + Intergenic
1006641549 6:35492052-35492074 TTCCCCTGCACCAGCCCTGCTGG + Intronic
1006694659 6:35920881-35920903 ACCCCCTGCCTCTGGGCTGCGGG - Intronic
1006907528 6:37542994-37543016 ATACCCTCCACCTGGGTTGTTGG - Intergenic
1006984361 6:38167286-38167308 ATCCCCAGCACTTGGGAGGCAGG + Intergenic
1007422699 6:41729106-41729128 CTCCCCTGCAGCAGGGCTGTGGG + Intronic
1007696540 6:43737446-43737468 CTCCCCTGGAGCAGGGCTGCTGG - Intergenic
1014516702 6:122387731-122387753 AACCTCTGCACCTGGGTTGTGGG - Intergenic
1016866725 6:148774930-148774952 ATCACTTGAACCTGGGATGCGGG + Intronic
1018328684 6:162704175-162704197 ATGCCCTCCACCTGGGCAGCAGG + Intronic
1018472117 6:164106473-164106495 CTGCCCTGCATCGGGGCTGCGGG + Intergenic
1018903393 6:168062304-168062326 ATCCCCGGCACCCGGGCTGTGGG + Intronic
1019064202 6:169282208-169282230 CTTCCCTGCACCGGGGATGCTGG - Intergenic
1020667065 7:11059488-11059510 AACCACTGCACCTGGCCTACAGG - Intronic
1022251783 7:28615572-28615594 ATGCCTTGAACCTGGTCTGCTGG + Intronic
1022588888 7:31642415-31642437 ATCCTCTGCCCCTTGGGTGCAGG - Intronic
1022694762 7:32693258-32693280 GTTCCCTGCAGCTGGGCAGCAGG + Intergenic
1023912440 7:44565565-44565587 ATCCCAGGCAGCAGGGCTGCAGG + Exonic
1024229673 7:47354549-47354571 TTCCCCAGCACCTGGGCCTCAGG - Intronic
1024281586 7:47723533-47723555 GTCCCCAGCCCCTGGGCTGCGGG + Intronic
1024464964 7:49702598-49702620 AGCCCCAGCATCTGGGCAGCAGG - Intergenic
1024567130 7:50690602-50690624 ATCCCCTGGGCCTGGGCCCCAGG + Intronic
1024675611 7:51635653-51635675 ATCCCCTTCCTGTGGGCTGCTGG + Intergenic
1026055845 7:66982968-66982990 AGCCACTGCACCTGGCCTGGTGG - Intergenic
1027252122 7:76405560-76405582 ATCACTTGCACCAAGGCTGCAGG + Intronic
1029458234 7:100681687-100681709 ACCCCCAGCCCCTGGGCTGTAGG - Exonic
1029642924 7:101832424-101832446 GTCCCCAGCACCTGCGGTGCAGG + Intronic
1032022919 7:128419992-128420014 ATCCCCTGGACATGGGTGGCTGG - Intergenic
1032550651 7:132781125-132781147 AGCCACTGCACCTGGTCTGTAGG - Intergenic
1034369256 7:150580264-150580286 ATACCCTGCACCTGGCTTGGAGG - Intergenic
1035392495 7:158514539-158514561 ATCGCCATCACCTGGGGTGCAGG - Intronic
1035729075 8:1842098-1842120 ATCCCCAGCACCTGGCCTCGTGG - Intronic
1036798735 8:11774088-11774110 AGCCACTGCACCTGGCCTGACGG - Intronic
1038272855 8:26090195-26090217 AGCCACTGCACCTGGCCAGCAGG - Intergenic
1040588004 8:48762715-48762737 AGCCACTGCACCTGGCCAGCTGG - Intergenic
1041679668 8:60575938-60575960 AGCCACTGCACCTGGCCTACAGG + Intronic
1041693057 8:60708528-60708550 CTTCCCTTCACCTGGGATGCAGG + Intronic
1042021877 8:64377838-64377860 ACCCCCTCCCCCCGGGCTGCGGG + Intergenic
1042914497 8:73862142-73862164 AGCCACTGCACCTGGCCTTCAGG - Intronic
1043053201 8:75407276-75407298 ATGCCCTGGCCTTGGGCTGCAGG + Intergenic
1044433953 8:92140534-92140556 AGCCACTGCACCTGGCCTGAGGG - Intergenic
1045368318 8:101496060-101496082 ATCCCTTGAACCTGGGAGGCGGG + Intronic
1046317671 8:112528689-112528711 TTCACATTCACCTGGGCTGCAGG - Intronic
1046660331 8:116941498-116941520 AACCCTTGCACCTTGCCTGCAGG - Intronic
1046757217 8:117984331-117984353 ATCGCTTGAACCTGGGGTGCAGG + Intronic
1047308603 8:123673730-123673752 ATCCCTTGAGCATGGGCTGCAGG + Intergenic
1047491606 8:125379335-125379357 AGCCACTGCACCTGGCCTGGAGG - Intergenic
1047927177 8:129693234-129693256 ATCCTGTGCCCCTGAGCTGCTGG - Intergenic
1048936627 8:139362835-139362857 CTCCCCTGCATCTGGGTTGGGGG + Intergenic
1049437724 8:142595452-142595474 ATCCCCAGCACTGGGGCTGGCGG - Intergenic
1049469344 8:142768530-142768552 CTTCCCTGCACCAGGGCTCCTGG - Intronic
1049643500 8:143726005-143726027 TTCCCCTGCCCCAGGGCTGCTGG + Exonic
1049865756 8:144934426-144934448 ATACACTCCACATGGGCTGCAGG + Intronic
1049920462 9:358561-358583 AGCCACCGCACCTGGCCTGCAGG - Intronic
1050722674 9:8608575-8608597 ATCCCCTGCTCCAGGGCAGCAGG + Intronic
1052982446 9:34458780-34458802 AGCGCCTGCGCCTTGGCTGCTGG + Intronic
1053093180 9:35298603-35298625 AGCCACTGCACCTGGCCTTCTGG + Intronic
1053386365 9:37693790-37693812 ACCCCTTGGACCTGGGCTCCTGG + Intronic
1056499157 9:87190715-87190737 ATACCCTCCACCTGGACTCCTGG - Intergenic
1056691506 9:88812204-88812226 ATCCCCAGAACCTGGACTGTGGG + Intergenic
1057554685 9:96078371-96078393 CTGCCCATCACCTGGGCTGCTGG + Intergenic
1057739117 9:97696856-97696878 CTTCGCTGCACCTCGGCTGCTGG - Intronic
1057830986 9:98406787-98406809 ATCTCCTGCATCTGCCCTGCTGG + Intronic
1058668660 9:107342473-107342495 CTCCCCTGCCCAGGGGCTGCAGG - Intergenic
1058954312 9:109931283-109931305 ATTCCCTGCAACTGGGCTAATGG + Intronic
1059768715 9:117408050-117408072 ATCCTAAGCACCTGGGCTGATGG - Intronic
1060022666 9:120145864-120145886 CTCCCCTGCACACGTGCTGCAGG - Intergenic
1060529268 9:124338959-124338981 ATCCCCTTCCCCTGGGCAGCTGG + Intronic
1060547053 9:124467989-124468011 ATCCCCTGTGCCTGGGCAGATGG - Intronic
1061416573 9:130450463-130450485 ACCCCCTGCCCCTGAGTTGCTGG - Intronic
1061459274 9:130723256-130723278 AGCCACTGCACCTGGCCAGCAGG - Intronic
1061626061 9:131841428-131841450 ACGCCCTGCAGCTGGGCAGCAGG - Intergenic
1062099657 9:134721509-134721531 GTCCCATGCACCTGGGCCTCTGG + Intronic
1062104213 9:134743977-134743999 ATCCCCTCCCCATGGCCTGCTGG + Intronic
1062250323 9:135590656-135590678 GCTCCCTGCACCTGGGCAGCCGG - Intergenic
1203768983 EBV:39824-39846 CTCCACTGCACCTGGAATGCAGG + Intergenic
1185712852 X:2318057-2318079 AGCCACTGCACCTGGCCTTCAGG - Intronic
1187284876 X:17895600-17895622 ATCCCTTGCACCTGGAGAGCAGG + Intergenic
1187374979 X:18743974-18743996 ATCACTTGAACCTGGGCAGCGGG - Intronic
1187932043 X:24302511-24302533 AGCCACTGCACCTGGCCTGCTGG + Intergenic
1190409074 X:50116537-50116559 ATCCGCTGTATCTGGGCAGCAGG + Intergenic
1190413143 X:50156515-50156537 ACCCCCTCCCCCTGGGCTGGAGG + Intergenic
1191249722 X:58254580-58254602 AGCCCCTGCGCCAGGCCTGCAGG - Intergenic
1191250470 X:58257773-58257795 ATCACCTGCACCTGGCCTTCGGG + Intergenic
1191251304 X:58261428-58261450 AGCCCCAGCACCAGGCCTGCGGG + Intergenic
1191252203 X:58265081-58265103 AGCCCCTGCACCAGGCCCGCTGG + Intergenic
1191258422 X:58289907-58289929 ATCCCCTGCCCCGGGCCTGGGGG + Intergenic
1192740220 X:73885154-73885176 AACCACTGCACCTGGCCTGTAGG - Intergenic
1192748417 X:73963338-73963360 ATCGCCTGAACCTGGGAGGCGGG - Intergenic
1192890633 X:75386760-75386782 AGCCACTGCACCTGGCCAGCTGG + Intronic
1192954327 X:76052584-76052606 ATATCCTGCACCTGGCCTGGAGG - Intergenic
1195972269 X:110486122-110486144 ATCTCTTGAACCTGGGATGCAGG - Intergenic
1196503896 X:116417975-116417997 AGCCACTGCACCTGGCCTGAAGG + Intergenic
1196685833 X:118509547-118509569 AGCCACTGCACCTGGCCTGGAGG + Intronic
1200106435 X:153715870-153715892 AGCCACTGCACCTGGCCTGAGGG - Intronic