ID: 1184520773

View in Genome Browser
Species Human (GRCh38)
Location 22:44992729-44992751
Sequence AGGCATAAGAATGAGTGATG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 330
Summary {0: 1, 1: 0, 2: 0, 3: 19, 4: 310}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184520767_1184520773 25 Left 1184520767 22:44992681-44992703 CCCCACTTTCTGTGGACTGAACA 0: 1
1: 0
2: 0
3: 22
4: 189
Right 1184520773 22:44992729-44992751 AGGCATAAGAATGAGTGATGTGG 0: 1
1: 0
2: 0
3: 19
4: 310
1184520766_1184520773 29 Left 1184520766 22:44992677-44992699 CCAGCCCCACTTTCTGTGGACTG 0: 1
1: 0
2: 1
3: 16
4: 223
Right 1184520773 22:44992729-44992751 AGGCATAAGAATGAGTGATGTGG 0: 1
1: 0
2: 0
3: 19
4: 310
1184520771_1184520773 -10 Left 1184520771 22:44992716-44992738 CCCAACACAGAGTAGGCATAAGA 0: 1
1: 0
2: 0
3: 27
4: 307
Right 1184520773 22:44992729-44992751 AGGCATAAGAATGAGTGATGTGG 0: 1
1: 0
2: 0
3: 19
4: 310
1184520769_1184520773 23 Left 1184520769 22:44992683-44992705 CCACTTTCTGTGGACTGAACAGC 0: 1
1: 0
2: 1
3: 6
4: 134
Right 1184520773 22:44992729-44992751 AGGCATAAGAATGAGTGATGTGG 0: 1
1: 0
2: 0
3: 19
4: 310
1184520768_1184520773 24 Left 1184520768 22:44992682-44992704 CCCACTTTCTGTGGACTGAACAG No data
Right 1184520773 22:44992729-44992751 AGGCATAAGAATGAGTGATGTGG 0: 1
1: 0
2: 0
3: 19
4: 310

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184520773 Original CRISPR AGGCATAAGAATGAGTGATG TGG Intronic
905462851 1:38132876-38132898 AGACTTAAGAATGAATGATGAGG - Intergenic
905575709 1:39042928-39042950 GGGCATAAGAGTGAATGTTGAGG + Intergenic
907111876 1:51934176-51934198 AGGCAGGAGAATGGGTAATGAGG - Intronic
909813270 1:79958760-79958782 AGGCAAGAGAATGTGTGCTGGGG + Intergenic
910263396 1:85313355-85313377 AGGCCTAAGAAGAAGTGATTGGG + Intergenic
911167311 1:94735493-94735515 TGTCATCAGAATGAGTGACGGGG + Intergenic
913345967 1:117811487-117811509 AGGCTTAAGAGAGAGTTATGGGG - Intergenic
915077544 1:153321813-153321835 AGCCATAACAATGAATGGTGAGG + Intergenic
915299115 1:154941947-154941969 AGGCTGAAGAATGAGAGATAAGG + Intergenic
915610401 1:156987322-156987344 AGTCATAAGAAAGAATGAAGAGG + Intronic
916223187 1:162464827-162464849 AGGCATATCACTGAGGGATGTGG - Intergenic
916318197 1:163473638-163473660 AGGCCTAAGACTGTGAGATGTGG - Intergenic
917948938 1:180008401-180008423 AGGCATTATAATGAGTGCTTTGG - Intronic
918575235 1:186050711-186050733 AGATATAAGAATGAATGATAAGG + Intronic
918957968 1:191235764-191235786 AGGCATAAGAATGAATATTAAGG + Intergenic
918987719 1:191654805-191654827 AGGCAAAATAATAAGTGAAGGGG - Intergenic
920300090 1:204983224-204983246 AGGGACAAGAATCAGTTATGGGG + Intronic
921455904 1:215371178-215371200 AGGCATAAAATTCAGAGATGGGG - Intergenic
922342884 1:224671509-224671531 AAGCACAAGAAAGAGAGATGGGG + Intronic
922546308 1:226459820-226459842 AGGCATCAGAAATGGTGATGGGG + Intergenic
923737684 1:236626998-236627020 AGGTATGAGAATGAGGTATGAGG - Intergenic
923750004 1:236738650-236738672 AGGCATAAGTGTAAATGATGGGG + Intronic
924070801 1:240276249-240276271 AGGCATTAGAATAGGTGAAGAGG + Intronic
924694399 1:246383262-246383284 ATGCATTTGAATGAGTGTTGGGG + Intronic
1063772154 10:9215924-9215946 AGGCATTAGAATCAGAGAAGCGG - Intergenic
1065835985 10:29658942-29658964 AGGCATCAGGGTGAGTGATTTGG + Intronic
1067554748 10:47260964-47260986 AGGCATAAAAATGGATGCTGAGG - Intergenic
1068162087 10:53277842-53277864 AGGCATAAGAATGATTCAATAGG + Intergenic
1068233395 10:54200559-54200581 AGGCAAAAGTATGATTGAAGTGG - Intronic
1068291398 10:55006248-55006270 TGGGAGAAGAAGGAGTGATGAGG - Intronic
1073444225 10:103571259-103571281 AGGCATAAGGAAGAGGGAAGAGG - Intronic
1075250093 10:120861051-120861073 ATGCAGAAGAATGGGGGATGAGG + Intronic
1075400662 10:122159271-122159293 TGGAACAAGACTGAGTGATGCGG + Intronic
1075408788 10:122212189-122212211 AGGCTCAGGAATGAGAGATGTGG + Intronic
1075955108 10:126516884-126516906 AAGCAGAAGTTTGAGTGATGCGG - Intronic
1078343929 11:10526481-10526503 AGACTCAAGAATGAGTCATGCGG + Intronic
1078904506 11:15671486-15671508 AGTCATCAGGATGAGGGATGAGG + Intergenic
1079702741 11:23569533-23569555 AGGCCTAAAAATGAATGCTGAGG - Intergenic
1080732732 11:34976635-34976657 AGGAATAAAAATGAGTGAGTGGG + Intronic
1081194918 11:40149865-40149887 AGGCAAAAGAGTCAGAGATGTGG + Intronic
1081921019 11:46776613-46776635 AGGCAAAACAGTGAGTGATCTGG + Intronic
1082206654 11:49443696-49443718 AGGCATAAAAATAAGTGTTGTGG + Intergenic
1082925643 11:58543964-58543986 AGGCATGTGAAAAAGTGATGAGG - Intronic
1083054531 11:59807112-59807134 AGGCATAAGAAAGGCTTATGTGG + Intronic
1083134868 11:60662823-60662845 GGGCAGAAGACGGAGTGATGGGG - Intergenic
1084856579 11:71992145-71992167 AGGCACAACAATAAATGATGGGG + Intronic
1084945234 11:72634648-72634670 AGGCATAAGAAGGACTCAGGAGG + Intronic
1085425091 11:76397300-76397322 AGCCATAAGAAGGAATGAAGGGG - Intronic
1085633412 11:78138968-78138990 ATGAAAAAGAATAAGTGATGTGG - Intronic
1086304970 11:85470036-85470058 ATGGATAGGAGTGAGTGATGGGG - Intronic
1086648612 11:89258069-89258091 AGGCATAAAAATAAGTGTTGTGG - Intronic
1087178020 11:95112912-95112934 AGGCATATGAAACAGTGATTAGG + Intronic
1087345081 11:96961936-96961958 AGGCAAGAGAATGAGCCATGTGG + Intergenic
1088879535 11:113962740-113962762 AGGCATGAGAAGGTGGGATGGGG + Intergenic
1089363211 11:117904577-117904599 AGGCAGAGCAATGACTGATGTGG - Intronic
1090098899 11:123773139-123773161 AAGCATAAAAATGGGTGATTTGG - Intergenic
1092169111 12:6362305-6362327 AGGGCAAAGAATGAGTGATCTGG + Intronic
1094152080 12:27295944-27295966 TGGGAAAAGAATGAGTGGTGAGG + Intronic
1094231845 12:28114826-28114848 AGGCATGAGGAGCAGTGATGTGG + Intergenic
1095899836 12:47316838-47316860 AGGAATAAGAATGTTTGTTGGGG + Intergenic
1095937881 12:47705119-47705141 AGGAAAAAGGATGAGTGATGGGG + Intronic
1096810929 12:54169386-54169408 TTGCATATGAATGAGGGATGGGG + Intronic
1096893450 12:54795583-54795605 ATGCAGAAGGAGGAGTGATGAGG + Intergenic
1098139777 12:67439679-67439701 ACAAATAAGAAAGAGTGATGTGG + Intergenic
1098839315 12:75459747-75459769 AGGCACAAGAACCAGTGCTGAGG - Intergenic
1099036120 12:77589569-77589591 AAGAATGAGAATGAGTGAAGGGG + Intergenic
1100716665 12:97313311-97313333 AGGGTTAGGAAGGAGTGATGGGG - Intergenic
1101075090 12:101120684-101120706 ATGAATAAAAATAAGTGATGGGG + Intronic
1101245024 12:102876901-102876923 AAGTATGAGAATGAGAGATGTGG - Intronic
1101733473 12:107445379-107445401 AGGTATGAAAATGAGTAATGCGG + Intronic
1102581664 12:113892339-113892361 AGGCATAGGAAAAAATGATGGGG + Intronic
1103051542 12:117784138-117784160 AGCCATATCACTGAGTGATGGGG - Intronic
1103110691 12:118275435-118275457 GGGCATAAGATTGAATAATGGGG - Intronic
1103336147 12:120191352-120191374 AAGCATAAGACCCAGTGATGGGG + Intronic
1103801305 12:123539384-123539406 AGGCAGAGAATTGAGTGATGCGG - Intergenic
1103981881 12:124742073-124742095 AGGAATTTGAATGAGAGATGGGG + Intergenic
1105613903 13:21995028-21995050 AGGCAGAAGAATGGGTGAGAGGG + Intergenic
1106035517 13:26041179-26041201 AGGATTAAGGTTGAGTGATGAGG + Intergenic
1106758436 13:32844919-32844941 AGGCATATGTGTGAGTGGTGAGG - Intergenic
1107649575 13:42530997-42531019 AGACATAAGAAAGAGTGTTCTGG - Intergenic
1107790305 13:43995311-43995333 AGGCATAAGGCAGAGTGCTGAGG + Intergenic
1108032221 13:46244480-46244502 AGGAATAAGGCTGAGTGCTGTGG + Intronic
1108462795 13:50683965-50683987 AAGCATGAGAAAGACTGATGTGG - Intronic
1108913587 13:55582844-55582866 AGGCATAGAAATAAGGGATGGGG + Intergenic
1109377374 13:61514382-61514404 AGGCATAAATAATAGTGATGAGG - Intergenic
1109968634 13:69736868-69736890 AGGCATAAGAATGAGACAATAGG + Intronic
1110676571 13:78253889-78253911 AGACAAAGGAATGAGTGAAGAGG - Intergenic
1111406620 13:87814766-87814788 AGGCTTAAAAATGGGTGCTGAGG + Intergenic
1111467069 13:88627652-88627674 AGGCTGAAGAATGTGTTATGTGG - Intergenic
1113093281 13:106637048-106637070 AGGCAGAAGAATTACTGAGGCGG - Intergenic
1113975950 13:114227384-114227406 AAACATGAGAAAGAGTGATGGGG - Intergenic
1114352981 14:21874713-21874735 AGGTTTAGGGATGAGTGATGTGG - Intergenic
1115109034 14:29798848-29798870 AAGAAAAAGAATCAGTGATGTGG - Intronic
1118688399 14:68314293-68314315 AGGGATCAGAATGAGTGCAGGGG - Intronic
1120147589 14:80996203-80996225 AGGAGTAAGAATGATTGATCCGG - Intronic
1120414493 14:84202094-84202116 AGGCATAAGAAAGAGTAAAGGGG + Intergenic
1122948988 14:105030354-105030376 AGGAGTCAGGATGAGTGATGAGG - Intergenic
1123538052 15:21259428-21259450 AGGCAGAATAATAAGAGATGAGG - Intergenic
1126511746 15:49483965-49483987 TGGTTAAAGAATGAGTGATGTGG + Intronic
1127729325 15:61784063-61784085 AGGCATAAGAATGACATGTGGGG + Intergenic
1130968856 15:88717217-88717239 TGGCAGAAGAGTGAGTGAGGCGG + Intergenic
1131785941 15:95911250-95911272 AAGCAGAAGAATTAGTTATGAGG + Intergenic
1133667282 16:7981134-7981156 AGACATCAGAAAGAGTTATGAGG + Intergenic
1134116099 16:11549981-11550003 AGGCAGAAGCTGGAGTGATGAGG + Intronic
1135900237 16:26451689-26451711 AGGAACAAGAAAGAGAGATGGGG + Intergenic
1136673783 16:31880682-31880704 AGGGAGAAGAATGAGTCATCAGG + Intronic
1139221795 16:65190244-65190266 AAGGATAAGTATGAGCGATGTGG - Intergenic
1139527402 16:67525392-67525414 TGGCAAATGAATGAATGATGTGG + Intronic
1140277397 16:73522883-73522905 AAGGAGAAGAATGAGTGAAGCGG + Intergenic
1142576332 17:910816-910838 GGGCAGCAGAACGAGTGATGTGG + Exonic
1146470070 17:33117152-33117174 AGGAAGAAGAATGAGGAATGAGG - Intronic
1147546342 17:41404871-41404893 AGGCTTCAGAATCACTGATGGGG - Intergenic
1147854111 17:43465640-43465662 AGGCATCAGAAAAAGGGATGTGG + Intergenic
1149079244 17:52633565-52633587 AGGCAAAAGAGAGAGTGAAGGGG - Intergenic
1149391742 17:56198423-56198445 AGGCAGTAATATGAGTGATGGGG + Intronic
1149718028 17:58813023-58813045 AGTCATAATAATTTGTGATGTGG + Intronic
1150581044 17:66474034-66474056 AAGGATGAGAAAGAGTGATGTGG - Intronic
1154031301 18:10756349-10756371 GGGAATAAGAATGAGCTATGGGG + Intronic
1154031335 18:10756549-10756571 AGGGATAAGAATGAGCTATAGGG + Intronic
1154031512 18:10757370-10757392 GGGGATAAGAATGAGAGATGGGG + Intronic
1154031528 18:10757448-10757470 GGGGATAAGAATGAGCTATGGGG + Intronic
1158035139 18:53019550-53019572 AGGCTTAAGGATAAGTGAGGTGG - Intronic
1158870762 18:61685525-61685547 AAGCAGAGGCATGAGTGATGTGG - Intergenic
1159021969 18:63150822-63150844 ATGCTTAAGAATGAGTTATCAGG + Intronic
1159653696 18:71006955-71006977 AGGCATAAGTAAGTGTTATGTGG - Intergenic
1159908083 18:74116694-74116716 AGGCACAAGCATGAGTGGGGAGG - Intronic
1160758333 19:769993-770015 AGGAATAAGAATGAATGTTGAGG + Intergenic
1162262854 19:9546654-9546676 AGGGATTAGAAAGAGTGAGGAGG - Intergenic
1164922773 19:32102135-32102157 TGTCATAAGAGTGAGGGATGGGG + Intergenic
1166538312 19:43589961-43589983 AGGCATCAGAAAGAGTCAGGCGG + Exonic
1167724705 19:51202051-51202073 AGCCATAAGGAAGAGTCATGGGG - Intergenic
1168391393 19:56010849-56010871 TGGCATAAAAAGGAATGATGTGG + Intronic
925655767 2:6146573-6146595 AGACATAGGCATGAGAGATGAGG + Intergenic
925666056 2:6257625-6257647 AGGCAGCATGATGAGTGATGAGG - Intergenic
927944728 2:27128781-27128803 AGGCTTGACAATGTGTGATGGGG - Intronic
928212240 2:29331895-29331917 AGGCATAAGAAAAAGTGATTTGG - Intronic
929862919 2:45694580-45694602 ATGCATATGAATGAGTTGTGTGG + Intronic
930342508 2:50134682-50134704 AGGCATTGGTATGTGTGATGGGG - Intronic
930707556 2:54519762-54519784 AGGGATTACAATGAGAGATGAGG + Intronic
931184105 2:59932858-59932880 AACCATAAAAATGAATGATGTGG + Intergenic
932127807 2:69160288-69160310 AGGCATAAGCATGGGGGTTGGGG - Intronic
933066975 2:77809498-77809520 ATGCATAAGAATGGGTAAAGGGG - Intergenic
933294351 2:80472395-80472417 AGGATTCAGAATGAGTAATGTGG - Intronic
934151167 2:89149008-89149030 TGCCCTAAGAATTAGTGATGTGG + Intergenic
934216092 2:90032899-90032921 TGCCCTAAGAATTAGTGATGTGG - Intergenic
935133668 2:100279882-100279904 AGGCAGAAGCAGGAGTGAGGAGG - Exonic
938449915 2:131408916-131408938 AGGGGTAAGAATGAGTTCTGTGG + Intergenic
938581259 2:132648567-132648589 AGGGTTAAGGATCAGTGATGAGG + Intronic
939189147 2:138895908-138895930 AGGCAGAAGGATGAGGAATGGGG + Intergenic
939195993 2:138973291-138973313 AGGGATAAGAAATAGTGTTGTGG - Intergenic
939279253 2:140040919-140040941 AGGGATAAGAATGAGGAATTAGG + Intergenic
939475745 2:142684701-142684723 TGCCATAAGAATGTGTGAGGAGG - Intergenic
940948882 2:159649444-159649466 AGGCAGTAGTATGAGTGTTGGGG + Intergenic
941720752 2:168810119-168810141 AGGCACCTGAATGAGTGAGGAGG - Intronic
942245185 2:174001341-174001363 AGGCATAAGAAAGAATGTTTTGG + Intergenic
943003780 2:182363525-182363547 AGGTAAAAGAATGAGCCATGTGG + Intronic
945484312 2:210377003-210377025 AGACATAAGAATGAGGGAGTTGG - Intergenic
945570736 2:211464298-211464320 GGGCATATGAATTAATGATGAGG + Intronic
945775388 2:214100904-214100926 AGGAAAAAAAATGAGTGAAGTGG + Intronic
946927780 2:224642921-224642943 ATGCAAAAGAATGAGTGAGAGGG + Intergenic
947429250 2:230011238-230011260 AGGCATTAGAAAGGGTAATGGGG + Exonic
1169666583 20:8043727-8043749 ATGCAGTAGAATGAGTGATGTGG - Intergenic
1170532349 20:17307407-17307429 GGTCATAAGAATGAGCCATGGGG + Intronic
1171199594 20:23230708-23230730 AGGGAGATGAATGAGTGAAGTGG + Intergenic
1172201381 20:33128817-33128839 AGGCATAAGAATGACTTTGGCGG - Intergenic
1173271280 20:41538047-41538069 AGCCATAAAAAGGAGTGAAGTGG + Intronic
1173951806 20:46999320-46999342 AGGATGAAGAAGGAGTGATGGGG + Intronic
1174163535 20:48568584-48568606 TGGCATAAGAAAGTCTGATGGGG + Intergenic
1174164878 20:48577516-48577538 TGGTCTCAGAATGAGTGATGTGG + Intergenic
1174215910 20:48916200-48916222 AGGCATAAATATGGGTGATGTGG - Intergenic
1174693318 20:52531584-52531606 AGCCATAAGAATATGTGATATGG + Intergenic
1176521267 21:7826264-7826286 AGGCTTAAGAAAGAATGATCAGG - Intronic
1177528609 21:22331698-22331720 AGGCATAAGAATGATACATTGGG + Intergenic
1177910933 21:27030970-27030992 ATGCATAACAATCAATGATGTGG - Intergenic
1178655287 21:34456276-34456298 AGGCTTAAGAAAGAATGATCAGG - Intergenic
1178973399 21:37201084-37201106 TGGGCTAAGAATGAGTGATTGGG + Intronic
1181260452 22:21593515-21593537 AGGCAGAAGACTGTGAGATGGGG - Intronic
1183250374 22:36726026-36726048 AGGCAGGAGAATGAGTGAATGGG + Intergenic
1183727576 22:39598024-39598046 AGGGAGAAGAATGAGGAATGGGG + Intronic
1183929633 22:41228548-41228570 AGGGTTAAGATTGAGTGAGGCGG + Intronic
1184093379 22:42303936-42303958 AGGCAGGAGAAAGAGTGAAGAGG + Intronic
1184255934 22:43287026-43287048 AGGCACAAGGGTGTGTGATGGGG + Intronic
1184520773 22:44992729-44992751 AGGCATAAGAATGAGTGATGTGG + Intronic
949738213 3:7199354-7199376 AGGCAACAGAGTGAGTGCTGAGG + Intronic
950154132 3:10709104-10709126 AGGCATAGGAAGGAGAGAGGGGG + Intergenic
951799626 3:26581157-26581179 AAGAAGAAAAATGAGTGATGGGG + Intergenic
951949214 3:28180694-28180716 ATGAAGAAGAATGAGTGAAGGGG + Intergenic
952060421 3:29502143-29502165 AGGTATACAAATGAGTGAAGCGG - Intronic
952078840 3:29732066-29732088 AGGGGTAAGATAGAGTGATGTGG - Intronic
952926888 3:38326741-38326763 AGGCATGAGGCTGAGGGATGGGG - Intergenic
953702461 3:45207309-45207331 GGCTATAAGAATGAGTGATGAGG - Intergenic
953951357 3:47192868-47192890 AGGCATACTGATGAGTGGTGAGG - Intergenic
955690420 3:61585381-61585403 AGTCATAAGACTGCGTGTTGAGG - Intronic
956972859 3:74546994-74547016 AGACAGAAGCATGAGTGAAGTGG - Intergenic
957410661 3:79835363-79835385 ATGCAAAACAATGTGTGATGTGG - Intergenic
959160007 3:102711655-102711677 AGTCATAAGAATGAATCAAGTGG + Intergenic
959395504 3:105832461-105832483 AGGCAAAAGAATGATGCATGTGG + Intronic
959513239 3:107237244-107237266 AGGCAAAAGAATGAATCATTTGG - Intergenic
960303340 3:116031277-116031299 AGGCATGAGAAAAGGTGATGAGG + Intronic
960363399 3:116741786-116741808 AGGAATAAGAAAGAGGAATGAGG - Intronic
961607353 3:128106465-128106487 AGGAAGAAGAATGTGTGAAGGGG - Intronic
961996199 3:131246284-131246306 AGGCATAAGAATGATACATTTGG - Intronic
962477491 3:135768960-135768982 AGGCAACAGAATGAGTATTGAGG - Intergenic
962480438 3:135793566-135793588 AGGCATGAGAATGAGTGGACAGG + Intergenic
962620383 3:137172150-137172172 GGGCATAAGTATGAGGGACGGGG + Intergenic
964445544 3:156753589-156753611 AGGCACAATAATAAGTGATTGGG + Intergenic
967358019 3:188595395-188595417 GGGGATACGAATGACTGATGGGG - Intronic
967947272 3:194814002-194814024 AGGCACAAGACTGAATCATGAGG + Intergenic
968136057 3:196220294-196220316 AGGCTTAAGAAGCAGGGATGCGG + Intronic
970013771 4:11489651-11489673 AGGCCTAAAAATGAATGCTGAGG + Intergenic
971134418 4:23852490-23852512 AGGAAAGAGAATGAGTGATGTGG - Intronic
971164772 4:24171591-24171613 AGGCATATTTCTGAGTGATGGGG - Intergenic
971712903 4:30139958-30139980 AGGCATAAGTTTAAGTGATAAGG + Intergenic
973128366 4:46617635-46617657 AGGCCTAAAAATGAATGCTGAGG + Intergenic
973900001 4:55459616-55459638 AGGAATAAGGAACAGTGATGTGG - Intronic
974511317 4:62845524-62845546 AGGCAAAAGAGTGAGTGCAGGGG + Intergenic
975442442 4:74427048-74427070 CGGCATTAGACTGAGTGAGGTGG + Intergenic
975481721 4:74888292-74888314 AGAAATAAGAATCACTGATGAGG + Intergenic
975736332 4:77384890-77384912 AGGCCTATAATTGAGTGATGGGG + Intronic
976513915 4:85942348-85942370 AGGCATAACCTTGATTGATGTGG + Intronic
976765998 4:88598190-88598212 AGGGATAAGAATGAGTTGTTAGG + Intronic
978393402 4:108251527-108251549 AGCCTTAATAATGAGTGATCAGG + Intergenic
978429126 4:108615115-108615137 AGGCATAAGAATTAGAAAGGAGG + Intergenic
979375787 4:119944952-119944974 TGGCATAAGGATGGGTAATGTGG + Intergenic
981351474 4:143734480-143734502 AGGCATAAGAATGATAGAGTGGG - Intergenic
983601967 4:169541099-169541121 AGAAATAAAAATGAGTAATGTGG + Intronic
984228385 4:177063685-177063707 AGGCATAAGAATGATATAAGGGG + Intergenic
985193099 4:187399336-187399358 AGGAAGAAGGTTGAGTGATGTGG - Intergenic
987153596 5:15064976-15064998 AGGGATAAGAATGAGTGACAGGG - Intergenic
987417484 5:17678963-17678985 AGGCATTAATGTGAGTGATGGGG - Intergenic
987455876 5:18146058-18146080 AAGGAGAAGAATGAGTGATGTGG + Intergenic
987527856 5:19076916-19076938 AGGCATAAGAATGATCCATTGGG + Intergenic
987594340 5:19976804-19976826 AGGGATGAAAATGAGTTATGAGG + Intronic
988991498 5:36675605-36675627 AGGCATAAGAAAGCCTGATCAGG + Intronic
990999896 5:61772209-61772231 CGGCAGAAGAAAGAGTGAAGGGG - Intergenic
992333756 5:75744065-75744087 AGGCATAAAAATGCATGATAGGG + Intergenic
992842175 5:80706286-80706308 AGGCGTATGATTGAGTGAAGTGG + Intronic
993884237 5:93397683-93397705 GGGCATAATGAAGAGTGATGGGG + Intergenic
995629961 5:114122120-114122142 AGGCAGCACAATGAATGATGTGG + Intergenic
995758291 5:115536361-115536383 AGGCTGAAGAAAGAGAGATGAGG - Intronic
997378150 5:133413235-133413257 AGGTATAAGAAGGAATTATGAGG - Intronic
999361466 5:150989775-150989797 AGGCATGAGAATGTAGGATGTGG + Intergenic
999840880 5:155425256-155425278 TTGCATAACAATGACTGATGAGG + Intergenic
1000094692 5:157960972-157960994 AGGCAGAATAATGAGAGATAAGG - Intergenic
1001694028 5:173656290-173656312 AGGCATAAGCTTTTGTGATGTGG - Intergenic
1001859262 5:175038945-175038967 AGGCAAAAGAACCAGTGAGGGGG + Intergenic
1004450641 6:15742198-15742220 AGGCAAGAGAATGTGTGAAGGGG + Intergenic
1005611633 6:27531407-27531429 AGGTAGAAGAAAGAGAGATGAGG - Intergenic
1005667616 6:28074133-28074155 AACCATAAAAATGACTGATGCGG - Intergenic
1005926148 6:30447421-30447443 AGGCATATGAGTGAGTGTGGAGG + Intergenic
1008748399 6:54701827-54701849 AGGCAGGACAATGAGTGAAGTGG - Intergenic
1010106360 6:72173787-72173809 AGGCATGAGAATGGATGATTGGG + Intronic
1010699349 6:79023398-79023420 AGGCATAAGAATGAGTACTCTGG - Intronic
1010933686 6:81834959-81834981 AGGAAGAAGAATGAGGGAGGAGG + Intergenic
1013458586 6:110355283-110355305 AGTCATAAGAAAGGGGGATGGGG + Intronic
1013922860 6:115430201-115430223 AAGCAAAAGAATGAGAGATGTGG - Intergenic
1015336511 6:132045152-132045174 AAGGATAAGAATCAGTAATGTGG + Intergenic
1020441729 7:8224131-8224153 AGGCAGAGCAATGAGAGATGGGG + Intronic
1021367234 7:19795021-19795043 AGGCATAAGAATGTGGAAAGAGG + Intergenic
1021383185 7:19993778-19993800 AGGCATAAAAATGATGGGTGGGG + Intergenic
1021439622 7:20663095-20663117 AGGCAGAAGGATGAGTGGTCTGG - Intronic
1022538846 7:31116639-31116661 AGCCAGAGGAATGAGTGATAAGG - Intergenic
1023377715 7:39575171-39575193 AGACATTAGACTGAGTGGTGTGG + Intronic
1023673006 7:42599472-42599494 AGGCATAAGCATTAGTGCAGAGG + Intergenic
1024776084 7:52787933-52787955 AGGCTGAAGGATGAGTGGTGAGG - Intergenic
1025080832 7:55981091-55981113 AGACAGAAGAATGAGAGACGGGG - Intronic
1025625599 7:63218528-63218550 AGGCAGGAGTGTGAGTGATGGGG + Intergenic
1025656517 7:63524643-63524665 AGGCAGGAGTGTGAGTGATGGGG - Intergenic
1026727899 7:72884712-72884734 AGGCATATAAATGATTAATGTGG - Intronic
1026863309 7:73807884-73807906 AGGCAGAAGAAGGAGGGGTGGGG + Intronic
1027115941 7:75481075-75481097 AGGCATATAAATGATTAATGTGG + Intronic
1027366470 7:77463497-77463519 AGGCATTATAATAAGTGCTGAGG + Intergenic
1027399072 7:77788850-77788872 AGGCATGAGGAGGAGTGAGGAGG + Intergenic
1028333330 7:89623032-89623054 AGGCATAAGCACCAGTGCTGAGG - Intergenic
1029721605 7:102369590-102369612 AGGCATATAAATGATTAATGTGG - Intronic
1032661209 7:133985852-133985874 AGGGATAAGAATGAGGGAACTGG - Intronic
1033527650 7:142232361-142232383 AGAAATAAGAATAAGAGATGAGG + Intergenic
1034118258 7:148603785-148603807 AGGGATTTGAATGACTGATGAGG - Intronic
1034355305 7:150446409-150446431 AGGAAGAAGAATGAGTAGTGAGG + Intergenic
1036168792 8:6463224-6463246 AGGCAGAAGACTGAGTTCTGCGG + Intronic
1039655969 8:39407496-39407518 TGACATATGAATTAGTGATGTGG + Intergenic
1041312818 8:56533822-56533844 AGGCATAGGTATGAGGTATGAGG + Intergenic
1042200124 8:66273482-66273504 AGGCCTGAGAATGAGGGGTGAGG - Intergenic
1042325605 8:67524495-67524517 AGGCATAAACTGGAGTGATGTGG - Intronic
1042437823 8:68788426-68788448 AGGCATGAGAGTGAGTGCTCAGG + Intronic
1042925454 8:73963790-73963812 AGGTATAAAAATGCTTGATGGGG + Intronic
1043844232 8:85146004-85146026 AGGGGTCATAATGAGTGATGTGG - Exonic
1043866799 8:85383827-85383849 AGGCATTAATGTGAGTGATGGGG - Intronic
1044415236 8:91931374-91931396 AGGAATAATAATGATTGAGGAGG - Intergenic
1044473972 8:92604815-92604837 AGGAAGAAGAATGACTTATGGGG - Intergenic
1044868399 8:96594837-96594859 AGGGAGAAGTATGAGTGAAGAGG + Intronic
1045953281 8:107876339-107876361 AGTCATAGCAATGAATGATGAGG + Intergenic
1046126763 8:109919871-109919893 AGGCATATAAATAAGTGATGTGG - Intergenic
1048262524 8:132957017-132957039 AGGGATGGGAATGAGAGATGAGG + Intronic
1049472239 8:142781674-142781696 AGGCATAGGATTGAGTGGTGGGG - Intergenic
1050400758 9:5251224-5251246 AGGCATAAGAATGACATATTGGG + Intergenic
1052336577 9:27326199-27326221 AGCCATAACAGAGAGTGATGTGG + Exonic
1052405096 9:28049692-28049714 AGGCATTATAATGCCTGATGCGG + Intronic
1053361701 9:37492251-37492273 AGGCATAAACATGAGGTATGTGG - Intronic
1053621068 9:39818060-39818082 TGGTTAAAGAATGAGTGATGTGG - Intergenic
1053884035 9:42626274-42626296 TGGTTAAAGAATGAGTGATGTGG + Intergenic
1053888633 9:42668020-42668042 TGGTTAAAGAATGAGTGATGTGG - Intergenic
1054223055 9:62433720-62433742 TGGTTAAAGAATGAGTGATGTGG + Intergenic
1054227655 9:62475467-62475489 TGGTTAAAGAATGAGTGATGTGG - Intergenic
1054263094 9:62889377-62889399 TGGTTAAAGAATGAGTGATGTGG + Intergenic
1055024322 9:71703249-71703271 ACGGATAAGATGGAGTGATGAGG + Intronic
1058222887 9:102324878-102324900 GGGAAGAAGAATGAGTGACGGGG - Intergenic
1058383137 9:104401318-104401340 AAGAATAAGAATAAGTGATCTGG - Intergenic
1058550622 9:106110982-106111004 AGGTTTAAGAAGGAATGATGGGG + Intergenic
1059086145 9:111305027-111305049 AGGCAGAAGAATGGAAGATGGGG + Intergenic
1059402874 9:114081483-114081505 AGACACAAGAATAAATGATGAGG - Intergenic
1059605117 9:115825730-115825752 AAGCAGAAGAAAGAGTGAAGGGG - Intergenic
1059974869 9:119705144-119705166 AGGCATAAGTATTTGGGATGAGG + Intergenic
1060633959 9:125185373-125185395 AGGAATAAGAATGACATATGTGG - Intronic
1061361358 9:130144351-130144373 AGGCAGCAGAATGAGCCATGAGG - Intergenic
1188381331 X:29496448-29496470 AGGAATAAGAAAGAGTGTGGAGG - Intronic
1188552285 X:31377381-31377403 AGGCTTAAAACTTAGTGATGGGG - Intronic
1191105490 X:56769577-56769599 AGACATAAGAAAGCCTGATGCGG + Intergenic
1191106483 X:56774979-56775001 AGACATAAGAAAGCCTGATGCGG + Intergenic
1191107476 X:56780381-56780403 AGACATAAGAAAGCCTGATGCGG + Intergenic
1192265607 X:69535558-69535580 GGGCATAGGAAAGAGAGATGAGG + Intergenic
1193292988 X:79799389-79799411 AGGCATAAGAATGATAGTGGGGG - Intergenic
1193920308 X:87416804-87416826 AGGCATAATATCGAGTGATATGG - Intergenic
1194940453 X:100003245-100003267 AAGAATAAGAGAGAGTGATGGGG + Intergenic
1195485219 X:105396952-105396974 AGGCAGTAACATGAGTGATGGGG - Intronic
1198939260 X:141934936-141934958 TGGCATAAGAATAAGAGATTAGG + Intergenic
1199430471 X:147753915-147753937 AGGGATAAGGAGAAGTGATGTGG - Intergenic
1201352981 Y:13066793-13066815 AGGCATAAGAATGAGACATTGGG + Intergenic
1201644416 Y:16213423-16213445 AGGAATCAGAAAGACTGATGGGG + Intergenic
1201658399 Y:16371898-16371920 AGGAATCAGAAAGACTGATGGGG - Intergenic