ID: 1184513906

View in Genome Browser
Species Human (GRCh38)
Location 22:44948720-44948742
Sequence AAACCCGGCTTCACAAAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 168
Summary {0: 1, 1: 7, 2: 30, 3: 40, 4: 90}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184513906 Original CRISPR AAACCCGGCTTCACAAAGAC AGG Intronic
901861312 1:12076423-12076445 AAAAGCGGCTTACCAAAGACAGG - Intronic
909122292 1:71618456-71618478 AAACCCTGCTTCACAAAGACAGG - Intronic
909248743 1:73325610-73325632 AAACCAGGCTTCACAAATGAAGG - Intergenic
909662269 1:78097317-78097339 AAACTCTGCCTCACTAAGACTGG - Intronic
911792356 1:102033614-102033636 AAACCCTGCTTCACAAAGATAGG - Intergenic
918017006 1:180644998-180645020 AAAACCTGCTTCACAAAGATAGG + Intronic
918217649 1:182406992-182407014 AAACCCAGCTTTAGGAAGACAGG + Intergenic
918750947 1:188268590-188268612 AAACCCTGCTTCACAAAAATAGG + Intergenic
919091322 1:192981557-192981579 AAACCCTGCTTCACAAAGATAGG - Intergenic
920924872 1:210331342-210331364 AGACCCTGCTTCACAAAGATAGG + Intronic
922321308 1:224490121-224490143 AATCCAGGCTTTAGAAAGACAGG + Intronic
922671797 1:227514180-227514202 AAACCCTGCTTCACAAAGACAGG + Intergenic
924244505 1:242070668-242070690 AAACCCTGTTTCACAAAGACAGG + Intergenic
924821773 1:247498992-247499014 AAACCATGCTTCACAAAGACAGG + Intergenic
1063005885 10:1970249-1970271 AAATCCTGCTTCACAAAGACAGG - Intergenic
1063594393 10:7420640-7420662 AAACCCTGCTTCCCAAAGATAGG - Intergenic
1065516905 10:26532812-26532834 AAACCAGCCTAAACAAAGACAGG - Intronic
1066608259 10:37205661-37205683 AAACACAGCTTCACATAGTCAGG - Intronic
1067728261 10:48790009-48790031 AAACCCTGCTTCCCAAATAGCGG - Intronic
1068163331 10:53296745-53296767 AGACCCTGCTTCACAAAGATAGG + Intergenic
1070615233 10:77964555-77964577 AAACCCTGCTTCACAAGGATAGG - Intergenic
1074628204 10:115218278-115218300 AAACTCTGCTCCACGAAGACAGG + Intronic
1075345359 10:121678308-121678330 AAAGTTGGCTTCACAATGACTGG - Intergenic
1075976237 10:126697993-126698015 AAACCAGGCTGGACAAAGAGAGG + Intergenic
1078020400 11:7651997-7652019 AGAACTGGCTTAACAAAGACTGG - Intronic
1078826109 11:14931718-14931740 AAATCCTGCTTCACAAAGATAGG + Intronic
1079000617 11:16752005-16752027 AAACCCTGTTTCACAAAGACAGG - Intronic
1079570121 11:21932646-21932668 AAACCCTGCTTCACAAAGATAGG - Intergenic
1082990722 11:59205261-59205283 AACCCCGGCTTCCCAAAGCCAGG - Exonic
1083083813 11:60121921-60121943 AAACCCTGCTTCATAAAGATAGG - Intergenic
1084553433 11:69862583-69862605 AATCTCGGCCCCACAAAGACGGG + Intergenic
1094812782 12:34156141-34156163 AAAGCCTGCTTCACAAAGACAGG - Intergenic
1100158125 12:91825667-91825689 AAATCCCCTTTCACAAAGACAGG - Intergenic
1107655626 13:42589899-42589921 AAAACCGACTACACAAAGAAGGG - Intronic
1109218312 13:59615367-59615389 AAACCTGGCTGCACAGAGCCTGG + Intergenic
1109413545 13:62006473-62006495 AAACCCAACTTCATGAAGACAGG + Intergenic
1112865565 13:103892365-103892387 AAACCCAGTTTCACAAAGACAGG - Intergenic
1113401436 13:109997657-109997679 AAACCCTGCTTCAGAAAGATAGG - Intergenic
1113630992 13:111883779-111883801 AAACCAGGCATCACTAACACAGG + Intergenic
1116140382 14:40985936-40985958 AAACCCTGCTTCACAAAAATGGG + Intergenic
1118526620 14:66651729-66651751 AAACCCTGCTTCACAAAGACAGG - Intronic
1120149826 14:81020889-81020911 AAACCCTGCTTCACAAAGATAGG - Intronic
1122098050 14:99386040-99386062 ACACCCTGCTTCATGAAGACGGG + Intergenic
1122855927 14:104560030-104560052 GACCCCGGCTTCACACAGACAGG + Intronic
1122950639 14:105042586-105042608 ACACCCGGCTTCCCAGCGACAGG + Intergenic
1124440275 15:29680753-29680775 AAACTCTGCTTCACAAACACAGG + Intergenic
1125006684 15:34824674-34824696 AAATCTGGCTTCAGAAAGAGGGG - Intergenic
1125483044 15:40093476-40093498 ACACCCGGCTTAACAAAATCTGG + Intronic
1126457249 15:48877140-48877162 AAATCCTGCCTCACAAAGATAGG - Intronic
1127880346 15:63151816-63151838 AAACCCAGCTTCACAAGGATAGG - Exonic
1131631752 15:94184559-94184581 AAACCCTGCTTCACAAAGACAGG + Intergenic
1133627911 16:7589476-7589498 AAAGGCAGCTTCACAAAGTCAGG - Intronic
1135835525 16:25822034-25822056 ATACCGGGCATCACAAATACAGG - Intronic
1138425540 16:56929768-56929790 AAACCCTGCTTCACAGAGATGGG + Intergenic
1140581985 16:76241360-76241382 AAATCCTCCTTCACAAAGATAGG - Intergenic
1140620395 16:76723031-76723053 CAACTCGGCTTCCCAAAGGCTGG + Intergenic
1145257484 17:21334750-21334772 AAACAAGGCTTCTTAAAGACAGG - Intergenic
1146611065 17:34305371-34305393 AAACATGGATTCAAAAAGACAGG + Intergenic
1146637394 17:34516674-34516696 AAAAGAGGCTTCCCAAAGACAGG + Intergenic
1149440340 17:56668629-56668651 AAACCCTGCTTTACAAAGATAGG - Intergenic
1150321611 17:64218854-64218876 AAACCAGGCCTCACTTAGACTGG + Intronic
1150797408 17:68249088-68249110 AAAGCCAGCCTCACAATGACAGG - Intronic
1152163770 17:78687304-78687326 AAACACTGCTTCACAAAGACAGG + Intronic
1157558443 18:48628994-48629016 AGACCCAACTTCTCAAAGACAGG - Intronic
1159792535 18:72800381-72800403 AAACCCTGCTTCACAAAGATAGG - Intronic
1160426208 18:78780983-78781005 AAACCCAGCCTCACAAAATCTGG + Intergenic
1161304977 19:3562283-3562305 AAACTGAGTTTCACAAAGACGGG + Intronic
1167527175 19:49991775-49991797 AGAGCCGGCTTCCCAATGACAGG + Intronic
926288033 2:11506249-11506271 AAACCACGCTTCTCAAGGACAGG - Intergenic
926824699 2:16892887-16892909 AAACTCTGCTTCACAAACATAGG - Intergenic
928040359 2:27869835-27869857 AAACTCTGCTTCACAAAGATAGG + Intronic
929174662 2:38964156-38964178 AAACCCTGCTTCACAAAGATGGG + Intronic
929226751 2:39519015-39519037 AAACTCAGCTTCCCAAAGACAGG - Intergenic
929707900 2:44235002-44235024 AAACCTGGCCTCACACAGATAGG + Intronic
931183945 2:59931304-59931326 AGACGAGGCTTGACAAAGACTGG - Intergenic
933480484 2:82851186-82851208 AAACCCTGCTTCACAAAGACAGG + Intergenic
936689924 2:114874410-114874432 AAACCCTGCTTCACCAAGATAGG - Intronic
937018048 2:118624286-118624308 AAACCCTATTTCACAAAGATAGG - Intergenic
937165890 2:119816753-119816775 AAACACTGCTTCATAAAGATAGG + Intronic
937836775 2:126479191-126479213 AAACCCCACTTCATAAAGATAGG - Intergenic
939306519 2:140418567-140418589 AAATCCTGCTTCACAAATATGGG - Intronic
943818692 2:192290459-192290481 AAACCCTGCTTCACAAAGATAGG + Intergenic
947095112 2:226557852-226557874 AAACCCAGCATCCAAAAGACAGG + Intergenic
1177319509 21:19501892-19501914 AAACACAACTTCACAGAGACAGG - Intergenic
1179188098 21:39100355-39100377 AAACCCTGCTTCACAAAGATAGG - Intergenic
1184513906 22:44948720-44948742 AAACCCGGCTTCACAAAGACAGG + Intronic
1184833810 22:47008512-47008534 AAATCAGCCTCCACAAAGACTGG - Intronic
949460472 3:4287572-4287594 AAACACAGCTTCACAAAGATAGG + Intronic
950758430 3:15197996-15198018 AAACCCTGCTTCATAAAGATAGG + Intergenic
958804686 3:98795582-98795604 AAATCAGGCTTCAAAAAGAATGG + Exonic
961435599 3:126914389-126914411 AAACCCTTATTCACAAAAACAGG + Intronic
961580837 3:127880760-127880782 AAACCCTGCTTCACAAACAGAGG + Intergenic
961667886 3:128504877-128504899 AAACCCGGCTTCAGATTGACCGG - Intergenic
962240297 3:133746300-133746322 CAACCCGGCTGCACAAACACGGG + Exonic
963356308 3:144212581-144212603 AAACCCTGCTTCACAAAGATAGG + Intergenic
966369134 3:179228548-179228570 AAATCTGGCCTCACAAAGATAGG - Intronic
967658976 3:192082062-192082084 AATCCCTGATTCACAAAGAAAGG + Intergenic
969077574 4:4592449-4592471 AAACCAGGCTTCAGAAGGACAGG + Intergenic
971619574 4:28838606-28838628 AAACCCAACTTCACACAGATAGG - Intergenic
971620403 4:28848489-28848511 GCACCTGGCCTCACAAAGACTGG - Intergenic
974697405 4:65394044-65394066 TAACCAGGGTTCACAAAGTCAGG + Intronic
975417449 4:74121401-74121423 AAACCCTACTTCACAAAGATAGG - Intronic
975625355 4:76340567-76340589 AAACACTGCTTCACAAAGATAGG - Intronic
975778078 4:77810975-77810997 AAATCCGTCTTCAAAAAGAATGG - Intronic
976122718 4:81800583-81800605 AAACCCTGCTTCACAAAGATAGG + Intronic
976180400 4:82393539-82393561 AAACCCTGCTTCACAAAGATAGG - Intergenic
978222463 4:106293262-106293284 AAACCCTGCTTCACAAAGATAGG - Intronic
979829230 4:125280146-125280168 AAACCCTTCTTCACAAAGATAGG - Intergenic
980991343 4:139741006-139741028 AAACCCAGCTTCCCACAGACAGG - Intronic
981297387 4:143147419-143147441 ATATCCTGCTTCACAAATACAGG + Intergenic
982039799 4:151385513-151385535 AAACCCTGCTTCACAAAGATAGG + Intergenic
983677640 4:170314707-170314729 AAACTCAGCTTCACAAAGATAGG - Intergenic
984881353 4:184412495-184412517 AAATCTGGCTTCAAAGAGACTGG - Intronic
985753417 5:1697339-1697361 AAACTCTGCTTCACAAAGACAGG + Intergenic
986350178 5:6870326-6870348 CAACCCTGCTTCACAAAGATAGG + Intergenic
987032223 5:13986560-13986582 AAGCCAGTCTTCAGAAAGACAGG + Intergenic
987093847 5:14531036-14531058 AAACATGGCTTTACAGAGACAGG - Intronic
987993180 5:25241930-25241952 AAACCCTGCTTCACAAAGATAGG + Intergenic
988136110 5:27173872-27173894 AAACCCTGCTTCACAAAGATTGG - Intergenic
990501857 5:56404370-56404392 AAAGCCATCTTCACAAGGACTGG - Intergenic
990820148 5:59829842-59829864 AAACCTGGCGTCACACATACCGG + Intronic
992950657 5:81853989-81854011 AAAGCCTGATTTACAAAGACTGG + Intergenic
993411923 5:87584716-87584738 AAACCCCACTTAACAAAGAATGG + Intergenic
995463903 5:112431097-112431119 AAACCCTGCTTCACAAAGATAGG + Intergenic
995861355 5:116644222-116644244 AAACCCTGCTTCACAAAGATAGG + Intergenic
997900374 5:137758015-137758037 AAACCCTGCTTCACAAATATAGG + Intergenic
999193773 5:149768103-149768125 AAACCCTGCTTCACAGGGATAGG + Intronic
1000916242 5:167085672-167085694 AAACACAACTTCATAAAGACAGG - Intergenic
1001894462 5:175366505-175366527 AAACCCTGCTTCGCAAAGATAGG - Intergenic
1003917516 6:10800964-10800986 AAACGTGGCATCACAAAGAGGGG - Intronic
1004181393 6:13383461-13383483 AAACTCAGCTTCACAGAGATAGG - Intronic
1004599281 6:17132154-17132176 AAACCCTGCTGCACAAAGATGGG - Intergenic
1004770081 6:18771507-18771529 ATACCCTGCTTCACAAAGTTAGG - Intergenic
1007018422 6:38493601-38493623 AAACCTGTCTTCGCAATGACAGG - Intronic
1013036079 6:106384590-106384612 AAACCCTGCTTCACAAAGATAGG + Intergenic
1016661353 6:146584783-146584805 CAACTCGGCTTCCCAAAGTCTGG - Intergenic
1017097329 6:150816199-150816221 AAACCCTGCTTCACAAAGATAGG + Intronic
1017667557 6:156735991-156736013 AAGCCTGGCTTCTCAAAGAGTGG - Intergenic
1018596551 6:165487254-165487276 AAACCCTGCTTCACAAAGACAGG - Intronic
1018664527 6:166122927-166122949 AAACCCTGCTTCACAAAGACAGG + Intergenic
1019906699 7:4070345-4070367 AAACTCTGCTTTGCAAAGACAGG + Intronic
1025846211 7:65200568-65200590 AATACCGACGTCACAAAGACTGG - Intergenic
1025896431 7:65706296-65706318 AATACCGACGTCACAAAGACTGG - Intergenic
1027795691 7:82691048-82691070 AAATCCTGCATCAAAAAGACAGG - Intergenic
1030064525 7:105649147-105649169 AAACACTGCTCCACAAAGAAAGG - Intronic
1031514550 7:122685986-122686008 AAAACCAGCTTCACAAATACTGG - Intronic
1032840672 7:135711111-135711133 AAAGCCGCCTCCACAAAGCCTGG - Intronic
1036382638 8:8247412-8247434 AAATCCTGCTTCACAAAGACAGG - Intergenic
1038235354 8:25747556-25747578 ACACTTGGCTTCACAAAGAAAGG - Intergenic
1039716899 8:40119448-40119470 TTACCCAGCTTCAGAAAGACTGG - Intergenic
1042172330 8:66004260-66004282 AAGCCCTGCTTCACAAAGACAGG - Intergenic
1043050992 8:75385339-75385361 AAACCCTGCTTCACAAGGATAGG - Intergenic
1044031757 8:87247045-87247067 AAACTCTGCTTCACAAAGGTAGG + Intronic
1046238127 8:111454068-111454090 GAAGCCTGCTTCACAAAGATAGG - Intergenic
1046438816 8:114231259-114231281 ATATCCTGCTTCACAAGGACTGG + Intergenic
1050057080 9:1667005-1667027 AAACCCTGCTTCACAAAGATAGG - Intergenic
1053169030 9:35865202-35865224 AAGCCCGGCTTCACTAGGCCTGG + Intergenic
1057775835 9:98008617-98008639 AAACTTTGCTTCACAAAGATAGG - Intronic
1058045599 9:100353531-100353553 AAAAATGTCTTCACAAAGACTGG + Intergenic
1058155379 9:101508913-101508935 AAACCCTGTTTCACAAAGGTAGG + Intronic
1058229481 9:102408214-102408236 AAACTCTGCTTCACAAAGATCGG - Intergenic
1186514540 X:10156801-10156823 AAACCCGGCGTCCCGGAGACAGG - Intergenic
1188065688 X:25656668-25656690 AAACCCTGCTTCACAATGATAGG + Intergenic
1189185409 X:39050671-39050693 AAAACAGGCTTCGCAAACACAGG + Intergenic
1201755992 Y:17485608-17485630 AAACAGGTCTTCACAATGACTGG + Intergenic
1201757877 Y:17507215-17507237 AAACTCTGCTTCAGAAAGACAGG - Intergenic
1201843677 Y:18398767-18398789 AAACTCTGCTTCAGAAAGACAGG + Intergenic
1201845560 Y:18420377-18420399 AAACAGGTCTTCACAATGACTGG - Intergenic