ID: 1184514109

View in Genome Browser
Species Human (GRCh38)
Location 22:44950694-44950716
Sequence TATTATGCAAAGAGGGCTTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 170
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 152}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184514109 Original CRISPR TATTATGCAAAGAGGGCTTG GGG Intronic
900125449 1:1067106-1067128 TATTATGCAAAGAGCCCTGGTGG - Intergenic
906712602 1:47942264-47942286 TATTTTCCAAAGAGGGCAGGAGG - Intronic
906751079 1:48260993-48261015 TATGATGCAGAGTAGGCTTGGGG - Intergenic
907353758 1:53855187-53855209 AATGATGCAGAGAGGGCTTCTGG - Intronic
913490151 1:119371845-119371867 GATTATGCAAAGAGCCCTGGAGG - Intronic
915061786 1:153192129-153192151 TATTAGGCACAGAGGGCATGTGG + Intergenic
917246380 1:173005265-173005287 TATTGTGGAAAGAGGCATTGAGG - Intergenic
921956594 1:220991248-220991270 CATCAGGAAAAGAGGGCTTGCGG + Intergenic
923199313 1:231695923-231695945 TATTATGCAGAGAGGGAGTGAGG + Intronic
1065822071 10:29534943-29534965 TAAAAAGCAAAGAGGGCTTTTGG + Intronic
1066201064 10:33143080-33143102 AATTAAGCAAAGAAAGCTTGAGG + Intergenic
1067406046 10:46024182-46024204 TATTATCCAAGGAGGGCTTTTGG - Intronic
1070279162 10:75036423-75036445 TAACATGCACACAGGGCTTGGGG - Intergenic
1071688276 10:87786527-87786549 CAATATGCAAAGAAAGCTTGTGG + Intronic
1071903128 10:90142095-90142117 AATTATGAAGAGAGGGCCTGAGG + Intergenic
1072187623 10:93056349-93056371 TATTATGAAATGAGGGCTTCAGG - Intronic
1072700156 10:97634719-97634741 TATTATGCAGAGAAGGCTACAGG + Intronic
1072861315 10:99007942-99007964 AATTATGCATACAGGGCATGGGG - Intronic
1073649853 10:105346822-105346844 TATTAGGCAAAGGGCACTTGAGG - Intergenic
1073669942 10:105576659-105576681 TAATATGCAAAGAGAATTTGAGG + Intergenic
1074725994 10:116310577-116310599 TATTTTTCAAAGAAGGCTTAAGG - Intergenic
1075712086 10:124536220-124536242 TATTTTGCCCAGAGGCCTTGTGG + Intronic
1076221933 10:128740827-128740849 TACTAAGCAATGTGGGCTTGCGG + Intergenic
1080023764 11:27592509-27592531 TTATATGCAAAGAGGACATGAGG + Intergenic
1080172683 11:29324695-29324717 TTATATGCAGAGATGGCTTGGGG + Intergenic
1082229209 11:49743171-49743193 TATTATGCAAATAGGCTTTCCGG + Intergenic
1083731299 11:64653957-64653979 GATGATGGGAAGAGGGCTTGTGG + Intronic
1084862431 11:72028819-72028841 AAGGCTGCAAAGAGGGCTTGTGG + Intronic
1087831456 11:102823630-102823652 TTGCAAGCAAAGAGGGCTTGGGG - Intergenic
1088556706 11:111069153-111069175 TAATATGCAAAGGGGTCATGGGG + Intergenic
1095303608 12:40614931-40614953 TATTATAGAACCAGGGCTTGGGG - Intergenic
1095954980 12:47800693-47800715 GATTATGCAAGAGGGGCTTGGGG + Intronic
1097440142 12:59597871-59597893 TATTATTCAAACATGCCTTGGGG - Intronic
1097968306 12:65604731-65604753 CATAATTGAAAGAGGGCTTGTGG - Intergenic
1098503514 12:71222507-71222529 CTTTATGCAAGCAGGGCTTGGGG - Intronic
1100283239 12:93138652-93138674 CATGATGAAAAGAGGGCTTTTGG - Intergenic
1101346836 12:103893890-103893912 TATTAGGCAAAGAGGTATTGTGG - Intergenic
1106785834 13:33107416-33107438 GATTATGCACAGAGGGCTCTGGG + Intronic
1107878646 13:44813772-44813794 TATTATGGGAAGAGGACTGGGGG + Intergenic
1108064273 13:46561894-46561916 AATAATGCAAAGATGGCTTAAGG - Intronic
1109820535 13:67646796-67646818 TTTTTTCCAAAGAGGGTTTGGGG + Intergenic
1113981016 13:114275907-114275929 TAATATGCTCAGAGGGCTAGCGG - Intergenic
1114211630 14:20620668-20620690 TAATATGCAAAGTGTGATTGGGG - Intergenic
1115182170 14:30642035-30642057 TCTAATGCAAATAGGCCTTGGGG - Intronic
1115925963 14:38435181-38435203 TTTTATGCAAAGAGGTATAGAGG + Intergenic
1116615932 14:47138642-47138664 TAATATGGAAATACGGCTTGAGG - Intronic
1119151747 14:72366680-72366702 TACTATTCAAAGAGGGTCTGAGG - Intronic
1120572682 14:86141284-86141306 TATTATACAAAGTGGGATTGCGG + Intergenic
1122584591 14:102796441-102796463 TCGAATCCAAAGAGGGCTTGTGG + Intronic
1125107444 15:35989558-35989580 TTTTTTGCAAAGAGAGGTTGTGG - Intergenic
1126362693 15:47862707-47862729 TATTATACAAAGAGTGCTCCAGG - Intergenic
1126543134 15:49843853-49843875 TGGAATCCAAAGAGGGCTTGAGG - Intergenic
1128150116 15:65357818-65357840 TGTGATGCCAAGAGGGCTTAAGG - Intronic
1129671987 15:77612637-77612659 TGCTGTGCAAAGAAGGCTTGGGG + Intergenic
1133564937 16:6984624-6984646 TATTAAGTAAAGAAGGCATGTGG - Intronic
1134879231 16:17729790-17729812 TAGTGTGCACAGAGGTCTTGAGG + Intergenic
1135358893 16:21794230-21794252 TATTATGCAAATAGGACGAGTGG + Intergenic
1135457449 16:22610666-22610688 TATTATGCAAATAGGACGAGTGG + Intergenic
1137912045 16:52387597-52387619 AATCATGCAATGAGGGCTTAGGG - Intergenic
1138849409 16:60608226-60608248 TAATATGGAAAGAGGGCCTTGGG + Intergenic
1139698351 16:68691582-68691604 TATTTTCCAAAGTGTGCTTGTGG + Intronic
1140702497 16:77594331-77594353 TATTATGCCAAAAGGGCAAGAGG + Intergenic
1140966335 16:79969724-79969746 TATTATGGGAACAGGCCTTGGGG - Intergenic
1141112388 16:81281018-81281040 TATTATGTAAAGAGGCCTCTGGG - Intronic
1142244618 16:88964150-88964172 TGTTCTGCAAACACGGCTTGGGG + Intronic
1142246867 16:88974201-88974223 TCTTCTGCAAAGTGGGCTTGGGG + Intronic
1144042659 17:11426907-11426929 TTTTCTGCAAAGAAGGGTTGTGG - Intronic
1144528141 17:16008711-16008733 TATCAAGCAAAGAGGCCTTGAGG - Intronic
1149406470 17:56356957-56356979 AATTATGCACAGGGGGCTTTGGG - Intronic
926230082 2:10995835-10995857 AATCAAGCAAAGAGGACTTGAGG + Intergenic
928326956 2:30326917-30326939 TGTTATGGAAAGAGGGCATAGGG - Intergenic
929788778 2:45009458-45009480 TATTATTCTAAGCGGGCATGAGG + Intergenic
934522307 2:95026940-95026962 GTTCATCCAAAGAGGGCTTGCGG + Intronic
937591105 2:123614366-123614388 TATTATGAAAAGAGGCATTGAGG + Intergenic
937779860 2:125824814-125824836 TTTTAAACAAAGTGGGCTTGTGG - Intergenic
939944710 2:148395723-148395745 TATTATGAAAAGATGAGTTGGGG - Intronic
940815306 2:158291047-158291069 TTTTATGGAGAGAGGGCTAGAGG - Intronic
940893131 2:159054738-159054760 TACTATGAAAAGAGACCTTGAGG - Intronic
942881780 2:180870545-180870567 TATTAAGGAAAGAGGCGTTGAGG + Intergenic
943990603 2:194686173-194686195 TATTATGCAAAGAAGCAATGAGG - Intergenic
945201949 2:207290718-207290740 TAATATCAAAAGAGGTCTTGGGG + Intergenic
946993613 2:225364778-225364800 TATTTTGCAAAGAAGGCTCAAGG + Intergenic
947918131 2:233847902-233847924 TATCATCCAGAGAGGGCTGGTGG + Intronic
1169772681 20:9218837-9218859 TAGTAGGCAAAGAGGAGTTGGGG + Intronic
1172343258 20:34176103-34176125 TGTGCTGCAAAGAAGGCTTGAGG + Intergenic
1176186838 20:63784868-63784890 GATGATGCACAGAGGGGTTGGGG + Intronic
1177226745 21:18267057-18267079 TAGTATACAAAGAGGTCATGTGG + Exonic
1181380379 22:22497569-22497591 AATGATGTAAAGAGGGGTTGTGG + Intronic
1181446731 22:22982302-22982324 TATTATGCAAATAGGTTTTCTGG - Intergenic
1184514109 22:44950694-44950716 TATTATGCAAAGAGGGCTTGGGG + Intronic
949409537 3:3748899-3748921 AATTATGCACAGAGGGCTATGGG + Intronic
949427369 3:3933019-3933041 TAATATGCTAAGAGTGCTAGTGG + Intronic
949771213 3:7580312-7580334 TACTCTGCAAAGAGGGCTTAGGG + Intronic
952352811 3:32556860-32556882 TATTATGAAAATAGAGATTGTGG - Intronic
956158207 3:66320436-66320458 TATTATTCAAAGAGGGAATGGGG - Intronic
956661314 3:71601188-71601210 AATTATTGAAAGAAGGCTTGGGG - Intergenic
956807973 3:72836062-72836084 TATTCTGCAAATAGTGCTAGAGG + Intronic
959335958 3:105065878-105065900 TATGATGGAAAGAGGCATTGGGG + Intergenic
961184722 3:124904778-124904800 TCTTCTGGAAAGTGGGCTTGAGG - Intergenic
964866368 3:161266200-161266222 TAATATACAAGGAGGGATTGGGG + Intergenic
964988555 3:162775157-162775179 CATTTTCCAAAGAGGGTTTGAGG - Intergenic
966860400 3:184228539-184228561 GATTCTGCAGAGAGAGCTTGAGG - Intronic
968592106 4:1464438-1464460 AATTAGGAAAAGAGGGCTTACGG + Intergenic
969952940 4:10857147-10857169 TATTTTGAAAAGAGGCCATGGGG - Intergenic
972170298 4:36337154-36337176 AATCATGCAAAAAAGGCTTGGGG + Intronic
979466858 4:121049418-121049440 GATGATGCAAAGAGGGCCAGCGG - Intronic
981422357 4:144565597-144565619 TATTTTCCACAGAGAGCTTGTGG - Intergenic
981465326 4:145063006-145063028 TATAATGGAAGGAGGGATTGGGG + Intronic
981975433 4:150722785-150722807 TATCATGGAAAGAGGCATTGAGG + Intronic
982247496 4:153368264-153368286 TTTTAAGCAATGAGAGCTTGAGG - Intronic
982268726 4:153564975-153564997 TATGAGGCTAAGAGAGCTTGTGG - Intronic
982683509 4:158460067-158460089 TATTGTGGAAAGAGGCATTGAGG - Intronic
988524754 5:31977346-31977368 TTCTATTAAAAGAGGGCTTGAGG - Intronic
988992793 5:36688001-36688023 TTTTATGCACAGAATGCTTGGGG - Exonic
991448282 5:66723955-66723977 TATTTGGCAAAGAGGGGTGGGGG - Intronic
992372207 5:76154857-76154879 TATTTTCCAAAGAGGGTTTTGGG + Intronic
992453287 5:76892583-76892605 TTTTTTCCAAAGAGGGTTTGGGG + Intronic
996459397 5:123724608-123724630 TATAATGGAAAGAGGTATTGAGG + Intergenic
1006817038 6:36858632-36858654 TCTCATGCAAAGAGGGATGGGGG + Intronic
1008737191 6:54559447-54559469 TATTATGGATTGAGGGGTTGAGG - Intergenic
1010362631 6:75012601-75012623 TATTAGGATATGAGGGCTTGAGG - Intergenic
1011105100 6:83770641-83770663 TATTATGCAAAATGGACATGAGG + Intergenic
1012293515 6:97490312-97490334 TATTATGCAAATAATGATTGAGG - Intergenic
1012341155 6:98125411-98125433 TATCATGCAAAAAGGGCTTCAGG - Intergenic
1013053028 6:106555431-106555453 GATTATTCAAAAAGGACTTGAGG + Intronic
1015052948 6:128863778-128863800 TATTATGTAAACAGGGATTGAGG - Intergenic
1015297734 6:131617286-131617308 CATTATGCAAATAGTACTTGAGG - Intronic
1015406957 6:132848493-132848515 TATTATGCAAAAATGGCATATGG + Intergenic
1017668348 6:156743849-156743871 TATAAGGCAAAGATGGTTTGGGG - Intergenic
1018108200 6:160509103-160509125 GATTAAGCAAAGAGGTTTTGGGG - Intergenic
1018178686 6:161201382-161201404 TTTTATTCAAAGAGCACTTGAGG + Intronic
1019145250 6:169971747-169971769 AATTATTCAAAGGGCGCTTGCGG - Intergenic
1022562712 7:31366260-31366282 TATTATCCAGAGAGGGAGTGAGG - Intergenic
1022888408 7:34670649-34670671 TAATATGTAAAGAGCCCTTGAGG + Intronic
1024899347 7:54300093-54300115 GATTATGCAAGGAGGGCAAGGGG - Intergenic
1026491019 7:70863559-70863581 TATGATGCACAGAGAGCTGGTGG + Intergenic
1027508775 7:79052959-79052981 TCTTATGGAAAGAGGATTTGAGG - Intronic
1028767786 7:94579848-94579870 TTTTATGCAAAGTGAACTTGAGG - Intergenic
1029888863 7:103905391-103905413 TCTTATGAAAAGAGGTCCTGGGG - Intronic
1032323426 7:130904702-130904724 TATGCTGCAAAAAGAGCTTGTGG - Intergenic
1033872616 7:145774648-145774670 TATTAAGAAAAGAGGCCTTTGGG + Intergenic
1036942430 8:13064494-13064516 TATTATCCAGAGAGGGCTAGAGG + Intergenic
1040077766 8:43257335-43257357 TATTATGCTAATAGTGCCTGTGG + Intergenic
1040491564 8:47928129-47928151 AATTATGTTAAGAGAGCTTGAGG + Intronic
1041744901 8:61197993-61198015 TATCATGGAAAGAGGCATTGAGG - Intronic
1044598626 8:93981956-93981978 AATTAGGCAAAGAGGAATTGGGG - Intergenic
1046384215 8:113487446-113487468 TATTATGAAAAGAAGCATTGAGG - Intergenic
1047982278 8:130195702-130195724 CATTATGCAAAAGGGGCTTAAGG + Intronic
1049271994 8:141700894-141700916 TGGTATGCAAACAGGGCCTGGGG + Intergenic
1052946284 9:34170948-34170970 TACTATGCACAGAGGTCTTCTGG + Intergenic
1053304694 9:36975951-36975973 TATTAAGCTAGGAAGGCTTGAGG + Intronic
1056019106 9:82423154-82423176 ATTTATGCAAAGAAGGATTGGGG + Intergenic
1057283085 9:93726753-93726775 TATGATTCACAGAGGGCCTGAGG - Intergenic
1057840897 9:98484954-98484976 TCTTATGCTGAAAGGGCTTGGGG + Intronic
1059563428 9:115357993-115358015 AATTATTCAAAGAAGGCATGTGG + Intronic
1061437870 9:130578210-130578232 CATTATGCCAAGAGAGCTTTGGG - Intergenic
1186362043 X:8852625-8852647 AATTCAGCAGAGAGGGCTTGGGG - Intergenic
1186690925 X:11974754-11974776 TATTATGAAAGGAGGGCTTGTGG + Intergenic
1187257269 X:17654751-17654773 AATTATCCAAAGATGACTTGTGG - Intronic
1187493539 X:19774989-19775011 TACTAAACAGAGAGGGCTTGGGG - Intronic
1188672653 X:32898710-32898732 TAATATGCAATGAGGGCTGCTGG + Intronic
1189234024 X:39474066-39474088 TATAATGCATACAGGACTTGGGG + Intergenic
1192072741 X:67958386-67958408 AATTATGCAAAGAGGGCCAAAGG - Intergenic
1192508002 X:71701784-71701806 TATTATGCAAAGAGAGGGTATGG - Intergenic
1192518694 X:71779768-71779790 TATTATGCAAAGAGAGGGTATGG + Intergenic
1192756917 X:74056170-74056192 TATTAAAGAAATAGGGCTTGGGG + Intergenic
1194129711 X:90066322-90066344 TGTTAAGAAAAGAGGGTTTGTGG + Intergenic
1198213762 X:134538035-134538057 AAGTATGCCAAGAGGGGTTGAGG - Intergenic
1198478972 X:137023325-137023347 TTTTCTGAAAGGAGGGCTTGAGG + Intergenic
1200370112 X:155715987-155716009 TATTATGGAAAGAGGCATTGAGG - Intergenic