ID: 1184528152

View in Genome Browser
Species Human (GRCh38)
Location 22:45037658-45037680
Sequence GGTGACAGCATTCCAATGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184528147_1184528152 5 Left 1184528147 22:45037630-45037652 CCATCGGTGGGTGACTGCTCCAT No data
Right 1184528152 22:45037658-45037680 GGTGACAGCATTCCAATGGCAGG No data
1184528143_1184528152 26 Left 1184528143 22:45037609-45037631 CCATGAGAGGGTGACAGTATTCC No data
Right 1184528152 22:45037658-45037680 GGTGACAGCATTCCAATGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184528152 Original CRISPR GGTGACAGCATTCCAATGGC AGG Intergenic
No off target data available for this crispr