ID: 1184525315

View in Genome Browser
Species Human (GRCh38)
Location 22:45019292-45019314
Sequence GAGGGAAGCAAGGAGCCTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184525315_1184525326 26 Left 1184525315 22:45019292-45019314 CCTGCAGGCTCCTTGCTTCCCTC No data
Right 1184525326 22:45019341-45019363 AAAGCAAGTTGATGAGATTAAGG No data
1184525315_1184525327 27 Left 1184525315 22:45019292-45019314 CCTGCAGGCTCCTTGCTTCCCTC No data
Right 1184525327 22:45019342-45019364 AAGCAAGTTGATGAGATTAAGGG No data
1184525315_1184525328 28 Left 1184525315 22:45019292-45019314 CCTGCAGGCTCCTTGCTTCCCTC No data
Right 1184525328 22:45019343-45019365 AGCAAGTTGATGAGATTAAGGGG No data
1184525315_1184525323 1 Left 1184525315 22:45019292-45019314 CCTGCAGGCTCCTTGCTTCCCTC No data
Right 1184525323 22:45019316-45019338 GGGAGTTTTGGTTTCCTCCTGGG No data
1184525315_1184525322 0 Left 1184525315 22:45019292-45019314 CCTGCAGGCTCCTTGCTTCCCTC No data
Right 1184525322 22:45019315-45019337 TGGGAGTTTTGGTTTCCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184525315 Original CRISPR GAGGGAAGCAAGGAGCCTGC AGG (reversed) Intergenic
No off target data available for this crispr