ID: 1184523951

View in Genome Browser
Species Human (GRCh38)
Location 22:45010366-45010388
Sequence TATCAGAGGGAGGCGGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184523951_1184523965 30 Left 1184523951 22:45010366-45010388 CCCTCCTCCGCCTCCCTCTGATA No data
Right 1184523965 22:45010419-45010441 CCATACCAGCGCCGCGACTTGGG No data
1184523951_1184523963 29 Left 1184523951 22:45010366-45010388 CCCTCCTCCGCCTCCCTCTGATA No data
Right 1184523963 22:45010418-45010440 TCCATACCAGCGCCGCGACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184523951 Original CRISPR TATCAGAGGGAGGCGGAGGA GGG (reversed) Intergenic
No off target data available for this crispr