ID: 1184522774

View in Genome Browser
Species Human (GRCh38)
Location 22:45005439-45005461
Sequence TGTCCTACCATTCGGAGACT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 52
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 49}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184522774 Original CRISPR TGTCCTACCATTCGGAGACT AGG (reversed) Intronic
904908684 1:33917602-33917624 AGTCCTACCCTTCAGACACTGGG + Intronic
906419263 1:45650209-45650231 TGTTCTAGGATTAGGAGACTTGG - Intronic
914677965 1:149918147-149918169 GGTCCTGCCATACTGAGACTGGG - Intergenic
922358548 1:224799483-224799505 TGTTCTACCTTTTGGAGAATTGG - Intergenic
1064039160 10:11943653-11943675 TGTCCTTCCATCCTCAGACTTGG - Intronic
1068201739 10:53791990-53792012 TGTTTCACCATTCAGAGACTGGG + Intergenic
1073866079 10:107805552-107805574 TGTCCTACTTTCCAGAGACTTGG + Intergenic
1082838231 11:57667415-57667437 TGGCCAACCATTTGGCGACTAGG - Intergenic
1094083608 12:26564822-26564844 TGTCTCACAATTTGGAGACTAGG - Intronic
1109012809 13:56972954-56972976 TATCCTACCAGTCAAAGACTTGG - Intergenic
1111627213 13:90804503-90804525 TGACTTACCATTCTGGGACTTGG + Intergenic
1114036527 14:18634909-18634931 TGTCCTACAAAGCGGACACTGGG + Intergenic
1114122105 14:19680128-19680150 TGTCCTACAAAGCGGACACTGGG - Intergenic
1115467340 14:33729950-33729972 TGTCCTGCTTTTCGGAAACTAGG + Intronic
1128643294 15:69356258-69356280 TGTCCTGCCATTAGGTGAATTGG + Intronic
1139127537 16:64097669-64097691 TGTCCTCTCATTCTGAGACTGGG - Intergenic
1143135914 17:4712114-4712136 TGTCCTCCCATTAGGAGCCCTGG - Intronic
1151133284 17:71920818-71920840 TATTCTACAATTCAGAGACTTGG - Intergenic
1157176852 18:45459696-45459718 TGGCCTGACATTCAGAGACTAGG + Intronic
1157402471 18:47400005-47400027 TGACCTGCCATCCAGAGACTGGG + Intergenic
1168370665 19:55831220-55831242 TCTCCTTCCTTTCGGAGCCTAGG + Intronic
926369642 2:12167035-12167057 TGTCCTACCATGCTGTGACGAGG - Intergenic
937007229 2:118528137-118528159 TGTCCTACCATGGGCAGACAAGG + Intergenic
939635293 2:144575103-144575125 GCTCCTACCATTCTGAGATTGGG - Intergenic
939760489 2:146171378-146171400 TATCCTACCATTTGGATGCTGGG + Intergenic
943884746 2:193201989-193202011 TGTCCTACTATAAGAAGACTGGG + Intergenic
946477545 2:220023011-220023033 TGTTCTACAGTTAGGAGACTGGG + Intergenic
947075300 2:226337105-226337127 TGTCCTATCATTTGTAAACTTGG + Intergenic
947719503 2:232361796-232361818 TGTTCAACCAATCAGAGACTAGG - Intergenic
1180460652 22:15561966-15561988 TGTCCTACAAAGCGGACACTGGG + Intergenic
1184522774 22:45005439-45005461 TGTCCTACCATTCGGAGACTAGG - Intronic
949708041 3:6841327-6841349 TCTCCAACCATTTGGAGGCTAGG - Intronic
955110050 3:55940085-55940107 TGTCCTCCCATTGGGAATCTAGG - Intronic
964776390 3:160282899-160282921 TGTCCTACCTTTCGTAGTCAAGG + Intronic
972174501 4:36386789-36386811 TGTCCTTCCATGGGGAGCCTTGG + Intergenic
975588987 4:75981364-75981386 GGTCCTACCATTCGCAGATCTGG + Exonic
983234250 4:165161276-165161298 TGTCCAACCATACTTAGACTTGG - Intronic
998179248 5:139924988-139925010 TGTCCTACTGTCCTGAGACTCGG - Intronic
1021004970 7:15383060-15383082 TGCCCTCCCATTCGTAGGCTGGG + Intronic
1024517316 7:50269812-50269834 TGCCCTACCATTCAGAGAAAAGG - Intergenic
1025907263 7:65797132-65797154 TCTCTTACCATTCCCAGACTGGG + Intergenic
1037085531 8:14844598-14844620 TGTCCTAACATGAGGAGATTTGG + Intronic
1043052228 8:75398225-75398247 TGTCCCACCATTCTTAGAGTGGG - Intergenic
1045290014 8:100825049-100825071 TCACCTACCATTGGCAGACTGGG + Intergenic
1048177668 8:132167754-132167776 TGTCCTAGCTGTCAGAGACTTGG - Intronic
1050912795 9:11094724-11094746 TATCCTAATATTGGGAGACTTGG + Intergenic
1051504998 9:17817286-17817308 TTTCCATCCATACGGAGACTGGG - Intergenic
1054927969 9:70607207-70607229 TGTCCTACCTTTCAGAAACTTGG + Intronic
1192408443 X:70910305-70910327 TGTCCAATCATTAGGAAACTAGG + Intergenic
1194915888 X:99708165-99708187 TGTCCTACCATTATTAGAGTTGG - Intergenic
1196563269 X:117176194-117176216 TATCCTCCCATTCAAAGACTTGG - Intergenic
1201622491 Y:15975716-15975738 TGTCCTTCCTTTAGGACACTTGG - Intergenic