ID: 1184533513

View in Genome Browser
Species Human (GRCh38)
Location 22:45071473-45071495
Sequence CGCTTCTTCTGTCCCTTTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184533513_1184533517 7 Left 1184533513 22:45071473-45071495 CCTGGAAAGGGACAGAAGAAGCG No data
Right 1184533517 22:45071503-45071525 GCAGAACAAGGAGAGGGAGCAGG No data
1184533513_1184533522 20 Left 1184533513 22:45071473-45071495 CCTGGAAAGGGACAGAAGAAGCG No data
Right 1184533522 22:45071516-45071538 AGGGAGCAGGGGGCACCGGAAGG No data
1184533513_1184533514 -5 Left 1184533513 22:45071473-45071495 CCTGGAAAGGGACAGAAGAAGCG No data
Right 1184533514 22:45071491-45071513 AAGCGAATGAGAGCAGAACAAGG No data
1184533513_1184533515 0 Left 1184533513 22:45071473-45071495 CCTGGAAAGGGACAGAAGAAGCG No data
Right 1184533515 22:45071496-45071518 AATGAGAGCAGAACAAGGAGAGG No data
1184533513_1184533519 9 Left 1184533513 22:45071473-45071495 CCTGGAAAGGGACAGAAGAAGCG No data
Right 1184533519 22:45071505-45071527 AGAACAAGGAGAGGGAGCAGGGG No data
1184533513_1184533516 1 Left 1184533513 22:45071473-45071495 CCTGGAAAGGGACAGAAGAAGCG No data
Right 1184533516 22:45071497-45071519 ATGAGAGCAGAACAAGGAGAGGG No data
1184533513_1184533518 8 Left 1184533513 22:45071473-45071495 CCTGGAAAGGGACAGAAGAAGCG No data
Right 1184533518 22:45071504-45071526 CAGAACAAGGAGAGGGAGCAGGG No data
1184533513_1184533520 10 Left 1184533513 22:45071473-45071495 CCTGGAAAGGGACAGAAGAAGCG No data
Right 1184533520 22:45071506-45071528 GAACAAGGAGAGGGAGCAGGGGG No data
1184533513_1184533523 25 Left 1184533513 22:45071473-45071495 CCTGGAAAGGGACAGAAGAAGCG No data
Right 1184533523 22:45071521-45071543 GCAGGGGGCACCGGAAGGAAAGG No data
1184533513_1184533521 16 Left 1184533513 22:45071473-45071495 CCTGGAAAGGGACAGAAGAAGCG No data
Right 1184533521 22:45071512-45071534 GGAGAGGGAGCAGGGGGCACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184533513 Original CRISPR CGCTTCTTCTGTCCCTTTCC AGG (reversed) Intergenic
No off target data available for this crispr