ID: 1184526940

View in Genome Browser
Species Human (GRCh38)
Location 22:45029620-45029642
Sequence CAGTGTGTCCAGAGAGCAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184526937_1184526940 -8 Left 1184526937 22:45029605-45029627 CCAGAGAAAGCCATCCAGTGTGT No data
Right 1184526940 22:45029620-45029642 CAGTGTGTCCAGAGAGCAGCAGG No data
1184526936_1184526940 3 Left 1184526936 22:45029594-45029616 CCATGTTTAAGCCAGAGAAAGCC No data
Right 1184526940 22:45029620-45029642 CAGTGTGTCCAGAGAGCAGCAGG No data
1184526932_1184526940 24 Left 1184526932 22:45029573-45029595 CCCTGGTCCTGACAAAGCTTCCC No data
Right 1184526940 22:45029620-45029642 CAGTGTGTCCAGAGAGCAGCAGG No data
1184526934_1184526940 17 Left 1184526934 22:45029580-45029602 CCTGACAAAGCTTCCCATGTTTA No data
Right 1184526940 22:45029620-45029642 CAGTGTGTCCAGAGAGCAGCAGG No data
1184526933_1184526940 23 Left 1184526933 22:45029574-45029596 CCTGGTCCTGACAAAGCTTCCCA No data
Right 1184526940 22:45029620-45029642 CAGTGTGTCCAGAGAGCAGCAGG No data
1184526935_1184526940 4 Left 1184526935 22:45029593-45029615 CCCATGTTTAAGCCAGAGAAAGC No data
Right 1184526940 22:45029620-45029642 CAGTGTGTCCAGAGAGCAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184526940 Original CRISPR CAGTGTGTCCAGAGAGCAGC AGG Intergenic
No off target data available for this crispr