ID: 1184526300

View in Genome Browser
Species Human (GRCh38)
Location 22:45025471-45025493
Sequence ACACCCAGGTTTGCTGCTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184526300_1184526309 26 Left 1184526300 22:45025471-45025493 CCAGAAGCAGCAAACCTGGGTGT No data
Right 1184526309 22:45025520-45025542 TCCTAGATATTCTTACATGTAGG No data
1184526300_1184526303 2 Left 1184526300 22:45025471-45025493 CCAGAAGCAGCAAACCTGGGTGT No data
Right 1184526303 22:45025496-45025518 GTTGGAAGCAGCCCCAGCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184526300 Original CRISPR ACACCCAGGTTTGCTGCTTC TGG (reversed) Intergenic
No off target data available for this crispr