ID: 1184521730

View in Genome Browser
Species Human (GRCh38)
Location 22:44998565-44998587
Sequence ATAAGCCATCAGGCCAAGGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 314
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 292}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184521723_1184521730 14 Left 1184521723 22:44998528-44998550 CCCTTGGTTCTCACATCCTATGC 0: 1
1: 0
2: 0
3: 13
4: 201
Right 1184521730 22:44998565-44998587 ATAAGCCATCAGGCCAAGGCGGG 0: 1
1: 0
2: 0
3: 21
4: 292
1184521721_1184521730 25 Left 1184521721 22:44998517-44998539 CCGAGGTGCTCCCCTTGGTTCTC 0: 1
1: 0
2: 2
3: 25
4: 209
Right 1184521730 22:44998565-44998587 ATAAGCCATCAGGCCAAGGCGGG 0: 1
1: 0
2: 0
3: 21
4: 292
1184521724_1184521730 13 Left 1184521724 22:44998529-44998551 CCTTGGTTCTCACATCCTATGCT 0: 1
1: 0
2: 1
3: 11
4: 171
Right 1184521730 22:44998565-44998587 ATAAGCCATCAGGCCAAGGCGGG 0: 1
1: 0
2: 0
3: 21
4: 292
1184521725_1184521730 -2 Left 1184521725 22:44998544-44998566 CCTATGCTTTTAGCTTCAGCCAT No data
Right 1184521730 22:44998565-44998587 ATAAGCCATCAGGCCAAGGCGGG 0: 1
1: 0
2: 0
3: 21
4: 292
1184521722_1184521730 15 Left 1184521722 22:44998527-44998549 CCCCTTGGTTCTCACATCCTATG 0: 1
1: 0
2: 2
3: 10
4: 168
Right 1184521730 22:44998565-44998587 ATAAGCCATCAGGCCAAGGCGGG 0: 1
1: 0
2: 0
3: 21
4: 292

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184521730 Original CRISPR ATAAGCCATCAGGCCAAGGC GGG Intronic
901259426 1:7860758-7860780 GTAAGCCACCAGGCCCAGCCCGG - Intergenic
901507060 1:9691467-9691489 ATAAGGAGTCAGGCCAGGGCGGG + Exonic
901508979 1:9705186-9705208 ATGAGCCATCATGCCCAGCCTGG - Intronic
901608655 1:10479092-10479114 ATGAGCCATCACGCCCAGCCAGG - Intronic
902281619 1:15378904-15378926 AAAAGCCACCAGGCCAAGCGGGG - Intronic
903120257 1:21211923-21211945 CTCAGCACTCAGGCCAAGGCAGG + Intergenic
905691208 1:39944328-39944350 ATGAGCCATCATGCCCAGCCAGG + Intergenic
905712108 1:40114180-40114202 ATAAGCCAGCATGCCCAGCCTGG + Intergenic
906069754 1:43008000-43008022 ACAAGCGATCAGGGCAAAGCGGG - Intergenic
908537917 1:65095683-65095705 ATAATACAGGAGGCCAAGGCAGG - Intergenic
908643861 1:66255368-66255390 ATAAGCCACCACGCCCAGCCTGG + Intronic
909654987 1:78021690-78021712 ATAAGAAATAAAGCCAAGGCCGG + Intronic
910737692 1:90479721-90479743 GTGAGCCATCAGGCCCAGCCTGG - Intergenic
910831740 1:91468250-91468272 ATAAGCCACCATGCCCAGCCAGG - Intergenic
911119761 1:94284097-94284119 AAAAACCATCAAGCCAGGGCTGG + Intergenic
911619739 1:100053064-100053086 ATAAGCCACCATGCCCAGCCTGG + Intronic
911793508 1:102047664-102047686 ATCAGCCACCATGCCAAGCCTGG - Intergenic
912528226 1:110300665-110300687 ATAAGACCTGAGGGCAAGGCAGG - Intergenic
912846926 1:113082936-113082958 ATGAGCCACCACGCCCAGGCTGG + Intronic
913977528 1:143474802-143474824 ATGAGCCACCATGCCCAGGCTGG - Intergenic
914071933 1:144300433-144300455 ATGAGCCACCATGCCCAGGCTGG - Intergenic
914107222 1:144665923-144665945 ATGAGCCACCATGCCCAGGCTGG + Intergenic
914850444 1:151310115-151310137 CTGAGCCCCCAGGCCAAGGCTGG - Intronic
915598907 1:156910247-156910269 ATAAGCCCTCAGGGCAGGACAGG - Exonic
916310380 1:163391710-163391732 ATAAGCCATGATGCCTAGCCAGG + Intergenic
916527222 1:165621935-165621957 ATAGGCTAGGAGGCCAAGGCAGG + Intergenic
917842601 1:178993921-178993943 ATGAGCCACCAGGCCCAGCCAGG - Intergenic
918500821 1:185193745-185193767 ATGAGCCACCTTGCCAAGGCTGG + Intronic
918644237 1:186884592-186884614 ATGAGCCACCACGCCAAGCCTGG - Intronic
919888240 1:201950710-201950732 ATAAGCCATCATGCCCGGTCTGG - Intergenic
920018645 1:202935885-202935907 ATAAGCCACCATGCCCAGCCAGG + Intergenic
920668490 1:207984280-207984302 ATAAACAAACAGGCCAAGGCAGG + Intergenic
920788768 1:209068323-209068345 ATAAGACATCAGCCCACTGCAGG - Intergenic
920820237 1:209373704-209373726 ACAAGCCATCAGGCTCAGGAAGG + Intergenic
921941916 1:220850159-220850181 ATAAGCCACCACGCCTAGCCTGG + Intergenic
924945642 1:248844978-248845000 GTGAGCCATCACGCCCAGGCTGG - Intronic
1064055606 10:12094617-12094639 ATGAGCCACCATGCCCAGGCAGG + Intronic
1064215738 10:13398897-13398919 ATGAGCCATCATGCCCAGCCAGG + Intergenic
1064282418 10:13963485-13963507 AGAATCCATCAGTCCAAGACTGG + Intronic
1065016235 10:21465171-21465193 CTAAGGCAGGAGGCCAAGGCAGG + Intergenic
1065688884 10:28313221-28313243 ATAAGCCATCAGACCCAGCCTGG - Intronic
1067550868 10:47235087-47235109 TGAACCCAGCAGGCCAAGGCAGG - Intergenic
1067678986 10:48414862-48414884 ATGAGCCATCATGCCCAGCCTGG + Intronic
1069651285 10:70051827-70051849 ATCAGCCATTTGGCCAAGGCTGG + Intergenic
1070253248 10:74791581-74791603 ATGAGCCACCAGGCCCAGCCAGG - Intergenic
1070882679 10:79863365-79863387 ATCAGGCTTCAGGCCAAAGCTGG + Intergenic
1071478426 10:86044334-86044356 AAAAGCCATTAAGCCAATGCTGG - Intronic
1071649246 10:87379667-87379689 ATCAGACTTCAGGCCAAAGCTGG + Intergenic
1073309449 10:102529698-102529720 ATTAGCCGGGAGGCCAAGGCGGG + Intronic
1075924879 10:126243242-126243264 ATAAGACATCTGGCAAGGGCTGG - Intronic
1076714257 10:132355319-132355341 AACAGGCATCTGGCCAAGGCGGG - Intronic
1078088480 11:8248943-8248965 GGAAGCCTTCAGGCCAAAGCTGG + Intronic
1079127101 11:17724959-17724981 ATGAGCCACCATGCCAAGGCTGG - Intergenic
1079303003 11:19296170-19296192 GTATGCCAACAGGCCAGGGCTGG - Intergenic
1081264669 11:41005319-41005341 ATGAGCCATCACGCCCAGCCAGG - Intronic
1083788473 11:64968542-64968564 ATGAGCCATCAGGCCAGGCATGG + Intronic
1084015759 11:66379964-66379986 ATAAGCAATTATACCAAGGCTGG - Intergenic
1084064382 11:66695002-66695024 TGAAGCCAGCAAGCCAAGGCTGG - Intronic
1084170333 11:67397843-67397865 ATACTCCAGCTGGCCAAGGCTGG + Exonic
1084374866 11:68769617-68769639 AAAAGCAATCAGGCGGAGGCAGG - Intronic
1085398900 11:76223719-76223741 ATGAGCCACCAGGCCTAGCCTGG - Intergenic
1086961394 11:92982641-92982663 AGCAGCCAGGAGGCCAAGGCAGG - Exonic
1087374246 11:97322217-97322239 TTAAGCCAACAGGCCAAGAAGGG + Intergenic
1087978988 11:104587343-104587365 ATGAGCCATCAAGCCCAGCCTGG - Intergenic
1088719868 11:112582855-112582877 ACCTGCCATGAGGCCAAGGCAGG - Intergenic
1089347376 11:117799149-117799171 ATAAGCCAGCAGGCTGAGGGCGG - Intronic
1090533095 11:127611591-127611613 AGAAGCCATGAGGCCCAGGGAGG - Intergenic
1091596408 12:1881839-1881861 ATAAGCCATCTGGCCAAATTTGG - Intronic
1091735929 12:2921799-2921821 ATAAGCCACCACGCCCAGCCTGG - Intronic
1091828936 12:3535577-3535599 AGAACCCAACAGGACAAGGCTGG + Intronic
1092109508 12:5948960-5948982 CCTGGCCATCAGGCCAAGGCAGG + Exonic
1096226918 12:49871946-49871968 ATGAGCCACCAGGCCCAGCCCGG + Intronic
1097919383 12:65055487-65055509 ATGAGCCATCATGCCCAGCCAGG - Intronic
1098686652 12:73431467-73431489 CTAAGCCAAAAGGACAAGGCTGG - Intergenic
1101152370 12:101894948-101894970 TTATACCCTCAGGCCAAGGCAGG + Intronic
1102707348 12:114893727-114893749 ATGAGCCATCACGCCCAGCCAGG - Intergenic
1103097873 12:118146526-118146548 ATGAGCCACCATGCCAAGCCTGG + Intergenic
1104574370 12:129953383-129953405 ATAGGCCAACTGGCCAAGTCTGG + Intergenic
1105221806 13:18336590-18336612 ATGAGCCACCATGCCCAGGCTGG + Intergenic
1106134569 13:26964501-26964523 CTAAGCCATCAGACCAGGGAAGG - Intergenic
1106280287 13:28261548-28261570 ATGAGCCACCAGGCCCAGCCTGG - Intronic
1108242352 13:48478942-48478964 ATAAGCCATCATGCCTACCCGGG - Intronic
1108256361 13:48615327-48615349 AAAACCAATCTGGCCAAGGCTGG - Intergenic
1108351002 13:49590755-49590777 ATAAGCCACCATGCCCAGCCAGG - Intergenic
1108767962 13:53657989-53658011 ATAAGCCACCATGCCCAGCCAGG - Intergenic
1109694711 13:65939217-65939239 AAAAGCTGTCAGGCCAGGGCAGG + Intergenic
1110218460 13:73048622-73048644 ATAAGCCACCATGCCCAGTCAGG - Intergenic
1110416644 13:75260761-75260783 ATGAGCCACCATGCCCAGGCTGG - Intergenic
1112016938 13:95338951-95338973 ACCAGGCATCAGGCCAAGACAGG - Intergenic
1113235525 13:108268774-108268796 ACCAGCCATCAGGATAAGGCAGG + Intronic
1114177442 14:20335623-20335645 CTAAGCCATCACACCAAGCCTGG - Intergenic
1115247030 14:31306193-31306215 ATGAGCCATCATGCCTAGCCTGG - Intronic
1116856170 14:49954228-49954250 TAATGCCAGCAGGCCAAGGCGGG - Intergenic
1116873903 14:50092668-50092690 ATGAGCCACCATGCCCAGGCTGG - Intergenic
1117619672 14:57571972-57571994 ATATGCCATCATGACAATGCCGG + Exonic
1118938040 14:70306199-70306221 ATAAGCCAGAAGAACAAGGCTGG - Intergenic
1119222429 14:72919882-72919904 TTTAGCCATCAGGCCAGGACAGG + Intergenic
1119358714 14:74029398-74029420 ATGAGCCATCATGCCCAGCCTGG - Intronic
1120081562 14:80223128-80223150 ATAATCCATCATGCCCAGCCTGG + Intronic
1122330388 14:100908310-100908332 ATAAGCCACCATGCCCAGCCTGG - Intergenic
1126604781 15:50465174-50465196 AGAAGCCATCAGTCCAGGGTGGG + Exonic
1126746613 15:51831884-51831906 ATAAGACATGAGGCCAGGGCCGG + Intronic
1127067882 15:55259096-55259118 ATAAGCCACCATGCCCAGCCAGG + Intronic
1127861149 15:62995151-62995173 ATAAGCTGACAGCCCAAGGCTGG - Intergenic
1128973916 15:72134190-72134212 ATACAACATAAGGCCAAGGCAGG - Intronic
1129855281 15:78819828-78819850 ATAAGCCACCATGCCCAGCCGGG - Intronic
1129935079 15:79440524-79440546 AGAAGCCATCATGCCCAGGCAGG + Intronic
1130053464 15:80503008-80503030 ACAATCCATCCAGCCAAGGCTGG - Intronic
1130304023 15:82700753-82700775 TGAAGCCATAAGGGCAAGGCTGG - Intronic
1131112733 15:89775880-89775902 ATAAGGCATCAAGACAAGCCCGG - Intronic
1131250954 15:90829701-90829723 GTGAGCCAACAGGCCAAGGTGGG + Intergenic
1131919478 15:97308363-97308385 AAAAGTTGTCAGGCCAAGGCAGG - Intergenic
1132325078 15:100962245-100962267 ATAAGCCACCATGCCCAGCCTGG - Intronic
1132494014 16:251657-251679 ATAAGCCACCATGCCTAGCCAGG + Intronic
1133211119 16:4263952-4263974 GGAAGCCATCAGGCCAGGGGCGG - Intronic
1134225303 16:12385469-12385491 AGAGACCACCAGGCCAAGGCAGG + Intronic
1135054665 16:19220907-19220929 ATGAGCCATCATGCCCAGACAGG - Intronic
1135072680 16:19365868-19365890 ATGAGCCACCAGGCCCAGACTGG - Intergenic
1135808946 16:25569939-25569961 ACCAGCCATCAGGCCTAGGAAGG - Intergenic
1136241458 16:28947008-28947030 ATAAGCCAACATGCCCGGGCTGG + Intergenic
1136421780 16:30138929-30138951 ATTAGCCAGAAGGCCGAGGCGGG - Intergenic
1137668343 16:50265117-50265139 ATGAGCCACCATGCCAAGCCTGG + Intronic
1138117389 16:54371279-54371301 ATAAGCCACCACGCCCAGCCCGG - Intergenic
1138826812 16:60330642-60330664 GTAAGCCATCATGCCCAGCCAGG - Intergenic
1139683282 16:68581881-68581903 ATAAGCCATCACACCCAGCCTGG - Intergenic
1141670667 16:85490137-85490159 AGCAGCCAGCAGGCCAAGGCAGG - Intergenic
1142790158 17:2257734-2257756 ATGAGCCACCAGGCCCAGCCAGG - Intronic
1142940438 17:3376394-3376416 AAAAACCATCAGGGGAAGGCAGG + Intergenic
1143218650 17:5243446-5243468 ATAAAACATCAGGCCTTGGCTGG + Intergenic
1144472725 17:15559106-15559128 ATGAGCCACCATGCCCAGGCTGG + Intronic
1144923755 17:18785589-18785611 ATGAGCCACCATGCCCAGGCTGG - Intronic
1145831044 17:27916564-27916586 ATAAGCCAACATGCCCAGCCTGG - Intergenic
1145962306 17:28894202-28894224 ATGAGCCATCATGCCCAGCCAGG - Intronic
1146066346 17:29638800-29638822 ATAATCCCTGAGGCCAAGGCAGG - Intronic
1146341893 17:32026709-32026731 ATGAGCCACCAGGCCAGGCCAGG + Intronic
1146508600 17:33426586-33426608 ATTTGCCATCAGGGCTAGGCAGG + Intronic
1147700447 17:42390678-42390700 ATAAACATTCAGGCCAAGGCGGG + Intergenic
1148192119 17:45686614-45686636 ATGAGCCATCATGCCCAGCCTGG - Intergenic
1148272969 17:46278226-46278248 ATAAGCCACCATGCCCAGCCTGG + Intronic
1148539071 17:48465462-48465484 ATGAGCCACCATGCCCAGGCAGG - Intergenic
1148637997 17:49164007-49164029 AGAAGCCATCAGATCAAAGCAGG + Intronic
1149501739 17:57157917-57157939 ATAAGCCATCATACCCAGCCAGG + Intergenic
1150594949 17:66595705-66595727 ATAATCCAGGAGGCCGAGGCGGG - Intronic
1154285681 18:13054108-13054130 ATGAGCCACCAAGCCCAGGCTGG + Intronic
1156655053 18:39275135-39275157 ATAAGACATCAGGGCAAGCAGGG + Intergenic
1157946452 18:51986003-51986025 ATATGTCATCAGGCCGAGGCGGG - Intergenic
1159958348 18:74535747-74535769 ATAAGCCACCATGCCCAGCCAGG - Intronic
1160902808 19:1437267-1437289 ATAAGCCACCACGCCCAGCCAGG + Intergenic
1161542015 19:4857691-4857713 ATGAGCCACCAGGCCCAGCCTGG - Intronic
1161765159 19:6203491-6203513 ATAAGCCACCATGCCCAGCCTGG - Intergenic
1162045742 19:7999088-7999110 ATAAGCCACCACGCCAGGCCAGG - Intronic
1162137833 19:8566957-8566979 GTAAGCCACCAGGCCAAGCCTGG + Intronic
1163078954 19:14922205-14922227 ATAAAACACCAGGACAAGGCTGG - Intergenic
1163445699 19:17345160-17345182 AGAAGCCATCAGGCCAGGCACGG - Intergenic
1163505575 19:17704070-17704092 ATAAGCCATTAGGCCATCCCAGG + Intergenic
1165184003 19:34001246-34001268 ATAAGCCAGCAACACAAGGCCGG + Intergenic
1165501964 19:36196689-36196711 ATAAGCCACCACGCCCAGCCTGG - Intronic
1165857904 19:38890985-38891007 AGATGCCATCAGGCCAGGCCTGG + Intronic
1166197600 19:41217349-41217371 AGAAGCCAGCAGCCCATGGCCGG + Intergenic
1167399113 19:49253072-49253094 ATAAGCCGTAAATCCAAGGCCGG - Intergenic
1167840925 19:52119130-52119152 GAAAGTGATCAGGCCAAGGCAGG + Intronic
927382254 2:22492484-22492506 ATAAGCCACCAAGCCCAGCCAGG + Intergenic
927982361 2:27381952-27381974 ATAAGGCATAAGGCTAAGTCAGG + Intronic
928830575 2:35478053-35478075 ATAAGGCATCAGCCCCAGTCAGG + Intergenic
930139488 2:47937112-47937134 ATAAGCCATCACACCCAGCCAGG + Intergenic
930642890 2:53872492-53872514 ATAATTTATAAGGCCAAGGCGGG + Intronic
930660982 2:54053065-54053087 ACAAGCCATCAGGACCAGGGAGG - Intronic
934069737 2:88372992-88373014 ATGAGCCACCAGGCCCAGCCTGG + Intergenic
934997296 2:98976618-98976640 ATAATAGATTAGGCCAAGGCAGG + Intergenic
936448689 2:112617181-112617203 ATGAGCCATCGAGCCCAGGCAGG + Intergenic
936460894 2:112713171-112713193 ATAAGCCACCAGGCAAGGGCAGG - Intergenic
937960312 2:127453240-127453262 CAGAGACATCAGGCCAAGGCTGG + Intronic
937985218 2:127635295-127635317 AGAAGCCAGCAGGCCAGGGCAGG + Intronic
938283261 2:130083087-130083109 ACATGTCATGAGGCCAAGGCGGG + Intronic
938322719 2:130375720-130375742 ATAAAACACCAGACCAAGGCCGG - Intergenic
938333894 2:130471631-130471653 ACATGTCATGAGGCCAAGGCGGG + Intronic
938355924 2:130649036-130649058 ACATGTCATGAGGCCAAGGCGGG - Intronic
938432349 2:131255813-131255835 ACATGTCATGAGGCCAAGGCGGG - Intronic
938866741 2:135429898-135429920 ATAAGACACCAGGCCCAGCCTGG - Intronic
939748696 2:146012513-146012535 ATCAGCCAACAGGGCATGGCTGG + Intergenic
939990324 2:148872251-148872273 AGAAGCCATCAGTCCAGGGTGGG - Intergenic
941163579 2:162061984-162062006 GTAAGCCACCATGCCCAGGCTGG - Intronic
943153693 2:184146795-184146817 ATGAGCCACCAGGCCCAGCCTGG + Intergenic
944390915 2:199218553-199218575 TTAAGACATCAGGCCAAATCTGG + Intergenic
944449001 2:199821743-199821765 ATAAGCCACCACGCCCAGCCTGG + Intronic
945111741 2:206366592-206366614 GTAAGCCATCATGCCCAGCCTGG + Intergenic
947028543 2:225766086-225766108 ATTACCCACTAGGCCAAGGCAGG + Intergenic
1172291797 20:33782088-33782110 ATGAGCCATCATGCCCAGCCTGG + Intronic
1172480855 20:35270538-35270560 TTGATCCATTAGGCCAAGGCTGG + Intronic
1172490775 20:35335893-35335915 ATAAGCCACCACGCCTAGCCAGG - Intronic
1175330323 20:58159231-58159253 ATGAGCCATCATGCCCAGCCTGG - Intronic
1175396118 20:58663266-58663288 ATCAGCCTTCAGGGAAAGGCAGG + Intronic
1175444558 20:59011088-59011110 ATCAGCACTCAGGCCACGGCTGG + Intergenic
1176730239 21:10487440-10487462 ATGAGCCACCATGCCCAGGCTGG + Intergenic
1177528737 21:22332947-22332969 AGAATCTATCAGGCCTAGGCAGG + Intergenic
1177564237 21:22797096-22797118 ATGAGCCACCAGGCCTGGGCAGG + Intergenic
1178957376 21:37035483-37035505 ATAAGCCATCATGCCCAACCTGG + Intergenic
1179616430 21:42586491-42586513 AGAAGCCACCAGGCCACAGCAGG + Intergenic
1179616467 21:42586607-42586629 AGAAGCCACCAGGCCACAGCAGG + Intergenic
1179616482 21:42586655-42586677 AGAAGCCACCAGGCCACAGCAGG + Intergenic
1180617961 22:17141019-17141041 ATAGACCACCAGGCCAAGGCTGG + Intronic
1182279529 22:29209696-29209718 CTCAGCCCTCAGGCCCAGGCAGG - Intronic
1182891422 22:33822095-33822117 ACCAGGCATCAGGCCAAGGTTGG - Intronic
1183487901 22:38099249-38099271 GTAAGCCACCATGCCCAGGCTGG - Intronic
1183554717 22:38516273-38516295 ATATGGCATCTGGCTAAGGCTGG - Intergenic
1184193378 22:42909946-42909968 TTAGGGCATCAGGGCAAGGCTGG - Intronic
1184369058 22:44071001-44071023 CTACCCCACCAGGCCAAGGCGGG - Intronic
1184521730 22:44998565-44998587 ATAAGCCATCAGGCCAAGGCGGG + Intronic
950261112 3:11543967-11543989 ATGAACCATCAGCCCCAGGCTGG + Intronic
950802436 3:15564882-15564904 ATGAGCCATCATGCCCAGCCAGG - Intronic
950966141 3:17147338-17147360 ATAAGCCACCACGCCCAGCCCGG - Intergenic
951548646 3:23854497-23854519 AGAAGGCTTCAGGCCAAGGATGG - Intronic
952463208 3:33551599-33551621 ATGAGCCATCATGCCCAGCCAGG + Intronic
954548833 3:51463140-51463162 ATTAGACATCATGCCAGGGCTGG - Exonic
956053126 3:65270248-65270270 ATAAGCCAAAAGAACAAGGCCGG + Intergenic
956421492 3:69090817-69090839 ATAAGCCATCAGAGGAAGACAGG - Intronic
956618285 3:71194925-71194947 AGAAGCCATCAGCCCAAGAGAGG - Intronic
956828528 3:73021516-73021538 ATAAGCCATCACGCCCAGCCTGG + Intronic
957773042 3:84719114-84719136 ATAAACCATGAGACCAAGGAGGG - Intergenic
958919892 3:100092742-100092764 ATAAGACATGAGGACAAGGTAGG - Intronic
959954145 3:112215905-112215927 ATAAGCCAAAAGGACAAAGCTGG + Intronic
960509806 3:118535887-118535909 ATGAGCCACCAGGCCCAGCCTGG - Intergenic
961007509 3:123414847-123414869 ATGAGCCATCAGGGCCGGGCAGG - Intronic
961250342 3:125498563-125498585 AAAATACATGAGGCCAAGGCAGG - Intronic
964766908 3:160188188-160188210 ATCCGCCATCATGCTAAGGCTGG + Intergenic
967025097 3:185557725-185557747 ATAAGCCACCACGCCCAGCCTGG - Intergenic
969942933 4:10753133-10753155 AAAAGACATCTTGCCAAGGCGGG - Intergenic
970320233 4:14867999-14868021 ATAATCTGTCAGGCCAAAGCAGG - Intergenic
973683593 4:53346568-53346590 ATTAGACTTGAGGCCAAGGCTGG - Intronic
974041804 4:56864032-56864054 ATGAGCCATCACGCCCAGCCAGG - Intergenic
974319887 4:60333841-60333863 ACAAGCCTTCAGGCCTAGGAGGG + Intergenic
974587666 4:63900317-63900339 ATAAGCCACCATGCCCAGCCTGG + Intergenic
974783763 4:66590314-66590336 ATTAGACATGAGGACAAGGCAGG - Intergenic
974812129 4:66958014-66958036 ATAAGCCATGTTGCCCAGGCTGG + Intergenic
976562775 4:86521407-86521429 AAAAGCCATCAGGTCAGGGCAGG + Intronic
977184150 4:93916105-93916127 GTAAACCAACAGGCCAAGGCTGG + Intergenic
977925400 4:102694834-102694856 ATAAGCCTTCAGGCCAGGGAGGG - Intronic
981122796 4:141071845-141071867 AAAAGCTATAATGCCAAGGCTGG + Intronic
981709095 4:147691107-147691129 ATAAGACATAAGGCCAATGTAGG + Intergenic
982822528 4:159960312-159960334 ATGAGCCATCATGCCCAGCCTGG + Intergenic
984212461 4:176867328-176867350 ATAAGCCACCATGCCCAGCCAGG + Intergenic
984737796 4:183127017-183127039 ATAAGCCACCATGCCTAGCCAGG + Intronic
985289960 4:188377042-188377064 ATGAGCCACCAGGCCCAGACTGG - Intergenic
985911130 5:2884159-2884181 ATAAGCCATCAGGGCCAGCTAGG + Intergenic
988780687 5:34518916-34518938 ATAATCCCTGAGGCCAAGGTAGG - Intergenic
989628475 5:43456116-43456138 ATGAGCCATCATGCCCAGCCTGG + Intronic
993594414 5:89834848-89834870 ATGAGCCATCAAGCCCAGCCTGG - Intergenic
995525405 5:113046833-113046855 TGAAGCCATCTGCCCAAGGCTGG - Intronic
995744523 5:115390021-115390043 GTAGGCCAGCAGGCCAAGTCAGG + Intergenic
996734888 5:126749433-126749455 ATAAGCCACCAGGCCCACCCTGG + Intergenic
997358389 5:133279006-133279028 ATAAGCCTGCTGGCCAGGGCTGG - Intronic
997870348 5:137500627-137500649 ATCAGCTTTCAGGCCCAGGCTGG + Intronic
997897255 5:137730262-137730284 ATAGCCCATCAGGCCAAGTGAGG + Intronic
998453654 5:142253744-142253766 ATGAGCCACCGGGCCCAGGCTGG + Intergenic
1001991077 5:176115730-176115752 ATAAGCCACCACGCCCAGCCAGG - Intronic
1002225794 5:177722410-177722432 ATAAGCCACCACGCCCAGCCAGG + Intronic
1002268056 5:178048802-178048824 ATAAGCCACCACGCCCAGCCAGG - Intronic
1005726452 6:28653828-28653850 ATAAACCACCATGCCAAGCCAGG + Intergenic
1007601448 6:43084423-43084445 GTAAGCCATCACGCCCAGCCTGG + Intronic
1010220105 6:73441526-73441548 ATCAGCCATTAGGCCTAGGAAGG - Intronic
1013377162 6:109528823-109528845 TTAAGCCAGAAGGCAAAGGCTGG + Intronic
1014281769 6:119449395-119449417 TGAATCCATGAGGCCAAGGCAGG - Intergenic
1016287147 6:142486049-142486071 ATAAGCCACCATGCCCAGCCAGG - Intergenic
1016713203 6:147196619-147196641 GTAAGCCATCCAGCAAAGGCTGG + Intergenic
1017524179 6:155228460-155228482 ATGAGCCATCATGCCCAGCCAGG - Intronic
1020253358 7:6486700-6486722 TTAAGCCATCATGCCCAGACCGG + Intergenic
1022004432 7:26254724-26254746 ATAAGCCACCACGCCCAGCCCGG + Intergenic
1026497648 7:70917520-70917542 ATAAGGACACAGGCCAAGGCGGG - Intergenic
1026720195 7:72824316-72824338 ATGAGCCACCAGGCCTAGCCAGG - Intronic
1027426984 7:78071251-78071273 ATGAGCCACCAGGCCCAGCCAGG - Intronic
1030102960 7:105962386-105962408 AGAGGCCAGCAGCCCAAGGCTGG - Intronic
1031872613 7:127103123-127103145 ATGAGCCATCACACCAAGTCTGG + Intronic
1033804006 7:144934406-144934428 GTAAGCCACCATGCCAAGCCTGG + Intergenic
1033895711 7:146066770-146066792 ATGAGCCATCATGCCCAGCCTGG - Intergenic
1034486593 7:151368817-151368839 ACACGCCCTCAGGCCAAGCCGGG - Exonic
1037562773 8:20089413-20089435 ATAAGCCAGCACACCCAGGCTGG + Intergenic
1039287100 8:36053735-36053757 ATTAGCCATCATGCCCAGCCTGG - Intergenic
1042321354 8:67478752-67478774 ATAAGCCACCATGCCCAGCCAGG - Intronic
1044517575 8:93156982-93157004 ACAAGCCAGCATGCTAAGGCTGG - Intronic
1044603434 8:94028210-94028232 ATAAGACATCAAGTCATGGCTGG + Intergenic
1046628980 8:116604678-116604700 AGAAGTCATCAGGCGGAGGCTGG + Intergenic
1050212127 9:3272118-3272140 ATAAGCCTTCAGGTAAAAGCAGG + Intronic
1052283406 9:26757682-26757704 GTAAGATATCAGGCCCAGGCTGG + Intergenic
1052873954 9:33538454-33538476 ATGAGCCACCAGGCCCAGCCTGG - Intronic
1053798499 9:41747660-41747682 ATAAGCCATCTTGGCCAGGCTGG + Intergenic
1054186914 9:61959706-61959728 ATAAGCCATCTTGGCCAGGCTGG + Intergenic
1055395246 9:75867251-75867273 ATAAGCTCTCAGGTCAATGCTGG + Intergenic
1055527982 9:77154724-77154746 ATAAGCCATTAAGCTCAGGCAGG + Intergenic
1056575657 9:87854356-87854378 ATCAGACTTCAGGCCAAAGCTGG - Intergenic
1056616494 9:88171742-88171764 ATGAGCCACCAGGCCCAGCCAGG - Intergenic
1056789769 9:89617911-89617933 CTCAGCCCTCAGCCCAAGGCTGG + Intergenic
1056933680 9:90899162-90899184 ATCCCCCATCAGGCCAAAGCAGG + Intergenic
1059091583 9:111365022-111365044 ATAATCCTGGAGGCCAAGGCGGG + Intronic
1060127818 9:121066981-121067003 ATGAGCCATCATGCCCAGCCAGG - Intergenic
1060462973 9:123875884-123875906 CTAAAGCATCAGGCCAAGGCAGG + Intronic
1061093690 9:128441807-128441829 GTGAGCCACCAGGCCAAGGCTGG + Intergenic
1062490229 9:136801421-136801443 ATGAGCCACCATGCCCAGGCCGG - Intronic
1203495983 Un_GL000224v1:151985-152007 AAAAACCATCAGACCATGGCAGG + Intergenic
1203508606 Un_KI270741v1:93908-93930 AAAAACCATCAGACCATGGCAGG + Intergenic
1203584040 Un_KI270746v1:46633-46655 ATGAGCCACCATGCCCAGGCTGG - Intergenic
1185915950 X:4035407-4035429 ATCAGCTGTCAAGCCAAGGCAGG + Intergenic
1186017504 X:5214312-5214334 ATGAGCCACCAGGCCCAGCCAGG + Intergenic
1186060765 X:5703647-5703669 ATGAGCCACCACGCCCAGGCGGG + Intergenic
1187126857 X:16462210-16462232 ATGGGCCAGCAGGCCAAGGCTGG + Intergenic
1188639773 X:32486550-32486572 CTAAGCCAACAGGACAAAGCTGG + Intronic
1189239090 X:39511998-39512020 GAAAGCCACCAGGCCAATGCGGG + Intergenic
1189987113 X:46563354-46563376 ATGAGCCACCAGGCCCAGCCAGG + Intergenic
1191183050 X:57582517-57582539 CAGAGACATCAGGCCAAGGCTGG - Intergenic
1191214322 X:57919858-57919880 CAGAGACATCAGGCCAAGGCTGG + Intergenic
1191851246 X:65587898-65587920 AGAGGCCCTCATGCCAAGGCAGG - Intergenic
1193702534 X:84780414-84780436 ATAAGCCATCACACCCAGCCGGG + Intergenic
1196931135 X:120683289-120683311 TTAGGCTTTCAGGCCAAGGCAGG - Intergenic
1199991629 X:152990552-152990574 AGAAGCCATCAGGGAGAGGCCGG - Exonic
1200297289 X:154933361-154933383 ATAAGCTATCTGGCCAAGTTGGG + Intronic