ID: 1184515575

View in Genome Browser
Species Human (GRCh38)
Location 22:44959988-44960010
Sequence ACAGCGGAGGGCCCGCTCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 101}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184515575_1184515579 -7 Left 1184515575 22:44959988-44960010 CCAGAGAGCGGGCCCTCCGCTGT 0: 1
1: 0
2: 0
3: 5
4: 101
Right 1184515579 22:44960004-44960026 CCGCTGTGTGACCTCAGCACCGG 0: 1
1: 0
2: 0
3: 26
4: 256
1184515575_1184515582 26 Left 1184515575 22:44959988-44960010 CCAGAGAGCGGGCCCTCCGCTGT 0: 1
1: 0
2: 0
3: 5
4: 101
Right 1184515582 22:44960037-44960059 AGTCCTGCAACCCTCTCTAATGG 0: 1
1: 0
2: 0
3: 9
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184515575 Original CRISPR ACAGCGGAGGGCCCGCTCTC TGG (reversed) Intronic
902561114 1:17278013-17278035 ACAGCGGAGGCCTAGCTCCCAGG - Intronic
906817494 1:48893792-48893814 TCTGCTGAGGGCCCTCTCTCAGG - Intronic
907438630 1:54464971-54464993 ACAGGGGAGGGCCCGCCCCAGGG + Intergenic
915163212 1:153933769-153933791 ACAGGGGAGGAGCCGCTCCCTGG - Exonic
920347251 1:205314242-205314264 AGAGGGGAGGCCCTGCTCTCGGG + Intronic
1062946653 10:1466606-1466628 AGAGAGGAGGGGCCCCTCTCAGG + Intronic
1067768702 10:49108478-49108500 GCAGGGTAGGGCCCTCTCTCTGG + Intronic
1068338347 10:55667540-55667562 GCATCGGAGGGCCCGCTCAAGGG - Intergenic
1070877434 10:79826585-79826607 ACAGCAGTGGGCCGGCCCTCCGG - Intergenic
1071643926 10:87342626-87342648 ACAGCAGTGGGCCGGCCCTCCGG - Intergenic
1076804910 10:132850498-132850520 ACAGCAGAGGGCGGGCTCACTGG - Intronic
1077409468 11:2396726-2396748 GGGGCGGAGGGCCTGCTCTCTGG + Intronic
1082954171 11:58851038-58851060 ACAGGGAAGGGCCCCCTGTCTGG + Intronic
1083710157 11:64543003-64543025 ACAGCGGAGGCCCCGGGCCCGGG + Intergenic
1084271338 11:68030880-68030902 GCAGCGGGGAGCCGGCTCTCAGG + Intronic
1090375137 11:126283069-126283091 AGCGCGCAGGCCCCGCTCTCCGG - Intronic
1090384392 11:126348157-126348179 ACAGCAGAGGGCAGGCACTCAGG + Intergenic
1091398720 12:170267-170289 ACAGCTGAGGGCTGGCTCTGGGG - Intronic
1092259589 12:6945918-6945940 ACAAGGGAGGGCCAACTCTCAGG - Exonic
1099989805 12:89709482-89709504 CCAGCCGAGGGCGCGCTCGCCGG - Intergenic
1100330055 12:93573159-93573181 ACCGCGGAGAGCACGCTCGCAGG + Intronic
1101878051 12:108608373-108608395 ACAGCGCAGAGCCCCATCTCTGG + Intergenic
1101967871 12:109293294-109293316 CCAGCGGAGGTGCTGCTCTCGGG - Intronic
1102871253 12:116416017-116416039 ACAGCGGAGGGCACGCCCCGGGG - Intergenic
1105004280 12:132711196-132711218 CCAGCGGAGGAGCCGCTTTCCGG + Intronic
1105853645 13:24357956-24357978 ACTGCTGGGGGGCCGCTCTCTGG + Intergenic
1106098130 13:26668465-26668487 ACAGCCCCGGGCCAGCTCTCTGG + Intronic
1113905961 13:113819303-113819325 ACAGGGGAGGCCCCGCTGGCTGG - Intergenic
1117007912 14:51441164-51441186 AGAGAGGAGGTCCCGCCCTCTGG - Intergenic
1121061485 14:90914198-90914220 ACAACAGAGGGCCAGGTCTCCGG + Intronic
1122804505 14:104249798-104249820 ACAGCAGAGGTCCTGCTCTTGGG + Intergenic
1124399475 15:29335739-29335761 ACAATGGAGAGCCAGCTCTCAGG - Intronic
1125535821 15:40440930-40440952 GCGGCGGAGGCTCCGCTCTCGGG + Intronic
1126061192 15:44784446-44784468 ACAGGGAAGGGCCCCCTGTCCGG - Intergenic
1132154715 15:99487211-99487233 ACAGAGGAGGGCGCTCACTCAGG + Intergenic
1135636061 16:24076720-24076742 ACAGCATAGGGCTTGCTCTCAGG + Intronic
1136366156 16:29810157-29810179 ACAGCTGTGGGCTCCCTCTCGGG + Exonic
1139853736 16:69965316-69965338 AGACGGGAGGGCCCGCTCTCCGG + Intergenic
1139882714 16:70188229-70188251 AGACGGGAGGGCCCGCTCTCCGG + Intergenic
1140369796 16:74407290-74407312 AGACGGGAGGGCCCGCTCTCCGG - Intergenic
1141063279 16:80894694-80894716 ACAGCAGCAGGCCCGCTGTCGGG + Intergenic
1142591898 17:1009912-1009934 ACAGGGGAGGGCCTGGTGTCTGG + Intronic
1145120815 17:20257980-20258002 ACAGCAGAGTCCCGGCTCTCAGG - Intronic
1147115600 17:38297062-38297084 TCGGCGGAGGGCGCGCTCCCTGG + Exonic
1147951752 17:44111398-44111420 ACAGGGGAGGGCCTGCACTCAGG + Intronic
1148414081 17:47492559-47492581 TCGGCGGAGGGCGCGCTCCCTGG - Intergenic
1149344121 17:55717080-55717102 TCTGCGGAAGGCCCACTCTCTGG - Intergenic
1150858356 17:68774838-68774860 ACAGGGAAGGGCCCCCTGTCCGG + Intergenic
1152804145 17:82347161-82347183 ACAGCAGAACGCCCTCTCTCTGG + Intergenic
1153906115 18:9662740-9662762 AAAGAAGAGGGCCAGCTCTCTGG + Intergenic
1161562799 19:4983185-4983207 ACCACGTAGGGCCAGCTCTCAGG - Intronic
1162236347 19:9312653-9312675 ACAGGGAAGGGCCCCCTGTCTGG + Intergenic
1163075633 19:14888637-14888659 ACAGGGAAGGGCCCTCTGTCCGG - Intergenic
1165808661 19:38597119-38597141 ACAGCGGAGGGTGCGAGCTCTGG - Exonic
1167497405 19:49827741-49827763 ACAGAGGAGGCCCCCGTCTCTGG + Intronic
925335725 2:3097996-3098018 ACAGAGCAGGGCAAGCTCTCAGG - Intergenic
926886463 2:17603290-17603312 TCTGCTGAGGGCCCCCTCTCTGG + Intronic
930011345 2:46940800-46940822 ACAGCGGCAGGCCAGCTCCCGGG + Intronic
935123366 2:100201245-100201267 TGAGCAGAGGGGCCGCTCTCAGG + Intergenic
937315610 2:120930445-120930467 GCAGCGGAGGGCCTGAGCTCAGG - Intronic
938018441 2:127886197-127886219 ACAGCAGTGGGCCGGCCCTCCGG - Intergenic
946397049 2:219448445-219448467 CCTGCGCAAGGCCCGCTCTCTGG + Exonic
948660554 2:239503821-239503843 AGAGTGGAGGGCCAGCTGTCTGG - Intergenic
1174956751 20:55106190-55106212 ACAGTGGATGGGCTGCTCTCAGG + Intergenic
1178922612 21:36748236-36748258 ACCGCGGAGGCCCCGCGCGCCGG + Exonic
1179435838 21:41361521-41361543 ACAGCCGAGGACATGCTCTCAGG - Intergenic
1181025811 22:20126835-20126857 ACAGCGGCTTGCCCGCCCTCGGG - Intronic
1182430986 22:30298825-30298847 ACAACAGAGGGCACCCTCTCTGG + Intronic
1183586971 22:38758475-38758497 AGAGGGGAGGCCCTGCTCTCTGG - Intronic
1184133696 22:42533485-42533507 ACAGGGAAGGGCCCCCTGTCTGG + Intergenic
1184515575 22:44959988-44960010 ACAGCGGAGGGCCCGCTCTCTGG - Intronic
953743190 3:45554404-45554426 ACAGCTGAGGGCCTGCTTTGGGG + Intergenic
962299794 3:134229189-134229211 AGAGCGGAGCGCTCCCTCTCTGG + Intronic
962383230 3:134913319-134913341 TCAGCGCTGGGCCTGCTCTCAGG - Intronic
962677399 3:137767144-137767166 ACATCGGAGGGTCCTTTCTCAGG - Intergenic
963219788 3:142796500-142796522 CCAGGGTAGGGCCCTCTCTCAGG + Intronic
968108589 3:196022660-196022682 ACAGGGAAGGGCCCCCTGTCTGG + Intergenic
968550925 4:1223064-1223086 ACAGCGGAGGCACCGCCCCCTGG + Intronic
968680229 4:1913626-1913648 ACAGGGAAGGGCCCCCTGTCTGG + Intronic
976628051 4:87207877-87207899 ACATCGGAGGGCCCCCTCAAGGG + Intronic
981531827 4:145761346-145761368 ACAGTGGAAGGGCCGCTCCCCGG + Exonic
984359052 4:178704411-178704433 ACAGAGCAAGGCCCACTCTCAGG + Intergenic
994359952 5:98839536-98839558 ACAGCGCGGGGGCCGCTGTCGGG - Intergenic
1002491006 5:179577510-179577532 CTAGCGGAGGGCCGGGTCTCCGG + Intronic
1005922180 6:30411973-30411995 ACAGGGAAGGGCCCCCTGTCTGG + Intergenic
1018717813 6:166547433-166547455 GCAGCTGAGTGCCCGCTCTCCGG + Intronic
1019651898 7:2164303-2164325 ACAGCAGAAAGCCCGCACTCTGG + Intronic
1024059958 7:45690255-45690277 AGAGCGGAGGGCACACTCTAAGG + Intronic
1025263962 7:57440479-57440501 ACAGCTCAGGGTCAGCTCTCTGG - Intergenic
1025635271 7:63315629-63315651 ACAGCTCAGGGCCAGCTTTCTGG + Intergenic
1025647424 7:63432541-63432563 ACAGCTCAGGGCCAGCTTTCTGG - Intergenic
1026667837 7:72359074-72359096 ACAGCGGAGGGCCTGGCCTTTGG - Intronic
1026907458 7:74070733-74070755 TCAGCACGGGGCCCGCTCTCAGG - Intergenic
1027559109 7:79704966-79704988 ACAGAGGAGTGCACACTCTCTGG - Intergenic
1034552928 7:151832683-151832705 ACTCCTGAGGGGCCGCTCTCGGG + Intronic
1049213029 8:141395489-141395511 AAACCTGAGGGCCCACTCTCAGG - Intronic
1049735779 8:144203533-144203555 GGAGAGGAGCGCCCGCTCTCTGG + Intronic
1056443846 9:86645579-86645601 ACCGCGGAGGGCCCTGGCTCTGG + Intergenic
1060142439 9:121221794-121221816 AGAGCTGAGGCCCAGCTCTCAGG + Intronic
1060355611 9:122904920-122904942 CCTGCGGAGGCCCCTCTCTCTGG - Intronic
1061682949 9:132252345-132252367 ACAGGGAAGGGCCCCCTATCCGG - Intergenic
1061971740 9:134048897-134048919 TCCGCGGAGCCCCCGCTCTCAGG - Intronic
1186267533 X:7848502-7848524 ACAGCGGAAGGCCTTCCCTCTGG - Intergenic
1186376688 X:9010892-9010914 ACAGCGGAAGGCCTTCCCTCTGG - Intergenic
1195270939 X:103230158-103230180 ACATCGTATGGCCCTCTCTCTGG + Intergenic
1198272364 X:135066743-135066765 ACAGGGAAGGGCCCCCTGTCTGG + Intergenic
1201438190 Y:13981477-13981499 ACAGCGGAAGGCCTTCCCTCTGG + Intergenic