ID: 1184514557

View in Genome Browser
Species Human (GRCh38)
Location 22:44954025-44954047
Sequence GCTCAGAGCAGACCCCCAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 698
Summary {0: 1, 1: 1, 2: 98, 3: 217, 4: 381}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184514545_1184514557 13 Left 1184514545 22:44953989-44954011 CCACCCCACCGGGCTCTTCCTAA 0: 1
1: 0
2: 1
3: 24
4: 194
Right 1184514557 22:44954025-44954047 GCTCAGAGCAGACCCCCAGTGGG 0: 1
1: 1
2: 98
3: 217
4: 381
1184514552_1184514557 -5 Left 1184514552 22:44954007-44954029 CCTAAGGAGCCTCTCCCGGCTCA 0: 1
1: 0
2: 0
3: 12
4: 129
Right 1184514557 22:44954025-44954047 GCTCAGAGCAGACCCCCAGTGGG 0: 1
1: 1
2: 98
3: 217
4: 381
1184514539_1184514557 29 Left 1184514539 22:44953973-44953995 CCCTTGGCCTGAACCACCACCCC 0: 1
1: 0
2: 2
3: 25
4: 343
Right 1184514557 22:44954025-44954047 GCTCAGAGCAGACCCCCAGTGGG 0: 1
1: 1
2: 98
3: 217
4: 381
1184514549_1184514557 8 Left 1184514549 22:44953994-44954016 CCACCGGGCTCTTCCTAAGGAGC No data
Right 1184514557 22:44954025-44954047 GCTCAGAGCAGACCCCCAGTGGG 0: 1
1: 1
2: 98
3: 217
4: 381
1184514547_1184514557 10 Left 1184514547 22:44953992-44954014 CCCCACCGGGCTCTTCCTAAGGA 0: 1
1: 0
2: 2
3: 6
4: 110
Right 1184514557 22:44954025-44954047 GCTCAGAGCAGACCCCCAGTGGG 0: 1
1: 1
2: 98
3: 217
4: 381
1184514543_1184514557 22 Left 1184514543 22:44953980-44954002 CCTGAACCACCACCCCACCGGGC 0: 1
1: 0
2: 0
3: 20
4: 269
Right 1184514557 22:44954025-44954047 GCTCAGAGCAGACCCCCAGTGGG 0: 1
1: 1
2: 98
3: 217
4: 381
1184514540_1184514557 28 Left 1184514540 22:44953974-44953996 CCTTGGCCTGAACCACCACCCCA 0: 1
1: 1
2: 2
3: 47
4: 342
Right 1184514557 22:44954025-44954047 GCTCAGAGCAGACCCCCAGTGGG 0: 1
1: 1
2: 98
3: 217
4: 381
1184514544_1184514557 16 Left 1184514544 22:44953986-44954008 CCACCACCCCACCGGGCTCTTCC 0: 1
1: 0
2: 1
3: 48
4: 561
Right 1184514557 22:44954025-44954047 GCTCAGAGCAGACCCCCAGTGGG 0: 1
1: 1
2: 98
3: 217
4: 381
1184514548_1184514557 9 Left 1184514548 22:44953993-44954015 CCCACCGGGCTCTTCCTAAGGAG 0: 1
1: 0
2: 0
3: 3
4: 63
Right 1184514557 22:44954025-44954047 GCTCAGAGCAGACCCCCAGTGGG 0: 1
1: 1
2: 98
3: 217
4: 381
1184514550_1184514557 5 Left 1184514550 22:44953997-44954019 CCGGGCTCTTCCTAAGGAGCCTC 0: 1
1: 0
2: 2
3: 17
4: 172
Right 1184514557 22:44954025-44954047 GCTCAGAGCAGACCCCCAGTGGG 0: 1
1: 1
2: 98
3: 217
4: 381

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184514557 Original CRISPR GCTCAGAGCAGACCCCCAGT GGG Intronic
900987890 1:6083631-6083653 GCTCAGAGCTGAGCCCCCGGTGG + Intronic
901005028 1:6167381-6167403 GATCAGAGGAGACGCCCAGAAGG + Intronic
901158001 1:7153660-7153682 TCTCACAGCAGACAGCCAGTGGG + Intronic
901403513 1:9031215-9031237 GCTCAGAGGAGGCCCACAGTAGG + Intergenic
901659334 1:10788848-10788870 GCACAGAGGAGCCCACCAGTGGG + Intronic
902797988 1:18811753-18811775 GCTCACACCAGACCCCCTGTCGG + Intergenic
903101820 1:21036277-21036299 GCTCAGAGGAGACCTGCAGTGGG - Intronic
903145767 1:21371026-21371048 GCTCAGAGCAGACCCACGTGGGG + Intergenic
903239269 1:21971782-21971804 GCTCAGAGCAGTCTCCAACTCGG - Intergenic
903631447 1:24776079-24776101 GCACAGAGCAGGCTCCAAGTAGG - Intronic
904365694 1:30009808-30009830 GCTCAGAGAAGACCCACAGTGGG + Intergenic
904443832 1:30551475-30551497 GCTCAGAGGAGACCTGCAGTGGG - Intergenic
905546150 1:38801901-38801923 GCTCAGAGGAGACCCTCAGTGGG - Intergenic
906448203 1:45921984-45922006 GCTTAGAGGGGACCCGCAGTGGG + Intronic
906746626 1:48226432-48226454 ACACAGAGCAGGCACCCAGTGGG + Intronic
907252971 1:53155319-53155341 GTTCAGAGGAGACCCTCAGCGGG - Intergenic
907305764 1:53512380-53512402 GCTCAGAGAAGACGCCGAATAGG - Intronic
907761872 1:57368662-57368684 GCTCAGAGGAGACCTGCAGTGGG - Intronic
908259273 1:62327148-62327170 GCTCAGAGGAGACCCACAGTGGG + Intergenic
909282360 1:73771177-73771199 GCTCAGAGAAAACCCTCAGTGGG - Intergenic
910602090 1:89043205-89043227 GCTCAGAGGAAACCCACAGTGGG + Intergenic
910654903 1:89609655-89609677 GCTCAGAGGAGACCTGCAGTGGG + Intergenic
911004100 1:93199732-93199754 GCTCAGAGGAGACCCACAGTGGG + Intronic
911025089 1:93427387-93427409 GCTTAGAGGAGGCCCACAGTAGG - Intergenic
911050552 1:93667292-93667314 GCTCAACGCAGATTCCCAGTAGG + Intronic
911275616 1:95854175-95854197 GCTCAGAGAACACCCACAGTGGG - Intergenic
912013718 1:105005422-105005444 GCAGAGAGGAGACCCTCAGTGGG + Intergenic
912459355 1:109820630-109820652 TGTCAGAGCAGACCCTTAGTGGG + Intergenic
912488465 1:110047695-110047717 GCTCTGAGCAGTCCTCCTGTTGG - Intronic
913221884 1:116667004-116667026 GCTCAGCGCTCAGCCCCAGTGGG - Intronic
915105822 1:153534649-153534671 ACTCAGAGAGGACCCCCAGAGGG + Exonic
915200253 1:154221457-154221479 GATCAGAGGAGGCCCGCAGTGGG - Intronic
917496964 1:175549157-175549179 ACCCAAAGCAGACCCTCAGTGGG - Intronic
918904622 1:190476372-190476394 GTTCAGAGAAAACCCTCAGTGGG + Intronic
918963167 1:191306414-191306436 GCTCAGAGGAGAGCCGCACTGGG + Intergenic
918983630 1:191595814-191595836 GCTCAGAGGAGACCCGCAGTGGG + Intergenic
919083203 1:192891136-192891158 GCTCAGAGGAGACCCACGGTGGG + Intergenic
919513390 1:198493863-198493885 GCTCAGAGGAGACCCACAGTGGG + Intergenic
920440934 1:205979929-205979951 GCTCAGGCCAGACACCCAGCTGG + Intronic
920944110 1:210512203-210512225 GCTCAGGGCAGACCCAGAGATGG + Intronic
922041637 1:221903586-221903608 GCTCAGAGAAGACCCACATGGGG + Intergenic
922763233 1:228145097-228145119 TCTCAGAGCAGGCTCCCAGAGGG + Intronic
922861361 1:228819083-228819105 GCTCAGAGGAGATCCTCAGTGGG - Intergenic
923255254 1:232216411-232216433 GCTCAGATCAGTCTCACAGTAGG + Intergenic
923328185 1:232898859-232898881 GCAGAGAGGAGACCCACAGTGGG - Intergenic
923535003 1:234842653-234842675 GCCCAGAGCTGACTCCCATTCGG + Intergenic
924306189 1:242691420-242691442 GCTCTGAGAATACCCTCAGTTGG - Intergenic
924679982 1:246221264-246221286 ACTCAGAGAAAACCCACAGTGGG - Intronic
1062771387 10:104433-104455 GCTCAGAGGAGACCCACAGTGGG + Intergenic
1065201424 10:23316696-23316718 GCTAAGAGAAGACCCACAGTGGG + Intronic
1065407923 10:25389492-25389514 GCTCAGAGGAGATCTGCAGTGGG - Intronic
1065814221 10:29470063-29470085 CCTCAGAGCGGCCCCCAAGTCGG + Intronic
1066101501 10:32122287-32122309 GCTCAGAGGAGACCCGCAGGGGG + Intergenic
1067567734 10:47350539-47350561 GCTCACAGCAGACCTCCAGGAGG + Exonic
1068060555 10:52063664-52063686 GCTCAGAGAAAACCTGCAGTGGG + Intronic
1068157645 10:53222434-53222456 GCTCAGAGGGGACCTGCAGTGGG + Intergenic
1068283615 10:54908678-54908700 GCTCAGAGGAGACCCGCAGTGGG + Intronic
1070096183 10:73340283-73340305 GCAGAGAGGAGACCCACAGTGGG + Intronic
1071060845 10:81570041-81570063 GCTCAGAGGGGACCCACAGTGGG + Intergenic
1071281805 10:84110376-84110398 GCCAGGAACAGACCCCCAGTGGG + Intergenic
1071819332 10:89264392-89264414 GAGGAGAGGAGACCCCCAGTGGG + Intronic
1072154680 10:92714277-92714299 GCTCAGAGGAGACCCACAGTGGG + Intergenic
1072335494 10:94394890-94394912 GCTCGGAAGAGACCCACAGTGGG + Intergenic
1072470150 10:95706392-95706414 GCTCAGAGGAGACCCTCAGTGGG + Intergenic
1073260670 10:102188105-102188127 GCTCAGGGGAGACGCACAGTGGG + Intergenic
1073426666 10:103459232-103459254 GCATGGAGGAGACCCCCAGTGGG - Intergenic
1073479643 10:103778386-103778408 GCACAGAGGAAACCCCCAGAAGG + Intronic
1073946004 10:108751252-108751274 GCTTAGAGCATATCCCCATTGGG - Intergenic
1074247901 10:111713392-111713414 GCTCAGGGGAGACCCACAGTGGG + Intergenic
1074348392 10:112710650-112710672 GCTCAGAGTAAACCCCAACTTGG - Intronic
1075295499 10:121271652-121271674 ACTCAGGGAAGACCCCTAGTCGG + Intergenic
1076138020 10:128058274-128058296 GCTCAGAGAAGACTTGCAGTGGG - Intronic
1076775847 10:132697651-132697673 ACCCAGAACAGACCCCCAGCGGG - Intronic
1077844661 11:6012243-6012265 GCTCAGAGAAGACCTGAAGTGGG + Intergenic
1078042714 11:7883616-7883638 GCTCAGAGGAGACCCACAGAGGG + Intergenic
1078345509 11:10544530-10544552 GCTGAGAGGAGACCCACAGTGGG + Intergenic
1078836364 11:15034637-15034659 GCTCAGAGGAGACCTACAGTGGG + Intronic
1079710657 11:23679556-23679578 GCTCAGGGAAGACCCGCAGTGGG + Intergenic
1080450638 11:32376077-32376099 CCTCTGAGCACACCCCCAGTGGG - Intergenic
1080583919 11:33665255-33665277 GCTCAGAGGAGACCCACAGTGGG + Intronic
1080851949 11:36077992-36078014 GCTCAGAGGAGACTCACAGTGGG + Intronic
1083066729 11:59931748-59931770 GCTCAGTGGAGACCAACAGTAGG + Intergenic
1083551037 11:63590423-63590445 GCTCAGAGCTGGCCCCCAGCCGG + Intronic
1084469443 11:69348492-69348514 GCTCAGAGGAGACCCGCAGTGGG + Intronic
1084844150 11:71886409-71886431 GCCAGGAACAGACCCCCAGTTGG + Intronic
1085212151 11:74791156-74791178 GCTGAGAGGAGATCCACAGTGGG + Intronic
1085294662 11:75424323-75424345 CCTCAGAGCAGACCCCCGACGGG + Intronic
1085435215 11:76493632-76493654 GCTGAGAGAAGACCCACAGTGGG - Intronic
1086249345 11:84795217-84795239 GCAAAGAGGAGACCCACAGTGGG - Intronic
1086249385 11:84795494-84795516 GCTCAGAGGAGACCTGCAGTGGG - Intronic
1086508257 11:87528381-87528403 GCTCTGAGGAGACCTACAGTGGG + Intergenic
1087037847 11:93772704-93772726 GCTCAAAGAAGACCTGCAGTGGG + Intronic
1087162605 11:94964082-94964104 GCTCAGAGCAGAACTCTGGTTGG + Intronic
1087211012 11:95446598-95446620 GCTCAGAGGAGACCCACATTGGG + Intergenic
1087338874 11:96877947-96877969 GCTCAGAGGAGACCCACAGTGGG + Intergenic
1087338883 11:96878017-96878039 GCAGAGAGGAGACCCACAGTGGG + Intergenic
1087453402 11:98353245-98353267 GCTGAGAGGAGACCCACAGTGGG + Intergenic
1087928884 11:103952549-103952571 GCTCATATCAGACCCCCAGATGG - Intronic
1088135707 11:106553011-106553033 GCTCAGAGGAGACCTGCAGGGGG - Intergenic
1088513347 11:110600021-110600043 GCTCAGAGGAGACCCACAGGGGG - Intronic
1088651183 11:111959020-111959042 GCTCAGAGGAGACGTGCAGTGGG - Intronic
1088704218 11:112447480-112447502 GCTCAGAGGAGACCCGCAGTGGG + Intergenic
1089822450 11:121241008-121241030 GCTCAGAAGAGACCCGCAGTGGG + Intergenic
1089861182 11:121591208-121591230 GCCCAGAGCACACCCCCAGAAGG - Intronic
1090124842 11:124075150-124075172 GCTCAGAGGGGACCTGCAGTGGG + Intergenic
1090136970 11:124209313-124209335 GCTCAGAGGAGACCTGCAATGGG + Intergenic
1090635273 11:128686993-128687015 GCTCAGAGCACCCCACCCGTTGG - Intronic
1090910096 11:131111187-131111209 GCTCAGAGGAGACCTGCAGTGGG + Intergenic
1091088397 11:132746015-132746037 GCTCAGAGCAGAGCCCTGCTGGG - Intronic
1091752447 12:3031345-3031367 GGTCAGAGCGGAGACCCAGTTGG + Intronic
1091948550 12:4571472-4571494 ACTCACAGCACACCCCCAGTAGG - Intronic
1092447044 12:8567617-8567639 GCTCAGAGAAAATCCACAGTGGG + Intergenic
1092508163 12:9125227-9125249 GCTCAGAGGAGACCCACAGTGGG - Intergenic
1093059542 12:14588850-14588872 GCTCAGAGGAGAGCCGCAGTGGG + Intergenic
1094175468 12:27536798-27536820 GCTCAGAAAAGACCCACAGTTGG - Intronic
1095042373 12:37456367-37456389 GCTCAGAGGAGACCCATGGTGGG - Intergenic
1095603257 12:44038006-44038028 GCTAAGAGGAGACCCTCAGTGGG - Intronic
1095826144 12:46531700-46531722 GCTCAGAGGGGAACCACAGTGGG - Intergenic
1095909575 12:47412553-47412575 ACTCAGAGCACACATCCAGTTGG + Intergenic
1095954993 12:47800768-47800790 ACTGTGAGCAGACCCCCAGCAGG + Intronic
1096171951 12:49478920-49478942 GCTCAGCGGAGACCCGCAGTGGG + Intronic
1096295610 12:50381388-50381410 GCTCAGAGGAGACCCTCAGTGGG + Intronic
1096295621 12:50381458-50381480 GCAGAGAGGAGACCCACAGTGGG + Intronic
1096602928 12:52742926-52742948 GCTCAGAAGTGACCCACAGTGGG - Intergenic
1096944651 12:55391713-55391735 GCTCAGAGGAGACCAGCAGCAGG + Intergenic
1097076206 12:56396791-56396813 GCTCAGAAGAGACCCACAGTGGG + Intergenic
1097078126 12:56410263-56410285 GTTCAGAGGAGACCCACAGTGGG + Intergenic
1097446451 12:59678373-59678395 GCTCAGAGGAGACCTGCAGTAGG + Intronic
1097500298 12:60392810-60392832 GCTCAGAGAAGACCCACATTAGG - Intergenic
1097919098 12:65052534-65052556 GCTAAGAACATACTCCCAGTGGG - Intronic
1098951642 12:76645666-76645688 GCTCGGAGGAGACCCAAAGTGGG - Intergenic
1099295451 12:80823068-80823090 GCTCAGAAGAGACCCACAGTGGG - Intronic
1099693410 12:85991096-85991118 ACTCAGACAAGACCCACAGTGGG + Intronic
1101086306 12:101239786-101239808 GCTCAGAGGAGACCTGCAGTGGG - Intergenic
1101763938 12:107681872-107681894 GCTCAGAGAAGACCCACAGTGGG + Intergenic
1102535333 12:113576751-113576773 CCTCAGCTCAGGCCCCCAGTTGG - Intergenic
1102704698 12:114870845-114870867 GCTCAGATCAAACCCTCACTTGG + Intergenic
1102727087 12:115075182-115075204 GCTCAGAGAAGCCCCTCAGCTGG - Intergenic
1104295609 12:127509372-127509394 GCTCAGAACACCCCCCAAGTGGG + Intergenic
1105041924 12:132967455-132967477 GCTCAGAGGAGACCCACAGTGGG - Intergenic
1106308980 13:28535994-28536016 GCTCAGAGGAGACCCACAGTGGG - Intergenic
1106587577 13:31070588-31070610 GCTCAGAGCAGACTTCTAGCAGG - Intergenic
1108016968 13:46086380-46086402 GCTCAGAGGAGACTCGCGGTGGG + Intronic
1108240279 13:48457160-48457182 GCTTAGAGAAGACCCATAGTGGG + Intronic
1108542532 13:51456983-51457005 GCAGAGAGGAGACCCACAGTGGG - Intergenic
1108559385 13:51627847-51627869 GCAGAGAGGAGACCCACAGTGGG + Intronic
1108787410 13:53921497-53921519 GCTCAGAGGAGACCCACAGTGGG + Intergenic
1109396453 13:61765976-61765998 GCTCAGAGGAGACCTGCATTGGG + Intergenic
1109438944 13:62343789-62343811 GCTCAGAGGAGACCCACAGTGGG - Intergenic
1109470694 13:62799888-62799910 GCTCAGAGGAGACCCACAGTGGG - Intergenic
1109618129 13:64863740-64863762 TCTCAGAGCAGACTGCGAGTTGG + Intergenic
1109686695 13:65830124-65830146 GCTCTCAGGAGACCCGCAGTGGG - Intergenic
1109837486 13:67878026-67878048 GCAGAGAGGAGACCCACAGTGGG - Intergenic
1109837497 13:67878097-67878119 GCTCAGAGAAGACCTGCAGTGGG - Intergenic
1110201182 13:72851843-72851865 GCTGAGAGGAGACCCACAGTTGG - Intronic
1110201188 13:72851913-72851935 GCTGAGAGGAGACCCACAGTGGG - Intronic
1110778024 13:79432686-79432708 GCTCAGAGGAGACCTTCAGTGGG - Intergenic
1111237818 13:85431565-85431587 ACTCAGTGGAGACCCACAGTGGG - Intergenic
1111337191 13:86839751-86839773 GCTTAGAGAAGACCAGCAGTGGG + Intergenic
1111347333 13:86975139-86975161 GAGCAGAGGAGACCCCTAGTGGG - Intergenic
1111485726 13:88896072-88896094 GCTGAGAGGAGACCCATAGTGGG - Intergenic
1111800421 13:92974459-92974481 GCTCAGAGGAGACCCACAGTAGG + Intergenic
1113339214 13:109405199-109405221 GCTCAGAGGAGACTTGCAGTGGG - Intergenic
1113970744 13:114186342-114186364 GCTCAGAGGAGACCCACAGTGGG - Intergenic
1114349524 14:21835278-21835300 GCTCAGAGGAGACCTGCATTGGG + Intergenic
1114516475 14:23302823-23302845 GCTCAGAGCAGACCGCTAGCAGG - Exonic
1114682952 14:24502305-24502327 GCTCAGAGATGACACCCTGTAGG + Intronic
1116131457 14:40859651-40859673 GCTCAGAGGATATCCACAGTGGG - Intergenic
1116221645 14:42095756-42095778 GCTCAGAGGAGACCTGCAATGGG + Intergenic
1116257275 14:42571777-42571799 CCTCAGAGGAGACCCAGAGTGGG - Intergenic
1117285443 14:54282334-54282356 GCTCAGAGGAGACCCGCAGTGGG + Intergenic
1117734061 14:58751557-58751579 GCTCAGAGGAGACCTGCATTGGG - Intergenic
1118213491 14:63787576-63787598 GCTCAGAGGAGACCTGCAGTGGG + Intergenic
1118473068 14:66093372-66093394 GCTCACAGGAGACCCGCAGTGGG + Intergenic
1118521966 14:66595972-66595994 GCTTAAAGGAGACCCACAGTGGG + Intronic
1118521986 14:66596112-66596134 GCAGAGAGGAGACCCTCAGTGGG + Intronic
1119439458 14:74618499-74618521 ACTCAGAGCGGACCCCTAGCTGG - Intergenic
1119716293 14:76861883-76861905 GCACAGAGCAGACCCACTGGGGG - Intronic
1120405780 14:84091735-84091757 GCTCAGACGAGACCCACAGTGGG - Intergenic
1120590083 14:86364439-86364461 GCTCAGAGGAGACCTACATTGGG - Intergenic
1121327291 14:93028651-93028673 GCCCAGAGCAGGCCCCCTGCAGG + Intronic
1121562710 14:94886817-94886839 GCTCAGAGCAGAGTCCCTGGAGG - Intergenic
1122441878 14:101737516-101737538 ACTGGGAGGAGACCCCCAGTGGG - Intergenic
1122854476 14:104553539-104553561 GGTCAGAGCAGCACCCCCGTGGG + Intronic
1122941056 14:104981554-104981576 GCTAGGAGAAGACCCCCAGAAGG - Intergenic
1202840237 14_GL000009v2_random:114595-114617 GCTCAGAGGAGACCTGCAGTGGG - Intergenic
1202909618 14_GL000194v1_random:104792-104814 GCTCAGAGGAGACCTGCAGTGGG - Intergenic
1202883668 14_KI270722v1_random:84510-84532 GCTCAGAGGGGACCTGCAGTGGG + Intergenic
1202940900 14_KI270725v1_random:144092-144114 GCTCAGAGGAGACCCATAGTGGG - Intergenic
1123888406 15:24749668-24749690 GCTCAGAGAAGCCCTACAGTGGG - Intergenic
1124820916 15:33044801-33044823 GCTCAGAGGAGACCTACAGTGGG - Intronic
1125241596 15:37582652-37582674 GCTCAGAGGAGACCCACAGTGGG - Intergenic
1125718209 15:41831724-41831746 GCTCAGAGGAGACCCACAGTGGG - Intronic
1125752417 15:42037468-42037490 GCTCAGAGGAGACCCGCAGTAGG - Intronic
1126292563 15:47099151-47099173 GCTCCGAGGAGACCCATAGTGGG + Intergenic
1126386177 15:48095678-48095700 GCTCAGAGCAGACATCAAGCTGG - Intergenic
1126990825 15:54374048-54374070 GCTGAAAGAAGACCCTCAGTGGG + Intronic
1127525860 15:59791689-59791711 GCTCAGAGGAGACCCGCAGTGGG + Intergenic
1128965342 15:72052335-72052357 GCTCAGAGGAGACTCGCAGTGGG - Intronic
1129368990 15:75076268-75076290 GCTCAAAGGAGACCCACAGTGGG + Intronic
1129785155 15:78304856-78304878 GCTCAGAGAAGACCCGCAGTGGG - Intergenic
1130069038 15:80630981-80631003 GCTCACTGCAGACCCCCCGCGGG + Intergenic
1130856073 15:87841158-87841180 GCTCAGAGGAGACCCACAGTGGG + Intergenic
1131035859 15:89221688-89221710 GCTCACAGGAGGCCCTCAGTGGG + Exonic
1132573204 16:652987-653009 ACTCAGAGCAGGCACCCAGCAGG - Intronic
1132796857 16:1728795-1728817 GCACACAGCAGCCCCCCAGACGG + Intronic
1134679584 16:16114874-16114896 TCTTTGAGCGGACCCCCAGTGGG + Exonic
1137256464 16:46778893-46778915 GCTCAGAGGAGACCTGCAGGGGG - Intronic
1137343940 16:47637116-47637138 GCTGAGAGGAGACCCGCAGTGGG - Intronic
1137548875 16:49423223-49423245 GCTCAGTGCAGACCACCACTCGG + Intergenic
1137588658 16:49680018-49680040 GCTCAGAGGAGACCCACAGTGGG - Intronic
1137623339 16:49891568-49891590 GCTCAGAGGAGACTGGCAGTGGG + Intergenic
1137825225 16:51489220-51489242 GCTCAGAGGAGACCTGCAGTGGG + Intergenic
1138027940 16:53537545-53537567 GCTCATAGCAGACACCCTGGGGG + Intergenic
1138033480 16:53579765-53579787 GCCCAGAGGAGACCTGCAGTGGG + Intergenic
1139389968 16:66601317-66601339 GCTCAGAGGAGACTGACAGTGGG + Intergenic
1139625775 16:68187512-68187534 GCTCAGAGAAGACCCACAGAGGG + Intronic
1141097075 16:81170534-81170556 GGTCAGAGAAGACCCCCAGAAGG + Intergenic
1141299638 16:82802059-82802081 GCTCAGAGCTGTGCCCCACTGGG + Intronic
1141606116 16:85154295-85154317 TCTCAGAGGAGACCCCAAGTGGG + Intergenic
1141689335 16:85587594-85587616 GCTCAGCCCAGGCCCCCTGTTGG + Intergenic
1142304599 16:89278390-89278412 GCTCAGAGCAGGGCCCCATTTGG + Intronic
1142388828 16:89784748-89784770 GCTCAGAGCAGATCTGCAGGAGG + Intronic
1143499480 17:7330426-7330448 GCTGAGAGCAGCCCCCCAGTGGG + Intergenic
1144585126 17:16483083-16483105 GGCCAGAGCAGCCCCACAGTAGG + Intronic
1146086976 17:29838745-29838767 GCTCAGAGGAGACCCACAGTGGG - Intronic
1146093547 17:29906041-29906063 GCTCAGAGGAGACCCGCAGTGGG - Intronic
1146143206 17:30387939-30387961 GCTCAGAGGAGACCGGCAGTGGG + Intronic
1146425351 17:32732599-32732621 GCTCAGAGGAGAATCTCAGTGGG - Intronic
1149085546 17:52710753-52710775 GCTCAGAGGAAACCCACAGTGGG - Intergenic
1149238021 17:54616179-54616201 GCTTAGAGGAGACCCACGGTGGG - Intergenic
1149329907 17:55570104-55570126 GCTCAGAGAAGACCCACACTGGG - Intergenic
1149482871 17:57017743-57017765 GCTCAGAGGAGACCTGCAGTGGG + Intergenic
1149884721 17:60328452-60328474 GCTTAGAGGAGACCTGCAGTGGG - Intronic
1150521096 17:65866819-65866841 GCTCAGAGGAGACCCAGAGTGGG - Intronic
1150952862 17:69822173-69822195 GCTCAGTGGAGACCTGCAGTGGG - Intergenic
1151395245 17:73819040-73819062 GCTCAGAGGAGACCCGCAGTGGG + Intergenic
1151710111 17:75799612-75799634 GCACAGAGCTGACCCACAGCAGG - Intronic
1151773147 17:76177973-76177995 GCTCAGAGGATACCCGCAGTGGG - Intronic
1152530515 17:80915976-80915998 GCTCAGAGGAGACCCACAGTTGG - Intronic
1152856570 17:82668091-82668113 GCTCAGGGGAGACCCACAGTGGG + Intronic
1152864162 17:82712374-82712396 GCTCAGAGGAGACTCGCAGTGGG + Intergenic
1153139307 18:1954179-1954201 GCTCAGAGGAGACCTGCAGTGGG + Intergenic
1155027860 18:21958501-21958523 ACTCACAGCAGACCCGCAGTGGG + Intergenic
1155120631 18:22815963-22815985 GCTCAGAGGAGACCTGCAGTGGG + Intronic
1156160409 18:34351535-34351557 GCTCAGAGGAGACCTGCAGTGGG - Intergenic
1156298732 18:35817437-35817459 ACTCAGAGGAGACCCGCAGTGGG + Intergenic
1157006382 18:43589425-43589447 GCTCAGAGGAGAGCCACAGTGGG + Intergenic
1157042847 18:44060837-44060859 GCTCAGAGAAGACCCACAGTAGG + Intergenic
1157492004 18:48130020-48130042 GCTGATGGCAGAGCCCCAGTAGG + Intronic
1157498283 18:48171689-48171711 GCCCAGAGCAGGCACACAGTAGG + Intronic
1157506704 18:48231463-48231485 GCAGAGAGGAGACCCACAGTGGG - Intronic
1157623060 18:49027118-49027140 GCTCAGCCCTGGCCCCCAGTGGG + Intergenic
1158023336 18:52869267-52869289 GCTCAGAGGAGACCCACAGTAGG + Intronic
1158139401 18:54241395-54241417 GCTCAGAGGAGACCCACAGTGGG + Intergenic
1158633045 18:59132661-59132683 GCTCAGAGGAGACCCACAGTGGG - Intergenic
1159186728 18:64984346-64984368 GCTCAGAAAAGACCCCCGGTGGG - Intergenic
1159189025 18:65017586-65017608 GCTCAGAGGAGACTCGCAATGGG + Intergenic
1159276776 18:66232177-66232199 AGTCAGAGCAGACCCACAATAGG - Intergenic
1160716637 19:579783-579805 GCTCCGCGCAGACCCCCAGAGGG + Intronic
1161342028 19:3748134-3748156 GCACAGAGCAGACACACACTGGG + Intronic
1162231658 19:9271364-9271386 GCTTAGAGGAGACCCACAGTGGG - Intergenic
1163578073 19:18122302-18122324 GCACAGAGCATACACACAGTGGG - Intronic
1163908027 19:20164613-20164635 GATCAGAGCAGAACCCTAGGGGG + Intergenic
1163935512 19:20439020-20439042 GATCAGAGCAGAACCCTAGCAGG - Intergenic
1164984471 19:32638359-32638381 GCTCTCAGGAGACCCACAGTGGG - Intronic
1165022700 19:32936931-32936953 GTTCAGAGGAGACCCACAGTGGG - Intronic
1165663281 19:37601818-37601840 GCTCAGAGCAGATTCAGAGTGGG + Intronic
1166329199 19:42069099-42069121 GCGCAGAGCAGGCCCCTAGTGGG + Intronic
1166898188 19:46037039-46037061 GCTCAGAAGAGACCCACAGTGGG - Intergenic
1167013223 19:46822400-46822422 GCTCAGAGGAGACCGTCAGTGGG - Intergenic
1167235115 19:48309513-48309535 GCTCAGAGGAGACCTGCAGGGGG - Intronic
1167346290 19:48947449-48947471 GCTCAGGGGAGACCCGCAGTGGG - Intergenic
1168129900 19:54311547-54311569 ACTCACAGCTGACCCCCAGTGGG - Exonic
1168338079 19:55607754-55607776 GTTAAGAGCAGCCCCCAAGTGGG - Intronic
1202632820 1_KI270706v1_random:15962-15984 GCTCAGAGGAGACGTGCAGTGGG + Intergenic
1202653058 1_KI270707v1_random:24087-24109 GCTCAGAGGAGAACTGCAGTGGG - Intergenic
1202659093 1_KI270708v1_random:51658-51680 GCTCAGAGGAGACCTGCAGTGGG + Intergenic
924963932 2:58315-58337 GCTCAGAGGAGACCCACAGGTGG - Intergenic
925067973 2:943888-943910 GCTCAGAGGACACCCGCAGGGGG + Intergenic
926554595 2:14342076-14342098 GCTCAGAGGAGACCCGCAATGGG - Intergenic
926707365 2:15846222-15846244 GCTCAGAGCTGGCCTCCAGGAGG + Intergenic
926934719 2:18075509-18075531 GCTCAAAGCAGAACCCCAAGAGG + Intronic
926953626 2:18271302-18271324 GCTCAGAGGAGAAACGCAGTGGG + Intronic
926958781 2:18331920-18331942 ACTCAGAGAAGACCAGCAGTGGG + Intronic
927789679 2:26000587-26000609 GCTGGGAGCAGGTCCCCAGTTGG + Intergenic
927863883 2:26576675-26576697 ACTCAGAGCATGCCCCCAGGGGG - Intronic
928429799 2:31207903-31207925 ACTCAGAGCAGAACCACAGTGGG - Intronic
928723548 2:34147165-34147187 GCTCAGAGGAGTCCTGCAGTGGG + Intergenic
929014619 2:37481971-37481993 GCTCAGAGCAGACCTCCATTGGG - Intergenic
929847093 2:45541622-45541644 GCAGAGAGGAGACCCACAGTGGG + Intronic
929847119 2:45541761-45541783 GCAGAGAGCAGACCCAAAGTGGG + Intronic
930007000 2:46905950-46905972 GCACAGAGCTGACCCTCAGGAGG - Intronic
930612073 2:53554603-53554625 GCTCAGAGGAAACCTGCAGTAGG - Intronic
930729058 2:54709921-54709943 GCTCAGAGGAGACCCGCAGTAGG - Intergenic
930800607 2:55438810-55438832 GCTCAGAGGAGACCTGTAGTGGG - Intergenic
930971147 2:57397362-57397384 GCTCCGAGGAGACCTGCAGTGGG + Intergenic
931300546 2:60974165-60974187 GTTCAGAGAAGACCCACAGTGGG - Intronic
931500131 2:62856038-62856060 GCTCAGAGGAGACTCGCAGTGGG - Intronic
932054670 2:68432294-68432316 GCTCAGAGGAGAACCACAGTAGG + Intergenic
932501596 2:72187478-72187500 GCTCAGAGATGACCCACAGTGGG + Intronic
932825309 2:74933634-74933656 CCACAGAGCAGACCCTCAGCTGG - Intergenic
933093352 2:78147135-78147157 GCTCAGAAGACACCCGCAGTGGG - Intergenic
933113104 2:78429634-78429656 GCTCAGAGGAGACTCACAGTGGG - Intergenic
933383773 2:81583984-81584006 GATCAGAGGAGACCCGCAGTGGG - Intergenic
934606472 2:95699227-95699249 CCTCAGTGCTGACCACCAGTTGG + Intergenic
935670472 2:105552361-105552383 GCTCAGAGGGGCCCCCCACTTGG - Intergenic
936539877 2:113341355-113341377 CCTCAGTGCTGACCACCAGTTGG + Intergenic
937163981 2:119794893-119794915 GCTCAGAGGAGACCTGCAGTGGG + Intronic
937330588 2:121025883-121025905 GCTCAGGGCAGGCCCCAAGCAGG + Intergenic
937737884 2:125313597-125313619 GCTCTCAGGAGACCCACAGTGGG - Intergenic
938180607 2:129178947-129178969 GCTCAGAGGAAACCCTCAGGGGG + Intergenic
938732526 2:134157956-134157978 GCTGAGGGGAGACCCACAGTGGG + Intronic
938763405 2:134444642-134444664 GCTCAAAGCAGGCTCCAAGTTGG - Intronic
939120881 2:138114728-138114750 GGTCAGAGATGACTCCCAGTTGG - Intergenic
940694212 2:156959030-156959052 GCTCAGAAGAGACCCACAGTGGG + Intergenic
941043664 2:160649400-160649422 GCTCAGAGGAGACCCGCAATGGG - Intergenic
942053431 2:172162096-172162118 GCTCAGAGGAGACTCGCAGTGGG + Intergenic
943191046 2:184680245-184680267 GCAGAGAGGAGACCCGCAGTGGG - Intronic
943191058 2:184680315-184680337 GCAGAGAGGAGACCCACAGTGGG - Intronic
943426954 2:187749630-187749652 GCTCAGAGGAGACTCACAGTGGG + Intergenic
943526325 2:189021215-189021237 GCTCAGATGAGACCCACGGTGGG - Intergenic
944383829 2:199141902-199141924 GCTCAAAGGAGACCCACGGTGGG - Intergenic
944483877 2:200182834-200182856 GCTCAGAGGAGACCTGCAGTGGG - Intergenic
944586722 2:201179303-201179325 GCTCAGAGGAGGCCCACAGTGGG - Intergenic
946197373 2:218043098-218043120 GCTCGGAGGAGACCTGCAGTAGG + Intronic
946807613 2:223486759-223486781 TCTCATAGAAGATCCCCAGTGGG + Intergenic
947316731 2:228866775-228866797 GCTCAGAGGAGACCTGCACTGGG - Intronic
947435382 2:230068291-230068313 GTTCAGGGCAGACCGCCAGGCGG - Intronic
948293550 2:236845003-236845025 GCTCAGAGGAGACCCACAGTAGG + Intergenic
948575347 2:238946369-238946391 GCTCAGAGGAGACCCACAGTGGG + Intergenic
948713046 2:239837090-239837112 GCTCAGAGGAGACCTGCAGTGGG - Intergenic
948800415 2:240430847-240430869 GCTCAGAGGATGCCTCCAGTTGG + Intergenic
1168997677 20:2145166-2145188 GCTCAGAGCAGCAGCCCAGGGGG - Exonic
1170043802 20:12065121-12065143 GCTCAGAGGAAACCCACAGGGGG + Intergenic
1170458415 20:16554469-16554491 GCTCAAAGGAGACCCGCACTGGG - Intronic
1170964635 20:21055416-21055438 GCTCACAGAAGACACCAAGTGGG - Intergenic
1171536805 20:25899440-25899462 GCTCAGAGGAGATCCATAGTGGG - Intergenic
1171804305 20:29661717-29661739 CCTCAGAGGAGACCCATAGTGGG + Intergenic
1171839747 20:30194705-30194727 GCTCAGAGGAGACCCATAGTGGG - Intergenic
1172764549 20:37344626-37344648 GCTCAGGGCGGGCCCCCAGCTGG - Intergenic
1172903221 20:38349872-38349894 GCTCAGATCACACAGCCAGTAGG - Intronic
1173207555 20:41006789-41006811 GCTCAGAGGAGACTCACAGTGGG + Intergenic
1173313765 20:41925017-41925039 GCTAAAAGCAGACACCCAGTGGG + Intergenic
1173718604 20:45233270-45233292 GCTCAGAGGAGACCTGTAGTGGG - Intergenic
1175064417 20:56272898-56272920 GCTCAGGGGAGACCTGCAGTGGG - Intergenic
1175065146 20:56277791-56277813 GCTCAGAGGAGACCTGCAGTGGG - Intergenic
1175138598 20:56843044-56843066 GCGGAGAGGAGACCCACAGTGGG - Intergenic
1175944735 20:62553440-62553462 GGCCACAGCAGACACCCAGTGGG - Intronic
1175959878 20:62630644-62630666 GCTCAGAGGAGACCCGCCGTGGG + Intergenic
1176104631 20:63380185-63380207 GCTCAGAGGCGACCCGCAGTGGG - Intergenic
1176271899 20:64239691-64239713 GCCCAGAGAGGACCCCCAGGAGG + Intronic
1176582259 21:8542849-8542871 GCTCAGAGGAGACCCATAGTGGG + Intergenic
1176599095 21:8775564-8775586 GCTCAGAGGAGAACTGCAGTGGG + Intergenic
1176625278 21:9087226-9087248 CCTGAGACCAGACCCCCAGGCGG + Intergenic
1176628968 21:9119500-9119522 GCTCAGAGGAGACCTGCAGTGGG - Intergenic
1176645034 21:9341842-9341864 GCTCAGAGGAGACGTGCAGTGGG + Intergenic
1176973219 21:15289847-15289869 GCTCAGAGGAGACCCACAGTGGG + Intergenic
1176976559 21:15327577-15327599 GCTCAGAGGAGACCTGCAATGGG - Intergenic
1177262644 21:18750330-18750352 GCTCAGAGGAGACCCACAGTAGG - Intergenic
1177357780 21:20031385-20031407 CCTCAGAGGAGACCCACAGTGGG + Intergenic
1177396038 21:20537753-20537775 GCTCAGAGGAGACTTGCAGTGGG + Intergenic
1177624835 21:23646391-23646413 GCTGAGAGGAGACCCACAGTGGG + Intergenic
1178244447 21:30937065-30937087 GCTCAGAAGAGACCTGCAGTGGG - Intergenic
1179887926 21:44322319-44322341 GCTCTGGGCAGACCACCAGCAGG - Intronic
1179925260 21:44530705-44530727 GCACCGAGCAGACACCCAGCTGG + Intronic
1180147786 21:45930884-45930906 CAGCAGAGCAGAGCCCCAGTGGG + Intronic
1180162436 21:46004224-46004246 GCTCAGGGCTGAGCCCCAGAGGG - Exonic
1180162455 21:46004308-46004330 GCTCAGGGCTGAGCCCCAGAGGG - Exonic
1180178869 21:46108955-46108977 GCTCACAGGAGACCCGCAGGGGG + Intronic
1180265094 22:10519897-10519919 GCTCAGAGGAGACCCATAGTGGG + Intergenic
1180367917 22:11957392-11957414 GCTCAGAGGAGACGTGCAGTGGG - Intergenic
1180378171 22:12113944-12113966 GCTCAGAGGAGACCTGCAGTGGG + Intergenic
1180419335 22:12799337-12799359 GCTCAGAGGAGAACTGCAGTGGG - Intergenic
1180953830 22:19732544-19732566 GGGCAGAGAAGACCCCCAGGAGG - Intergenic
1182771029 22:32796598-32796620 GCTCTGGCCAGACCCTCAGTGGG - Intronic
1183024922 22:35057891-35057913 GCTCAGAGGAGACTTGCAGTGGG + Intergenic
1183329169 22:37210256-37210278 CCTCAGAGCTTACCCCCAGCGGG - Intronic
1183732424 22:39626111-39626133 GCACAGAGCAAACCTCCAGCTGG - Intronic
1184173924 22:42775302-42775324 GCTCAGAGGAGACCCGCAGTGGG - Intergenic
1184339305 22:43877278-43877300 GCTCACAGGAGGCCCCCAGTGGG + Intergenic
1184514557 22:44954025-44954047 GCTCAGAGCAGACCCCCAGTGGG + Intronic
1184665743 22:45988036-45988058 GCTCAGAGGAGACCTGCAGTGGG - Intergenic
1184865786 22:47201298-47201320 GCTCAGAGAAGACCCACAGGGGG + Intergenic
949921941 3:9009946-9009968 GCACAGAGCAGACCCTCAAAGGG + Intronic
950207652 3:11092905-11092927 ACTCAGAGGAGACCTGCAGTGGG - Intergenic
951064657 3:18249800-18249822 TCTCTGAGCAGTCCCTCAGTAGG + Intronic
951182236 3:19672050-19672072 GCTCAGAGGAGACCAGCAGTGGG + Intergenic
951264665 3:20552169-20552191 GATCAGAGGAGACCTGCAGTGGG + Intergenic
951562377 3:23981764-23981786 GCTCAGAGGGGACCTGCAGTGGG + Intergenic
952016195 3:28959579-28959601 GCTCAGAGGAGACCCAAGGTGGG - Intergenic
952269313 3:31816759-31816781 GCTCAGAGGAGACCCGTAGCGGG + Intronic
952540416 3:34361574-34361596 GGTCAGAGCAGACTCTCAGAGGG - Intergenic
952793383 3:37217921-37217943 GCTCAGAGGAGACCGGCATTGGG - Intergenic
953578716 3:44134363-44134385 TCTCAGAGCAGAGCTCCAGCAGG + Intergenic
953581004 3:44156608-44156630 GCTCTGAGGAGAACCCCATTGGG + Intergenic
954099311 3:48357347-48357369 GCTCAGAGGAGACCCACAGTGGG + Intergenic
954498081 3:50983631-50983653 GCTCAGAGGAGACTCACAGTGGG - Intronic
954737066 3:52715364-52715386 GCTCAGAGGAGATCCGCAGGGGG - Intronic
955959109 3:64320751-64320773 GCTCAAAGAAGCCCCCAAGTAGG + Intronic
957095295 3:75772203-75772225 GCTCAGAGGAGACCTGCAGGGGG - Intronic
957404941 3:79765341-79765363 GCTCGGAGCAGATATCCAGTTGG - Intronic
957417936 3:79929869-79929891 GCTCTCAGGAGACCCACAGTGGG - Intergenic
957427075 3:80052062-80052084 GCTCAGAGGAGACTTACAGTGGG - Intergenic
957486738 3:80871262-80871284 GCAGAGAGGAGACCCGCAGTGGG - Intergenic
957636389 3:82790985-82791007 GCTCAGAGGAGGCCCACAATGGG - Intergenic
957705198 3:83770823-83770845 GCTTAGAGGAGACCCACAGTGGG - Intergenic
958195376 3:90236145-90236167 GCTCAGAGGAGACCCTCAGTGGG - Intergenic
958418795 3:93907560-93907582 GCTCAGAGGAGACCCTCAGTGGG - Intronic
958448968 3:94249689-94249711 ACACAGAGCAGACCACCAGGGGG + Intergenic
958572892 3:95911268-95911290 GCTCAGAGGAGACCCACAGTGGG + Intergenic
958675510 3:97264760-97264782 GCTCTGAGGAGACCCACAGTGGG + Intronic
959037507 3:101384081-101384103 GCTGAGAGGGGACCCACAGTGGG - Intronic
960333907 3:116392995-116393017 GCTCAGAGGAGACCCCCAGTGGG - Intronic
960634194 3:119767816-119767838 GCTCAGAGGAGACCCACAGTGGG + Intergenic
961413915 3:126743720-126743742 GCTCAGATCACCCCTCCAGTTGG - Intronic
961525849 3:127496863-127496885 GCTCAGAGGAGACCAGCAGTTGG - Intergenic
961824155 3:129590036-129590058 GGTCAGAGCAGACACCCGGCAGG - Intronic
961942925 3:130656344-130656366 GCTCAGAGGAGACCTGCAGTGGG + Intronic
962211966 3:133486901-133486923 GCTCAGAGGAGACCCACAGTGGG + Intergenic
962211975 3:133486971-133486993 GCAGAGAGGAGACCCACAGTGGG + Intergenic
962646387 3:137444955-137444977 TCTCACAGCAGTGCCCCAGTGGG + Intergenic
963805205 3:149715042-149715064 GCTCAGAGGAGACCTGCAGTGGG - Intronic
964522835 3:157586049-157586071 GCCAGGAACAGACCCCCAGTGGG - Intronic
964791754 3:160459884-160459906 GCTCAGAGGATCCCCGCAGTGGG + Intronic
965005684 3:163019513-163019535 GCTCAGAGGAGACCTGCAGTGGG - Intergenic
965073941 3:163953249-163953271 GCAAAGAGGAAACCCCCAGTGGG + Intergenic
965118566 3:164521781-164521803 GATCAGAGGAGACCCACAGTGGG + Intergenic
965118587 3:164521918-164521940 GCTGAGAGGAGACCCACAGTGGG + Intergenic
965367803 3:167820999-167821021 GCAGAGAGGAGACCCACAGTGGG - Intronic
965541478 3:169875636-169875658 GCTCAGAGGAGACCCACAGTGGG - Intergenic
965984608 3:174736398-174736420 GCTCAGAGAAGACCCACATTGGG + Intronic
967876696 3:194272486-194272508 ACCCCGAGCAGAGCCCCAGTAGG + Intergenic
967973327 3:195015333-195015355 GCTCATAGCAGACACCCCCTTGG + Intergenic
1202741857 3_GL000221v1_random:63226-63248 GCTCAGAGGAGACGTGCAGTGGG - Intergenic
968626211 4:1627783-1627805 GCTGAGTGGAGACCCCCAGGTGG - Intronic
969785204 4:9452283-9452305 GCCAGGAACAGACCCCCAGTTGG + Intergenic
969956562 4:10897169-10897191 GCACACAGAAGACTCCCAGTCGG + Intergenic
970959713 4:21857632-21857654 GCTCAGAGGAGACCCACAGTGGG - Intronic
971079782 4:23196003-23196025 GCTCAGAGGAGACCCACAGTGGG - Intergenic
971478131 4:27091079-27091101 GCCCACAGGAGACCACCAGTGGG - Intergenic
971714041 4:30153055-30153077 GCTCAGAGGAGACCTACAGTGGG + Intergenic
972072612 4:35039278-35039300 GCTCAGAGGAGACCTGCAGTTGG - Intergenic
972106487 4:35494612-35494634 GCAGAGAGGAGACCCACAGTGGG - Intergenic
972106513 4:35494761-35494783 GCTCAGAGGAGACCCACAGTGGG - Intergenic
972111059 4:35560192-35560214 GCTAAGCGCAGAGCCACAGTGGG + Intergenic
972128715 4:35802423-35802445 GCTCAGAGGAAACCCACAGGGGG - Intergenic
972613808 4:40679394-40679416 GCTCAGAGGACACCCCCACGAGG + Intergenic
972645879 4:40967179-40967201 GCTCAGAGGAGACCCACAGTAGG - Intronic
973362451 4:49177936-49177958 GCTCAGAGGAGAACTGCAGTGGG + Intergenic
973398649 4:49618925-49618947 GCTCAGAGGAGAACTGCAGTGGG - Intergenic
974235840 4:59180022-59180044 GCTGAGAGGAGACCCACAGTCGG - Intergenic
974278439 4:59758899-59758921 GCTCAGAGAAGACCTGCAGTGGG + Intergenic
974285091 4:59855539-59855561 GCTCAGAGGACACCTGCAGTGGG + Intergenic
974420175 4:61662858-61662880 GCAGAGAGGAGACCCACAGTGGG - Intronic
974420184 4:61662928-61662950 GCAGAGAGGAGACCCACAGTGGG - Intronic
974420192 4:61662998-61663020 GCTCAGAGGAGACTTACAGTGGG - Intronic
974894910 4:67927044-67927066 GCTCACAGGAGACCCACAGTGGG - Intronic
975044452 4:69783998-69784020 GCTCAGAGAAGACCCACAGTGGG - Intronic
975221151 4:71814233-71814255 GCTCAGAGGAGAACTGCAGTGGG + Intergenic
975254303 4:72215858-72215880 GCTCATAGGAGACCCACAATGGG + Intergenic
975321373 4:73012419-73012441 GCTCAGAGGAGACCTGCAGTGGG - Intergenic
976097780 4:81527814-81527836 GCTCAGAGGAGACCTGCAGTGGG + Intronic
976647392 4:87400201-87400223 GCTCAGAGGAGACCCACAGTGGG - Intergenic
976679876 4:87745147-87745169 GCTCAGAGGAGACCTGCAGTGGG + Intergenic
976815803 4:89147977-89147999 GCTCAGAGGAGACCTGCGGTGGG + Intergenic
976921443 4:90449200-90449222 GCTAAGAGGAGACCCACAGTGGG + Intronic
976922634 4:90457577-90457599 GCTGAGAGAAGACCCACAGTGGG + Intronic
977033958 4:91925239-91925261 GCTCAGAGCGGACCCACAGTGGG - Intergenic
977359143 4:95981462-95981484 GCTCAGAGGAAACCCACAGCAGG - Intergenic
977430600 4:96926996-96927018 GCTCAGATCTGACTTCCAGTGGG + Intergenic
977645879 4:99410786-99410808 GCTCAGAGGAGACTTGCAGTGGG + Intergenic
977816200 4:101416605-101416627 GCTCAGAGGAGACCCATGGTAGG + Intronic
978229851 4:106385509-106385531 GCTCAGAGAAGACCCACAGTGGG + Intergenic
978248524 4:106604043-106604065 ACTCAAAGGAGACCCGCAGTGGG + Intergenic
978248537 4:106604112-106604134 GCAGAGAGGAGACCCACAGTGGG + Intergenic
978249318 4:106610975-106610997 GCTCAGAGGAGACCCACAGCAGG - Intergenic
978498510 4:109384871-109384893 GCTCAGAGGAGACTCACAGTGGG - Intergenic
979462910 4:121003775-121003797 GCTCAGAGGAGACCCACAGGGGG - Intergenic
980180291 4:129393083-129393105 GCTCAGAGGAAACTCGCAGTGGG - Intergenic
980450269 4:132960118-132960140 GCTCAGAGGAGACCCAGAGTGGG - Intergenic
980671184 4:136008909-136008931 GCTCAGAGGAGACCCATATTGGG - Intergenic
980730909 4:136823647-136823669 GCTCAGAGAAGACCGGCATTGGG + Intergenic
980745000 4:137001360-137001382 GCTCAGAGGAGACCCGTAGTGGG - Intergenic
982611096 4:157575086-157575108 GCTCAGAGGAGACCTGCATTGGG - Intergenic
983000532 4:162408918-162408940 GCTCAGAGGAGACCCACAGTGGG + Intergenic
983125802 4:163949631-163949653 GCTCAGAGGAGACCCACAGTGGG + Intronic
983380076 4:166981143-166981165 GCCCAGAGGAGACCCATAGTGGG + Intronic
983491965 4:168399035-168399057 GCTCAGAGGAGACCTGCAGTGGG - Intronic
983651512 4:170040851-170040873 GCTCAGAGGAGAGCCACAGTGGG - Intergenic
983715496 4:170776708-170776730 GCTCAGAGGAGACCCACAGTGGG - Intergenic
984058316 4:174957571-174957593 GCAGAGAGCAGACCCAGAGTAGG - Intronic
984102079 4:175499116-175499138 GCTCAGAGGAGATCCACAGGGGG + Intergenic
984296700 4:177862390-177862412 GCTCAGAGGAGACCCACAGTTGG - Intronic
984325254 4:178242448-178242470 GCTCAGAGGAGACCTGTAGTGGG - Intergenic
1202759788 4_GL000008v2_random:99409-99431 GCTCAGAGGAGACCTGCAGTGGG + Intergenic
986490914 5:8289228-8289250 TCTCAGAGCAGCCCTGCAGTGGG - Intergenic
986503817 5:8429425-8429447 GCTTAGAGGAGACCCACAGTAGG + Intergenic
986923564 5:12717687-12717709 GCTCAGAGGAGACTCACAGTGGG - Intergenic
987951893 5:24686982-24687004 GCTCAGAGGAGAACCACAGTGGG + Intergenic
987951913 5:24687122-24687144 GCAGAGAGGAGACCCACAGTGGG + Intergenic
988093176 5:26568925-26568947 GCTCAGAGAAGACCTACAGGGGG + Intergenic
988565865 5:32319839-32319861 GCTCAGAGGAGATCCACAGTGGG + Intergenic
989339203 5:40354912-40354934 GCTCAGAGGAGACCTGCAGTAGG - Intergenic
989520716 5:42396943-42396965 GCTCAGAGGAGACCAACATTGGG - Intergenic
990023789 5:51160342-51160364 GCTTAGAGGAGACCAGCAGTGGG - Intergenic
992585565 5:78235715-78235737 AATCATAGCAGAGCCCCAGTAGG + Intronic
994593924 5:101807117-101807139 GCAGAGAGGAGACCCACAGTGGG - Intergenic
994692344 5:103034448-103034470 GCTGAGAGGAGACCCACAGTGGG + Intergenic
994692354 5:103034516-103034538 GCTGAGAGGAGACCCACAGTGGG + Intergenic
995473412 5:112525822-112525844 GCCAGGAGCAGACCCCCACTGGG + Intergenic
995744917 5:115393360-115393382 GCTCAGAGGAGACCCGCAGTGGG + Intergenic
996880123 5:128287658-128287680 ACTCAGAGCAAACAACCAGTAGG + Intronic
996923790 5:128799727-128799749 GCTCAGAGGAGACCCACAGTAGG + Intronic
997381330 5:133440427-133440449 GCTCAGTGCAGCCCCACATTAGG - Intronic
997960493 5:138316850-138316872 GCTCAGAGGAGACCCACAGGGGG - Intronic
998480515 5:142459114-142459136 GCTGAGAGGAGACCCACAGTGGG + Intergenic
998845446 5:146304573-146304595 ACTCAGAGCGGACCCCCAGCAGG - Intronic
999318677 5:150600313-150600335 GCCCAGAGCAGCACTCCAGTGGG + Intergenic
1000266317 5:159641374-159641396 GCTCAGAGGAGATCTGCAGTGGG - Intergenic
1000426265 5:161094144-161094166 GCTCAGAGGAGACATGCAGTAGG - Intergenic
1001544592 5:172563227-172563249 GCTCATAGCAGACCTGCAGAGGG - Intergenic
1002465036 5:179404007-179404029 GCCCAAAGCAGACCCACCGTGGG - Intergenic
1002986279 6:2192290-2192312 GCTCAGAGAAGACCCACAGTGGG - Intronic
1003439021 6:6122370-6122392 GCAGAGAGGAGACCCACAGTGGG - Intergenic
1004304560 6:14488115-14488137 GCTCAGAGGAAACCCGCACTGGG - Intergenic
1005021413 6:21422997-21423019 GCTCAGAGGAGACCGACAGTGGG + Intergenic
1006348022 6:33498639-33498661 GGTCAGAGGAGACCCACAGTGGG - Intergenic
1006500989 6:34458614-34458636 GCTCAGAAGAGACCCGCAGTGGG - Intergenic
1006742450 6:36319284-36319306 GCTCACAGCTGGCCTCCAGTGGG - Intronic
1006753817 6:36397054-36397076 GCTCAGAGGAGATCCGCAGTGGG - Intronic
1008330612 6:50240482-50240504 GCTCAGAGGAGACTCATAGTGGG + Intergenic
1009846855 6:69145680-69145702 GCTCAGAGGAGACCTTCAGTGGG + Intronic
1010341171 6:74754940-74754962 GCTCAGAGGAGACCAGCAGAGGG - Intergenic
1010519734 6:76818175-76818197 GCAGAGAGGAGACCCACAGTGGG - Intergenic
1010846909 6:80720433-80720455 GCAGAGAGGAGACCCACAGTGGG - Intergenic
1011795608 6:90948249-90948271 GCTCAGAAGAGACCCGCAGTGGG - Intergenic
1012052214 6:94360958-94360980 GCCCAGAGAAGACCCGCAGTGGG + Intergenic
1012122415 6:95384696-95384718 GCTCAGAGGAGACCCACATTGGG - Intergenic
1012169519 6:96001788-96001810 GCTCAGAGGAGACCCACAGAGGG + Intergenic
1012752814 6:103184509-103184531 GCTCAGAGGAGACCCACAGTGGG - Intergenic
1013101629 6:106992074-106992096 GCTCAGAGCAGAGACACAGATGG + Intergenic
1013235997 6:108198426-108198448 GCTCAGAGGAGACCCACAGTGGG + Intergenic
1013375598 6:109510642-109510664 GCTCAGAGGAGACCCACAGTGGG - Intronic
1013693170 6:112668572-112668594 GCACAGAGGAGGCCCACAGTGGG - Intergenic
1013709381 6:112879798-112879820 GCTCAGAGGAGACCCGCAGGGGG + Intergenic
1014391716 6:120872708-120872730 GCTGAGAGGAGATCCACAGTGGG - Intergenic
1014391727 6:120872778-120872800 GCTAAGAAGAGACCCACAGTGGG - Intergenic
1015455599 6:133423968-133423990 GCTCAGAGGAGACCCACAGTGGG + Intronic
1015663787 6:135604221-135604243 GCTCAGAGGAAACCCTCAGAGGG - Intergenic
1016339633 6:143049273-143049295 GCTCGGAGGAAACCCACAGTGGG + Intergenic
1017420446 6:154267633-154267655 GCTCAGAGAAGACCCATAGTGGG + Intronic
1017522309 6:155213274-155213296 GCTCAGAGGAAACCCACAGTGGG + Intronic
1018419977 6:163632502-163632524 GCTCAGTGTAGCCTCCCAGTGGG + Intergenic
1018515830 6:164579238-164579260 GCACAGAGCAGAACCCAAGCAGG + Intergenic
1019296030 7:275899-275921 GCTCAGCGGAGACCCTCTGTGGG + Intergenic
1019360681 7:602761-602783 GCCAAGAGCAGAACCCCAGGAGG + Intronic
1019897868 7:3997312-3997334 GCCCAGAGGAGCCCCGCAGTGGG + Intronic
1020241658 7:6399844-6399866 GATCAGACCAGACCCTCAGGAGG - Intronic
1020586829 7:10079345-10079367 GCTCAGAGGAGACCTGCAGATGG - Intergenic
1020649311 7:10855329-10855351 GCTCAGAGGAGACCCGCAGTGGG - Intergenic
1020761297 7:12270304-12270326 GCTCAGAGGAGACCTGCAGTGGG - Intergenic
1020832522 7:13109926-13109948 GCAGAGAGGAGACCCACAGTGGG + Intergenic
1021500727 7:21329730-21329752 GCTCAAAATAGACCCTCAGTGGG + Intergenic
1023296252 7:38717798-38717820 GCTCAGAGCAGAGCTCCAGGGGG + Intergenic
1023699983 7:42883223-42883245 GCTCAGAGGAGACCTGCAATGGG + Intergenic
1023727231 7:43156286-43156308 GGACAGAGCAGGCCCCCAGTAGG + Intronic
1023826988 7:44016309-44016331 GCCCAGAGCAAGCCCCCAGAAGG + Intergenic
1024054900 7:45653689-45653711 ACACAGAGCAAAGCCCCAGTGGG - Intronic
1027008647 7:74722206-74722228 GCTCAGAGCGCACCGGCAGTGGG - Intronic
1027333667 7:77126463-77126485 GCTCAGAGGAGACCCACAGTGGG + Intronic
1027575232 7:79922640-79922662 GCTCAGAAGAAACCCACAGTGGG - Intergenic
1028527358 7:91801037-91801059 GCTCAGAGGAGACCCACAGAGGG + Intronic
1029738140 7:102476056-102476078 GCCCAGAGCAAGCCCCCAGAAGG + Intronic
1029755273 7:102569710-102569732 GCCCAGAGCAAGCCCCCAGAAGG + Intronic
1029773221 7:102668790-102668812 GCCCAGAGCAAGCCCCCAGAAGG + Intronic
1029782126 7:102744869-102744891 GCTCAGAGGAGACCCACAGTGGG - Intergenic
1029941837 7:104488995-104489017 GCTCAGAAGGGACCCCCACTTGG + Intronic
1030484456 7:110148777-110148799 GCAGAGAGGAGACCCACAGTGGG + Intergenic
1030746594 7:113173270-113173292 CCTCAGCTCAGAGCCCCAGTGGG - Intergenic
1031196981 7:118627668-118627690 GCTGAGTGCAGACCCACAGTGGG + Intergenic
1031242024 7:119257964-119257986 GCTCAGAGGAGACCTGCAGGTGG + Intergenic
1031265339 7:119573169-119573191 GCTCAGAGAAGACCTGCAGTGGG - Intergenic
1031743672 7:125467851-125467873 GCTCAGAGGAGACCAGCACTGGG + Intergenic
1031836996 7:126690752-126690774 ACTCAGAGGAGACCTGCAGTGGG + Intronic
1032304210 7:130717368-130717390 GCTGAGAGCACAACCACAGTGGG + Intergenic
1032658283 7:133955254-133955276 GCTCAGTGGAGACCTGCAGTGGG + Intronic
1032858566 7:135857735-135857757 GCTCAGAGGAGACCCACAGTGGG + Intergenic
1032919230 7:136527214-136527236 GCTCACAGGAGACCCAGAGTGGG + Intergenic
1034210359 7:149357873-149357895 GCTCAGAGGAAACCCACAGTCGG + Intergenic
1034728512 7:153363073-153363095 GCTCAGAGCAGACACTGAGAAGG + Intergenic
1036558670 8:9883498-9883520 GCTCAGAGGAAACCCCCACAAGG + Intergenic
1037553928 8:20004143-20004165 GCTCAGAGGAGACCCACAGTGGG + Intergenic
1039182264 8:34880167-34880189 GCTCAGAGGAGGCCCGCAGTGGG + Intergenic
1040661900 8:49583626-49583648 GCTCAGAGAAGACCTTCAGTGGG - Intergenic
1041205457 8:55494558-55494580 GCTCAGAGGAGACCCAAAGTGGG + Intronic
1041965433 8:63669973-63669995 GCTCAGAGGAGACCCACAGTGGG + Intergenic
1042335359 8:67624556-67624578 GCTCAGAGCAGATACCAAGAAGG + Intronic
1042336996 8:67639863-67639885 GCTCAGAGGAGACCTATAGTGGG + Intronic
1042439644 8:68810765-68810787 CCTGAGAGGAGACCCACAGTGGG + Intronic
1044008637 8:86965802-86965824 GCTCAGAGGAGACCTGCAGCAGG + Intronic
1044409614 8:91868640-91868662 GCTCAGAGGAGACCCACAGGAGG - Intergenic
1044412627 8:91901646-91901668 GCTCAGAGGAGACCCAGAGTGGG + Intergenic
1044774903 8:95677909-95677931 GCTCAGAGGAGACTCACAGTGGG + Intergenic
1044962389 8:97543236-97543258 GCTCAGAGGAGACCTGCAATGGG - Intergenic
1046140465 8:110083780-110083802 ACTCAGAGGAGACCCCCAGTGGG - Intergenic
1046186994 8:110734533-110734555 GCTCTAAGGAGACCCACAGTGGG + Intergenic
1046195755 8:110860842-110860864 GCAGAGAGGAGACCCACAGTGGG - Intergenic
1046395215 8:113632379-113632401 GCTCAGAGGAGACCCACAGTGGG + Intergenic
1046407289 8:113790889-113790911 GCTCTGAGGAGACCCACAGTTGG + Intergenic
1046503703 8:115111223-115111245 GCTCAGAAGAGACCTGCAGTGGG + Intergenic
1046674616 8:117094360-117094382 GCTCAGAGGAGACCCGCAGTGGG + Intronic
1046688784 8:117258770-117258792 ACTGAGAAAAGACCCCCAGTGGG + Intergenic
1049046876 8:140159354-140159376 GCACAGAGCAGGCCCTCAGGAGG + Intronic
1049685994 8:143939581-143939603 GCTCAGCTCAGAGCCCCAGTCGG + Intronic
1049814561 8:144592275-144592297 GCTCAGTGCTGTCCCCCAGGAGG - Intronic
1049814576 8:144592324-144592346 GCTCAGTGCTGTCCCCCAGGAGG - Intronic
1049814591 8:144592373-144592395 GCTCAGTGCTGTCCCCCAGGAGG - Intronic
1049814607 8:144592422-144592444 GCTCAGTGCTGTCCCCCAGGAGG - Intronic
1049814622 8:144592471-144592493 GCTCAGTGCTGTCCCCCAGGAGG - Intronic
1049814636 8:144592519-144592541 GCTCAGTGCTGTCCCCCAGGAGG - Intronic
1049814650 8:144592567-144592589 GCTCAGTGCTGTCCCCCAGGAGG - Intronic
1049814665 8:144592616-144592638 GCTCAGTGCTGTCCCCCAGGAGG - Intronic
1049824069 8:144655640-144655662 GCTCAGAGGAGACCTGCAGTGGG - Intergenic
1050182379 9:2934690-2934712 GCTCAGAGGAGACCCACAGTGGG - Intergenic
1050725547 9:8644325-8644347 GCTCAGAGGAGACCCATAGTGGG - Intronic
1050937264 9:11413963-11413985 GCTCAGAGGAGATCCACAGTGGG - Intergenic
1050942009 9:11471894-11471916 GCTGAGAGGAGACCACCAGGGGG - Intergenic
1051001790 9:12290943-12290965 GCTTAGGGGAGACCCACAGTGGG - Intergenic
1051406782 9:16746164-16746186 GCTCAAAGCAGTCACCCAGGAGG + Intronic
1051749471 9:20326210-20326232 GCTCAGAGCATACCCACAGAAGG - Intergenic
1052201606 9:25788582-25788604 GTTGAGAGCACAGCCCCAGTGGG - Intergenic
1052466779 9:28839558-28839580 GCTGAGAGGAGACCCACAATGGG + Intergenic
1052652344 9:31321113-31321135 GCTCAGAGGAGACCCACACTGGG + Intergenic
1053445092 9:38146515-38146537 GCAGAGAGAAGACCCACAGTGGG - Intergenic
1053445101 9:38146582-38146604 GCTCAGAGGAGACCCGCAGTGGG - Intergenic
1053617437 9:39782095-39782117 GCTCAGAGAAGACCCACAGTGGG - Intergenic
1053619129 9:39798413-39798435 GCTCAGAGGAGACCCGCAGTGGG + Intergenic
1053875619 9:42541458-42541480 GCTCAGAGAAGACCCACAGTGGG - Intergenic
1053877284 9:42557762-42557784 GCTCAGAGGAGACCCGCAGTGGG + Intergenic
1053895381 9:42736926-42736948 GCTCAGAGGAGACCCACAGTGGG - Intergenic
1053897029 9:42753175-42753197 GCTCAGAGAAGACGCACAGTGGG + Intergenic
1054234409 9:62543960-62543982 GCTCAGAGGAGACCCGCAGTGGG - Intergenic
1054236080 9:62560266-62560288 GCTCAGAGAAGACCCACAGTGGG + Intergenic
1054265028 9:62909016-62909038 GCTCAGAGGAGACCCGCAGTGGG - Intergenic
1054266729 9:62925342-62925364 GCTCAGAGAAGACCCACAGTGGG + Intergenic
1054550222 9:66594796-66594818 GCTCAGAGAAGACCCACAGTGGG + Intergenic
1054786094 9:69211597-69211619 GGCCAGTGCAGAGCCCCAGTAGG + Intronic
1055230477 9:74058127-74058149 ACTCAGAGTAGACCCAGAGTGGG - Intergenic
1055645495 9:78357981-78358003 GCTCAGAGGAGACCTGCAGTGGG - Intergenic
1055890865 9:81122409-81122431 GCTCAGAGGTGACCTGCAGTGGG + Intergenic
1055890876 9:81122479-81122501 GCAGAGAGAAGACCCACAGTGGG + Intergenic
1056191983 9:84194086-84194108 GCTCAGAGGAGACCCACAATGGG + Intergenic
1056986174 9:91365017-91365039 GCTCGGAGGAGACCCGCAGTGGG - Intergenic
1058077718 9:100667637-100667659 GCAGAGAGAAGACCCACAGTGGG - Intergenic
1058510850 9:105714264-105714286 GCTCAGAGAAGACCCACAGTGGG - Intronic
1059389338 9:113988968-113988990 GCTCAGAGCAGTACCCCATCAGG + Intronic
1060618842 9:125044524-125044546 GCTCTCAGGAGACCCCTAGTAGG - Intronic
1061265451 9:129502184-129502206 TCTCAGAGCAGTCTCCCAATAGG - Intergenic
1062184778 9:135212140-135212162 GCTCAGAGGAGACCCACAGTGGG - Intergenic
1062329156 9:136029276-136029298 GCTGAGAGGAGACCCACAGTGGG - Intronic
1062700606 9:137899874-137899896 GCTCAGCGCAGACCCTCTGAGGG + Intronic
1203691579 Un_GL000214v1:47624-47646 GCTCAGAGGAGACCTGCAGTCGG + Intergenic
1203751813 Un_GL000218v1:87181-87203 GCTCAGAGGAGACCTGCAGTGGG - Intergenic
1203710487 Un_KI270742v1:93150-93172 GCTCAGAGGAGACGTGCAGTGGG - Intergenic
1203540564 Un_KI270743v1:84304-84326 GCTCAGAGGAGACCTGCAGTGGG + Intergenic
1203612277 Un_KI270749v1:20863-20885 GCTCAGAGGAGACCCATAGTGGG + Intergenic
1203644716 Un_KI270751v1:56567-56589 GCTCAGAGGAGACCTGCAGTCGG - Intergenic
1186071013 X:5820721-5820743 ACTGAGAGCACACCCCCAGCAGG - Intergenic
1186456168 X:9711849-9711871 GCTCAGAGCAGTGCCCCGGAGGG + Intronic
1188756569 X:33969796-33969818 GCTCAGAGGAGACGCTCAGTGGG - Intergenic
1189023929 X:37371314-37371336 GCTCAGAGGAGACCCACATTGGG - Intronic
1190369550 X:49727601-49727623 GCTCAGAGAAGACCCATAGTGGG - Intergenic
1190681793 X:52832003-52832025 GCTCAGAGGAGATCCGCAGTGGG - Intergenic
1191016396 X:55813995-55814017 GCTCAGAGGAGACCCAAAGTGGG - Intergenic
1192265286 X:69533488-69533510 GCTCAGAGGGGACCCACAGTGGG + Intergenic
1192799671 X:74453769-74453791 ACTTAGTGCAGACACCCAGTCGG + Intronic
1193467598 X:81867819-81867841 ACTCAGAGAAGACCCAAAGTGGG + Intergenic
1193468690 X:81875016-81875038 GCTCAGAGAAGACCTGCAGTGGG + Intergenic
1193554213 X:82933028-82933050 GCTCAAAAGAGACCCGCAGTGGG - Intergenic
1194379411 X:93175564-93175586 GCTCAGAGGAGACCTGCAGTGGG - Intergenic
1194380354 X:93182272-93182294 GCTCAGAGGAGACCCTCAGTGGG - Intergenic
1194891456 X:99384481-99384503 GCTCTCAGGAGACCCACAGTGGG + Intergenic
1195655079 X:107325226-107325248 GCTCAGAGAAGACCTGCAGGGGG - Intergenic
1197035703 X:121870763-121870785 GCTGAGAGGAGACCCACAGTGGG - Intergenic
1197342268 X:125288049-125288071 GCTCAGAGCTGACCTGCAATAGG - Intergenic
1197378458 X:125710216-125710238 GCTCAGAGGAGACCTGCAGTGGG - Intergenic
1197421324 X:126238828-126238850 GCTCAGAGGAGACCTGCAGTGGG - Intergenic
1197609496 X:128622922-128622944 GCTCAGAGGAGGCCCACATTGGG + Intergenic
1197795937 X:130299064-130299086 ACTCAGAGGAGACCCGCAGTGGG + Intergenic
1199187946 X:144939064-144939086 GCTCAGAGGAGACCTACAGTGGG + Intergenic
1199861072 X:151800989-151801011 GCTCAGAGGAGACCCGCAGGGGG + Intergenic
1199991165 X:152988446-152988468 GGTCAGAGAAGAGCCCCAGGAGG - Intergenic
1200943012 Y:8804936-8804958 GCCAGGAACAGACCCCCAGTGGG + Intergenic
1201165467 Y:11204801-11204823 GCTCAGAGGAGACCTGCAGTGGG - Intergenic
1202018145 Y:20434213-20434235 GCTCAGAGAAGACCTGCAGTTGG + Intergenic
1202349693 Y:23974691-23974713 GCTCAGAGCAGACATTCAGCAGG - Intergenic
1202521086 Y:25695429-25695451 GCTCAGAGCAGACATTCAGCAGG + Intergenic