ID: 1184517277

View in Genome Browser
Species Human (GRCh38)
Location 22:44970464-44970486
Sequence CTGTAGCAGCAGACCTAGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 253
Summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 239}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184517277_1184517281 -2 Left 1184517277 22:44970464-44970486 CCCCTCTAGGTCTGCTGCTACAG 0: 1
1: 0
2: 1
3: 12
4: 239
Right 1184517281 22:44970485-44970507 AGAGCCACCAGTGGCTCCCCAGG 0: 1
1: 0
2: 1
3: 32
4: 223
1184517277_1184517282 -1 Left 1184517277 22:44970464-44970486 CCCCTCTAGGTCTGCTGCTACAG 0: 1
1: 0
2: 1
3: 12
4: 239
Right 1184517282 22:44970486-44970508 GAGCCACCAGTGGCTCCCCAGGG 0: 1
1: 0
2: 1
3: 36
4: 260
1184517277_1184517289 25 Left 1184517277 22:44970464-44970486 CCCCTCTAGGTCTGCTGCTACAG 0: 1
1: 0
2: 1
3: 12
4: 239
Right 1184517289 22:44970512-44970534 CCCCTTAACCACCTCAGCAGTGG 0: 1
1: 0
2: 0
3: 13
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184517277 Original CRISPR CTGTAGCAGCAGACCTAGAG GGG (reversed) Intronic
900414381 1:2528359-2528381 CTGTAGCAACAGATCTACTGCGG + Intergenic
901439753 1:9270670-9270692 CTGTTGCAGGAGAACTAGACGGG + Exonic
902286071 1:15409660-15409682 CTGTAGCAGCTGAGCGGGAGGGG - Intergenic
902828192 1:18991893-18991915 ATGGAGCCCCAGACCTAGAGGGG + Intergenic
904259274 1:29279176-29279198 CTGTAGCAGCAGAGAGAAAGAGG - Intronic
904563622 1:31414191-31414213 CTGTAGCTGCAGCCGCAGAGGGG + Intronic
905249035 1:36636306-36636328 CTGTGCCAGCAGGCCTAAAGGGG - Intergenic
905987734 1:42302415-42302437 CTGGAGCAGGAGACCAAGACAGG + Intronic
905994694 1:42371404-42371426 CTCTAGTAGCAGAACCAGAGAGG + Intergenic
906241289 1:44243693-44243715 CTGTAGCAGCAGAGAGGGAGTGG + Intronic
906344270 1:45005488-45005510 CTGAGGCAGGAGCCCTAGAGGGG + Intronic
906638644 1:47427510-47427532 CTGTTCCAGCAGACCTTGAGGGG + Intergenic
911091311 1:94019496-94019518 CTGAAGGACCAGACCAAGAGGGG - Intronic
912190837 1:107338433-107338455 TTGCAGCAGCAGACCTAGCTGGG - Intronic
914922885 1:151859513-151859535 CTGGGGCAGCAGATCTAGACAGG - Intergenic
916202526 1:162285532-162285554 TTGTGGCTGCTGACCTAGAGAGG + Intronic
918066766 1:181106600-181106622 CTTTGGCACCAGCCCTAGAGAGG + Intergenic
918722816 1:187875592-187875614 CTGGAGCAGGAGAAATAGAGGGG + Intergenic
921822281 1:219630929-219630951 CTGTGGCAGCAGGCATACAGAGG + Intergenic
923342493 1:233019674-233019696 CAGTAGCAGCAGCCCAGGAGAGG + Intronic
923640999 1:235760617-235760639 CTGTATCAGTAGATCTAGGGTGG - Intronic
923685239 1:236148922-236148944 GTGAAGCAGCAGCCTTAGAGAGG - Intronic
1063470692 10:6282508-6282530 CCGTAGCAGCAGATGTAGTGAGG + Intergenic
1068218347 10:54011190-54011212 CTGCAGCAGCAGTGGTAGAGGGG - Intronic
1069286262 10:66719650-66719672 CTGCAGCAGCATGCCTACAGTGG + Intronic
1069412482 10:68167917-68167939 CTGCAGGAGAAGAACTAGAGAGG + Intronic
1072750249 10:97973698-97973720 CTGCAGCAGCAGGCCAAAAGGGG - Intronic
1079377565 11:19907253-19907275 CTGAAGCAACAGACCAGGAGTGG - Intronic
1085154786 11:74283474-74283496 CTGTAACAGCAGACATGGATTGG - Intronic
1085205723 11:74730987-74731009 CTCTAGCAGCAGACCTCCTGGGG - Exonic
1086730578 11:90243796-90243818 CTGTAGCAACAGTCCTTGAAGGG + Intergenic
1090912324 11:131132120-131132142 GTGTGGGAGCAGACCTAGAAAGG - Intergenic
1091028825 11:132165245-132165267 CTGTATCAGCAGTCTTGGAGTGG + Intronic
1091526458 12:1306224-1306246 CTCTAGGAGCAGACTTACAGAGG + Intronic
1093498086 12:19780058-19780080 CTGTAGCTGCAGAGGCAGAGGGG + Intergenic
1093520195 12:20041160-20041182 CCATAGCACCAGCCCTAGAGAGG - Intergenic
1094134391 12:27108658-27108680 CTGATTCAGCAGACCTAGGGTGG + Intergenic
1094219027 12:27973913-27973935 CTGAAGCAGGAGGCCCAGAGAGG + Intergenic
1095262314 12:40110667-40110689 CTGTAGTGGCAGATCTAGACAGG - Intergenic
1096076901 12:48811568-48811590 GTGCATCAGCAGACCCAGAGGGG + Intergenic
1103980795 12:124735918-124735940 CTGCTGCAGCAGACCTAGGGTGG - Intergenic
1104024748 12:125017658-125017680 CTGTGCCAGCAGATCTAGAATGG - Intronic
1104866873 12:131961102-131961124 CTGCAGCAGCAGCCCTACAGGGG + Exonic
1104885423 12:132104470-132104492 CTGCAGCAGCAGCCCTACAGGGG + Exonic
1104888576 12:132127167-132127189 GTGCAGCAGCAGGCCTGGAGCGG - Intronic
1105268308 13:18843804-18843826 CTGTAGCAGCAGAAATACTGTGG + Intergenic
1110308655 13:74021006-74021028 GTGTAGTAGCAGACGTCGAGGGG - Intronic
1111735590 13:92135050-92135072 CTGCAGCAGGAGAACCAGAGAGG - Intronic
1119599017 14:75962175-75962197 CTGTAGCAGCAGGGTTAGGGTGG - Intronic
1122240326 14:100360775-100360797 CTTTAGCAGAAGGCCTAAAGAGG - Intronic
1202831004 14_GL000009v2_random:30190-30212 CTGTAGCAGCAGAAATACTGTGG - Intergenic
1123675190 15:22703730-22703752 CTGTAGCAGGAGACCCAGAGAGG - Intergenic
1124715661 15:32058733-32058755 CTGTGGGGGCAGAACTAGAGTGG + Intronic
1124769470 15:32519076-32519098 CTGCAGCAGGAGAACGAGAGAGG + Intergenic
1125053668 15:35331993-35332015 CTGTAGCTGCAGCCATAGATAGG + Intronic
1125351243 15:38769630-38769652 CTGTCTCACCAGACCTAGGGTGG - Intergenic
1125795329 15:42400317-42400339 CAGTAGCAGCAGAGATGGAGGGG + Intronic
1128793331 15:70448729-70448751 CTGTGGCATCAGAGCTAGCGTGG - Intergenic
1129845821 15:78767321-78767343 CTGTAGCTGAAGACCAAGGGTGG + Intronic
1130256041 15:82326539-82326561 CTGTAGCTGAAGACCAAGGGTGG - Intergenic
1130598912 15:85263447-85263469 CTGTAGCTGAAGACCAAGGGTGG + Intergenic
1132032858 15:98452524-98452546 CTGCTGCAGCAGAGCCAGAGAGG + Intronic
1132036383 15:98488337-98488359 CTGTGGCAGCTGACCCCGAGTGG - Intronic
1133118448 16:3591533-3591555 CTATAGCTGCAGACATAAAGGGG + Intronic
1133156003 16:3876713-3876735 CTGAAGCAGCAGCCCTGGAGAGG - Intronic
1136615528 16:31396041-31396063 CTGGAGCAGCTGACCTAGGTGGG - Intronic
1138452469 16:57101890-57101912 CTCTAGCAGAAGGCCTAGAGTGG - Intronic
1140143750 16:72285563-72285585 CTGTAGCCCCAGAGGTAGAGCGG + Intergenic
1141160149 16:81624010-81624032 CTGTATCAGCAGAAGCAGAGGGG - Intronic
1141752505 16:85968270-85968292 CTGTTTCAGCAGAACTAGGGTGG + Intergenic
1144684150 17:17215180-17215202 CTGTAGCTGCAGACCGAGGTGGG - Exonic
1145889543 17:28405316-28405338 CTGGAGCAGCAGGCCCAGCGAGG + Exonic
1146436674 17:32856234-32856256 CTGGAGCAGCAGACATGAAGAGG - Intronic
1146894785 17:36533658-36533680 CTGTAGCACCACACCTTAAGTGG - Intronic
1151877379 17:76874548-76874570 CTGTAGCAGCCCACCCAGATAGG - Intronic
1153411966 18:4803277-4803299 CTGCAGCAGCAGGGCAAGAGTGG + Intergenic
1154419711 18:14216230-14216252 CTGTAGCAGCAGAAATACTGTGG - Intergenic
1161740602 19:6018821-6018843 CTGCAGGAGCAGAGCTGGAGGGG - Intronic
1167571696 19:50292725-50292747 CTGTAGCAGTTGAACTGGAGTGG + Intronic
1168254692 19:55158972-55158994 CTCTAGCAGCGGACTTAGAATGG + Exonic
925900692 2:8507432-8507454 ATGGAGCAGAAGACCTATAGAGG - Intergenic
926008738 2:9392315-9392337 CTGCTGCAGCAGCCCTGGAGTGG + Intronic
926515593 2:13841131-13841153 GTTTAGCAGAAGACGTAGAGCGG + Intergenic
927604793 2:24477127-24477149 CTGTAGGAGCAGAGTTAGAAAGG - Intergenic
928617110 2:33051776-33051798 ATGTAGAAGCAGACATAAAGTGG - Intronic
928628757 2:33168983-33169005 CTGTGGCAGCAGAGTTAGGGGGG + Intronic
931905851 2:66843133-66843155 CTGTATCAGCAGTTCTGGAGAGG - Intergenic
932556457 2:72829181-72829203 ATGTAGAAGCAGAGATAGAGTGG - Intergenic
934497517 2:94821034-94821056 CTGTAGCAGCAGAAATACTGTGG + Intergenic
935305586 2:101733338-101733360 CTGTTACAGCTGACCTTGAGAGG + Intronic
936583285 2:113726598-113726620 CTTTAGCATCAGACAGAGAGTGG - Intronic
937587039 2:123565218-123565240 CTGTAGCACCAGCACTAGGGGGG + Intergenic
943436278 2:187868735-187868757 CTGCAGCTGGAGACCCAGAGAGG - Intergenic
943436293 2:187868829-187868851 CTGCAGCTGGAGACCCAGAGAGG - Intergenic
949070318 2:242020560-242020582 CTGCAGCTGCAGACCCAGAGAGG + Intergenic
1170089003 20:12569393-12569415 CTGTAGCAGTGGACCCAGAAAGG + Intergenic
1170463954 20:16605937-16605959 GTGTAGAGGCTGACCTAGAGTGG - Intergenic
1170519892 20:17173962-17173984 CTGAGGCAGCAGATCTGGAGTGG - Intergenic
1173259082 20:41417234-41417256 CTGTAGCAGCTGAGCAATAGTGG + Exonic
1174060957 20:47832807-47832829 GTGTAGCTGGAGACCTAGGGAGG - Intergenic
1174070940 20:47898563-47898585 GTGTAGCTGGAGACCTAGGGAGG + Intergenic
1174100162 20:48121219-48121241 GTGTAGCTGGAGACCTAGGGAGG - Intergenic
1174100871 20:48125276-48125298 GTGGAGCTGCAGACCTAGGGAGG - Intergenic
1174100901 20:48125469-48125491 TGGAAGCTGCAGACCTAGAGAGG - Intergenic
1174149228 20:48474436-48474458 GTGGAGCTGGAGACCTAGAGAGG - Intergenic
1174153120 20:48500095-48500117 GTGTAGCTGGAGACCTAGGGAGG - Intergenic
1176610192 21:8875029-8875051 CTGTAGCAGCAGAAATACTGTGG - Intergenic
1176853584 21:13943067-13943089 CTGTAGCAGCAGAAATACTGTGG + Intergenic
1178278821 21:31263528-31263550 CAGTGGTACCAGACCTAGAGGGG + Intronic
1179011580 21:37560558-37560580 CTGTACCTGGTGACCTAGAGTGG - Intergenic
1179578507 21:42322698-42322720 CTGGAGCAGCAGGCCAGGAGAGG - Intergenic
1180054075 21:45348106-45348128 CAGCAGCAGCAGCCCGAGAGTGG + Intergenic
1181569940 22:23763116-23763138 CTGAAGCAGCAGAACCACAGAGG + Exonic
1181894029 22:26090954-26090976 CTGAAGCAGCAGACCCAGAAGGG - Intergenic
1184147929 22:42622446-42622468 GTGGAGCAGCCGACCTGGAGGGG + Intronic
1184517277 22:44970464-44970486 CTGTAGCAGCAGACCTAGAGGGG - Intronic
1184677459 22:46051513-46051535 CTGTAGCAACAGGCTCAGAGAGG + Exonic
1184970379 22:48015847-48015869 CTGAAGCTGCTGACCCAGAGAGG - Intergenic
949159326 3:860931-860953 CTGCAGCTGGAGACCTGGAGAGG - Intergenic
949159351 3:861130-861152 CTGCAGCTGGAGACCTGGAGAGG - Intergenic
950873016 3:16245493-16245515 ATGTAGGACCAGCCCTAGAGTGG - Intergenic
952575997 3:34774859-34774881 CTGTAGCTTCACACGTAGAGTGG - Intergenic
957585706 3:82128813-82128835 CTGGAGAAGCTGACCTAGACAGG + Intergenic
958533576 3:95366281-95366303 CAGTATCAGCAGACCTCTAGAGG + Intergenic
963145361 3:141988502-141988524 CTGAGGCAGGAGAACTAGAGGGG - Intronic
964547934 3:157855709-157855731 ATGTAGCAGAAGACCTTTAGTGG + Intergenic
968049630 3:195645391-195645413 TTGCAGCTGCAGACCTGGAGAGG + Intergenic
968049639 3:195645485-195645507 TTGCAGCTGCAGACCTGGAGAGG + Intergenic
968049661 3:195645673-195645695 TTGCAGCTGCAGACCTGGAGAGG + Intergenic
968049665 3:195645720-195645742 TTGCAGCTGCAGACCTGGAGAGG + Intergenic
968097638 3:195942915-195942937 TTGCAGCTGCAGACCTGGAGAGG - Intergenic
968097662 3:195943150-195943172 TTGCAGCTGCAGACCTGGAGAGG - Intergenic
968097672 3:195943291-195943313 TTGTAGCTGCAGACCTGGAGAGG - Intergenic
968097730 3:195943716-195943738 TTGCAGCTGCAGACCTGGAGAGG - Intergenic
968097916 3:195945179-195945201 GTGCAGCTGCAGACCTGGAGAGG - Intergenic
968097921 3:195945226-195945248 ATGCAGCTGCAGACCTGGAGAGG - Intergenic
968105999 3:196001500-196001522 ATGGAGCTGCAGACCTGGAGAGG - Intergenic
968106077 3:196002152-196002174 TTGCAGCTGCAGACCTGGAGAGG - Intergenic
968106083 3:196002199-196002221 TTGCAGCTGCAGACCTGGAGAGG - Intergenic
968106094 3:196002293-196002315 TTGCAGCTGCAGACCTGGAGAGG - Intergenic
968106098 3:196002340-196002362 TTGCAGCTGCAGACCTGGAGAGG - Intergenic
968106212 3:196003239-196003261 TTGCAGCTGCAGACCTGGAGAGG - Intergenic
968106298 3:196003948-196003970 TTGCAGCTGCAGACCTGGAGAGG - Intergenic
968106394 3:196004700-196004722 CTGCAGCTGCAGACCCGGAGAGG - Intergenic
968304474 3:197640309-197640331 TTGCAGCTGCAGACCTGGAGAGG - Intergenic
968304496 3:197640497-197640519 TTGCAGCTGCAGACCTGGAGAGG - Intergenic
968304504 3:197640591-197640613 TTGCAGCTGCAGACCTGGAGAGG - Intergenic
968304514 3:197640685-197640707 GTGGAGCTGCAGACCTGGAGAGG - Intergenic
968304558 3:197641016-197641038 TTGCAGCTGCAGACCTGGAGAGG - Intergenic
968304588 3:197641300-197641322 GTGCAGCTGCAGACCTGGAGAGG - Intergenic
968304632 3:197641723-197641745 TTGCAGCTGCAGACCTGGAGAGG - Intergenic
968304664 3:197641958-197641980 TTGCAGCTGCAGACCTGGAGAGG - Intergenic
968304694 3:197642194-197642216 TTGCAGCTGCAGACCTGGAGAGG - Intergenic
968304705 3:197642288-197642310 GTGCAGCTGCAGACCTGGAGAGG - Intergenic
968304750 3:197642617-197642639 GTGCAGCTGCAGACCTGGAGAGG - Intergenic
968304763 3:197642711-197642733 GTGCAGCTGCAGACCTGGAGAGG - Intergenic
968304780 3:197642852-197642874 GTGCAGCTGCAGACCTGGAGAGG - Intergenic
968304798 3:197642993-197643015 TTGCAGCTGCAGACCTGGAGAGG - Intergenic
968304827 3:197643229-197643251 TTGCAGCTGCAGACCTGGAGAGG - Intergenic
968304838 3:197643322-197643344 GTGCAGCTGCAGACCTGGAGAGG - Intergenic
968304851 3:197643416-197643438 GTGCAGCTGCAGACCTGGAGAGG - Intergenic
968304864 3:197643510-197643532 GTGCAGCTGCAGACCTGGAGAGG - Intergenic
968304881 3:197643651-197643673 GTGCAGCTGCAGACCTGGAGAGG - Intergenic
968304894 3:197643745-197643767 GTGCAGCTGCAGACCTGGAGAGG - Intergenic
968304907 3:197643839-197643861 GTGCAGCTGCAGACCTGGAGAGG - Intergenic
968304926 3:197643980-197644002 TTGCAGCTGCAGACCTGGAGAGG - Intergenic
968304956 3:197644216-197644238 TTGCAGCTGCAGACCTGGAGAGG - Intergenic
968304981 3:197644404-197644426 GTGCAGCTGCAGACCTGGAGAGG - Intergenic
968304994 3:197644498-197644520 GTGCAGCTGCAGACCTGGAGAGG - Intergenic
968305007 3:197644592-197644614 GTGCAGCTGCAGACCTGGAGAGG - Intergenic
968305026 3:197644733-197644755 GTGCAGCTGCAGACCTGGAGAGG - Intergenic
968305045 3:197644874-197644896 GTGCAGCTGCAGACCTGGAGAGG - Intergenic
968305064 3:197645015-197645037 GTGCAGCTGCAGACCTGGAGAGG - Intergenic
968305089 3:197645203-197645225 GTGCAGCTGCAGACCTGGAGAGG - Intergenic
968305108 3:197645344-197645366 GTGCAGCTGCAGACCTGGAGAGG - Intergenic
968305121 3:197645438-197645460 GTGCAGCTGCAGACCTGGAGAGG - Intergenic
968305134 3:197645532-197645554 ATGCAGCTGCAGACCTGGAGAGG - Intergenic
968305143 3:197645626-197645648 CTGCAGCTGCAGACCTGGGGAGG - Intergenic
1202736873 3_GL000221v1_random:9816-9838 CTGTAGCAGCAGAAATACTGTGG - Intergenic
968753470 4:2402274-2402296 CTGGAGCAGCTGACCTTGGGAGG - Intronic
974689823 4:65282960-65282982 CTGTGTCAGCAGGTCTAGAGTGG + Intergenic
979388519 4:120099081-120099103 CTGGATCATCAGACCTGGAGAGG + Intergenic
981440334 4:144775316-144775338 ATGTCGCAAAAGACCTAGAGGGG + Intergenic
983526440 4:168765035-168765057 CTGTAAAAGAAGACCTAGAAGGG - Intronic
985506256 5:282449-282471 TTGCAGCTGCAGACCCAGAGAGG + Intronic
985506272 5:282590-282612 TTGCAGCTGCAGACCTGGAGAGG + Intronic
985506353 5:283393-283415 TTGCAGCTGCAGACCCAGAGAGG + Intronic
985506357 5:283440-283462 TTGTAGCTGCAGACCCAGAGAGG + Intronic
985506430 5:284101-284123 TTGGAGCTGGAGACCTAGAGAGG + Intronic
985741632 5:1620514-1620536 TTGCAGCTGCAGACCCAGAGAGG - Intergenic
985741771 5:1621640-1621662 TTGCAGCTGCAGACCTGGAGAGG - Intergenic
985741802 5:1621877-1621899 TTGCAGCTGCAGACCTGGAGAGG - Intergenic
985742032 5:1623711-1623733 GTGCAGCTGCAGACCCAGAGAGG - Intergenic
985742177 5:1624769-1624791 GTGCAGCTGCAGACCTGGAGAGG - Intergenic
985742187 5:1624863-1624885 TTGCAGCTGCAGACCTGGAGAGG - Intergenic
985742193 5:1624910-1624932 TTGCAGCTGCAGACCTGGAGAGG - Intergenic
985742205 5:1625004-1625026 CTGCAGCTGCAGACCCGGAGAGG - Intergenic
986107688 5:4675718-4675740 CCGTAGCAGCACACCTTGAAAGG - Intergenic
987464611 5:18256927-18256949 CTGTAGAAACAGAGATAGAGAGG + Intergenic
988065560 5:26226299-26226321 CTGCAGCTGGAGACCCAGAGAGG - Intergenic
988065672 5:26227228-26227250 CTGCAGCTGGAGACCTGGAGAGG - Intergenic
989237879 5:39170419-39170441 CCTCAGCAGCAGACCTGGAGGGG + Intronic
990116713 5:52399708-52399730 CTTTAGCTGCAGCCCAAGAGTGG + Intergenic
992805340 5:80331822-80331844 GTGGAGCAGAGGACCTAGAGAGG - Intergenic
993874996 5:93296029-93296051 GTTTAGCAGCAGAATTAGAGAGG + Intergenic
995349303 5:111156661-111156683 CTGAAGCAGCAGCCCTAGCAGGG - Intergenic
998036605 5:138922394-138922416 CTGTAGGGCCAGACCTAGAAAGG + Intronic
1000380446 5:160624286-160624308 CTGTGCCAGCAGCCCTAGGGAGG - Intronic
1001664511 5:173421392-173421414 CAGTACCAGCAGACCCAGAGAGG - Intergenic
1007796824 6:44355784-44355806 CTGTTGCAGAGGACCTAAAGAGG - Intronic
1008678426 6:53845746-53845768 CTGTTGCAGTAGATCCAGAGTGG + Intronic
1012228963 6:96737737-96737759 CAGCAGCAGCAGGGCTAGAGGGG + Intergenic
1017009712 6:150055060-150055082 GTGAAGCTGCAGACCTAGGGAGG - Intergenic
1023385415 7:39652143-39652165 CTATGGCAGCAGAGCAAGAGAGG + Intronic
1025233323 7:57217442-57217464 CTGGAGCTGCAGACCCAGGGAGG + Intergenic
1031505631 7:122578551-122578573 CTGACTCAGCAGATCTAGAGTGG + Intronic
1033253461 7:139778810-139778832 CTGGAGAAGCAAACCTGGAGAGG - Intronic
1038480625 8:27899368-27899390 CTGTAGGAGCAGAGCTGGTGTGG - Intronic
1039301579 8:36214952-36214974 CTGTAGCAGAAGTCAGAGAGAGG - Intergenic
1039471876 8:37818539-37818561 ATGTAGGAGCAGTACTAGAGTGG + Intronic
1039795008 8:40905462-40905484 CTCTACCAGCAAACCAAGAGGGG - Intergenic
1042482762 8:69322755-69322777 GTGCAGCTGCAGACCCAGAGAGG + Intergenic
1042482775 8:69322855-69322877 CTGCAGCTGGAGACCCAGAGAGG + Intergenic
1044600037 8:93994926-93994948 CTGTGGCAGCAGATTTAGGGAGG - Intergenic
1045068408 8:98474397-98474419 CTGAAGCTGCAGACCTAGGCAGG - Intronic
1045071748 8:98513635-98513657 CTGCAGCAGCAGACCTAATAGGG + Intronic
1048685985 8:136906206-136906228 CTCCAGCAGCAAGCCTAGAGTGG - Intergenic
1049197961 8:141325792-141325814 CTGTGGCTGCAGCCCTCGAGGGG - Intergenic
1050413666 9:5392033-5392055 ATGTACCATGAGACCTAGAGGGG + Intronic
1052565429 9:30143914-30143936 CTGTACCTGCATACATAGAGGGG - Intergenic
1053659628 9:40259437-40259459 CTGTAGCAGCAGAAATACTGTGG - Intronic
1053909999 9:42888789-42888811 CTGTAGCAGCAGAAATACTGTGG - Intergenic
1054360640 9:64112188-64112210 CTGTAGCAGCAGAAATACTGTGG - Intergenic
1054371756 9:64405736-64405758 CTGTAGCAGCAGAAATACTGTGG - Intronic
1054524970 9:66116779-66116801 CTGTAGCAGCAGAAATACTGTGG + Intronic
1054679375 9:67895453-67895475 CTGTAGCAGCAGAAATACTGTGG - Intronic
1055158058 9:73089066-73089088 ATGTAGCAGATGACCAAGAGTGG + Intergenic
1059874244 9:118616407-118616429 CTGCAGCAACAGAGCTGGAGAGG + Intergenic
1060698647 9:125731509-125731531 CTGTAGCAGGAGAGATGGAGGGG - Intergenic
1203705598 Un_KI270742v1:40260-40282 CTGTAGCAGCAGAAATACTGTGG - Intergenic
1186689803 X:11963287-11963309 CTGTAGCAGCAGACATCGGTTGG - Intergenic
1188078967 X:25813353-25813375 ATGTAGCATCATAACTAGAGAGG - Intergenic
1189943459 X:46152549-46152571 TTGTAGCAGGAGAGCTAGAGGGG + Intergenic
1192275302 X:69623769-69623791 GTGGAGAAGCAGACCCAGAGGGG + Intronic
1193913005 X:87328141-87328163 CTGTAGCAGCAGAGGCAGAAGGG - Intergenic
1195944946 X:110199751-110199773 CTGTGGCAGCAGTCCAAAAGAGG - Intronic
1197324393 X:125074324-125074346 CTGGGGAAGCAGACCCAGAGTGG - Intergenic
1197807600 X:130412577-130412599 GTGGAGCAGAGGACCTAGAGAGG + Exonic
1198850111 X:140957222-140957244 CTGTAGCAACAGAGCAAGACTGG + Intergenic
1198879445 X:141263511-141263533 GTGGAGCAGAGGACCTAGAGAGG - Intergenic
1199608519 X:149594944-149594966 CCGTAGATGCAGACCTGGAGCGG + Intergenic
1199630603 X:149774416-149774438 CCGTAGATGCAGACCTGGAGCGG - Exonic
1199654446 X:149980789-149980811 CTGGTTCAGCAGGCCTAGAGTGG - Intergenic