ID: 1184533379

View in Genome Browser
Species Human (GRCh38)
Location 22:45070826-45070848
Sequence AGGGTGAGTCCCACCTTAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184533376_1184533379 -8 Left 1184533376 22:45070811-45070833 CCTTGTACGGCCCTGAGGGTGAG No data
Right 1184533379 22:45070826-45070848 AGGGTGAGTCCCACCTTAGATGG No data
1184533364_1184533379 28 Left 1184533364 22:45070775-45070797 CCTCACCCTGGGCCAGCACTAGA No data
Right 1184533379 22:45070826-45070848 AGGGTGAGTCCCACCTTAGATGG No data
1184533372_1184533379 -3 Left 1184533372 22:45070806-45070828 CCTGCCCTTGTACGGCCCTGAGG No data
Right 1184533379 22:45070826-45070848 AGGGTGAGTCCCACCTTAGATGG No data
1184533375_1184533379 -7 Left 1184533375 22:45070810-45070832 CCCTTGTACGGCCCTGAGGGTGA No data
Right 1184533379 22:45070826-45070848 AGGGTGAGTCCCACCTTAGATGG No data
1184533369_1184533379 16 Left 1184533369 22:45070787-45070809 CCAGCACTAGAGGAGGCACCCTG No data
Right 1184533379 22:45070826-45070848 AGGGTGAGTCCCACCTTAGATGG No data
1184533362_1184533379 30 Left 1184533362 22:45070773-45070795 CCCCTCACCCTGGGCCAGCACTA No data
Right 1184533379 22:45070826-45070848 AGGGTGAGTCCCACCTTAGATGG No data
1184533368_1184533379 22 Left 1184533368 22:45070781-45070803 CCTGGGCCAGCACTAGAGGAGGC No data
Right 1184533379 22:45070826-45070848 AGGGTGAGTCCCACCTTAGATGG No data
1184533371_1184533379 -2 Left 1184533371 22:45070805-45070827 CCCTGCCCTTGTACGGCCCTGAG No data
Right 1184533379 22:45070826-45070848 AGGGTGAGTCCCACCTTAGATGG No data
1184533363_1184533379 29 Left 1184533363 22:45070774-45070796 CCCTCACCCTGGGCCAGCACTAG No data
Right 1184533379 22:45070826-45070848 AGGGTGAGTCCCACCTTAGATGG No data
1184533366_1184533379 23 Left 1184533366 22:45070780-45070802 CCCTGGGCCAGCACTAGAGGAGG No data
Right 1184533379 22:45070826-45070848 AGGGTGAGTCCCACCTTAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184533379 Original CRISPR AGGGTGAGTCCCACCTTAGA TGG Intergenic
No off target data available for this crispr