ID: 1184533518

View in Genome Browser
Species Human (GRCh38)
Location 22:45071504-45071526
Sequence CAGAACAAGGAGAGGGAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184533513_1184533518 8 Left 1184533513 22:45071473-45071495 CCTGGAAAGGGACAGAAGAAGCG No data
Right 1184533518 22:45071504-45071526 CAGAACAAGGAGAGGGAGCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184533518 Original CRISPR CAGAACAAGGAGAGGGAGCA GGG Intergenic
No off target data available for this crispr