ID: 1184534544

View in Genome Browser
Species Human (GRCh38)
Location 22:45077642-45077664
Sequence TCCCCAACCCCAGTTAGCTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1184534534_1184534544 9 Left 1184534534 22:45077610-45077632 CCCCTCCTGCCCTCCCACCTGGG No data
Right 1184534544 22:45077642-45077664 TCCCCAACCCCAGTTAGCTTTGG No data
1184534531_1184534544 24 Left 1184534531 22:45077595-45077617 CCAGCGCCAGGGAAGCCCCTCCT No data
Right 1184534544 22:45077642-45077664 TCCCCAACCCCAGTTAGCTTTGG No data
1184534541_1184534544 -4 Left 1184534541 22:45077623-45077645 CCCACCTGGGTCAACAGTCTCCC No data
Right 1184534544 22:45077642-45077664 TCCCCAACCCCAGTTAGCTTTGG No data
1184534538_1184534544 4 Left 1184534538 22:45077615-45077637 CCTGCCCTCCCACCTGGGTCAAC No data
Right 1184534544 22:45077642-45077664 TCCCCAACCCCAGTTAGCTTTGG No data
1184534539_1184534544 0 Left 1184534539 22:45077619-45077641 CCCTCCCACCTGGGTCAACAGTC No data
Right 1184534544 22:45077642-45077664 TCCCCAACCCCAGTTAGCTTTGG No data
1184534532_1184534544 18 Left 1184534532 22:45077601-45077623 CCAGGGAAGCCCCTCCTGCCCTC No data
Right 1184534544 22:45077642-45077664 TCCCCAACCCCAGTTAGCTTTGG No data
1184534542_1184534544 -5 Left 1184534542 22:45077624-45077646 CCACCTGGGTCAACAGTCTCCCC No data
Right 1184534544 22:45077642-45077664 TCCCCAACCCCAGTTAGCTTTGG No data
1184534543_1184534544 -8 Left 1184534543 22:45077627-45077649 CCTGGGTCAACAGTCTCCCCAAC No data
Right 1184534544 22:45077642-45077664 TCCCCAACCCCAGTTAGCTTTGG No data
1184534540_1184534544 -1 Left 1184534540 22:45077620-45077642 CCTCCCACCTGGGTCAACAGTCT No data
Right 1184534544 22:45077642-45077664 TCCCCAACCCCAGTTAGCTTTGG No data
1184534536_1184534544 8 Left 1184534536 22:45077611-45077633 CCCTCCTGCCCTCCCACCTGGGT No data
Right 1184534544 22:45077642-45077664 TCCCCAACCCCAGTTAGCTTTGG No data
1184534530_1184534544 25 Left 1184534530 22:45077594-45077616 CCCAGCGCCAGGGAAGCCCCTCC No data
Right 1184534544 22:45077642-45077664 TCCCCAACCCCAGTTAGCTTTGG No data
1184534537_1184534544 7 Left 1184534537 22:45077612-45077634 CCTCCTGCCCTCCCACCTGGGTC No data
Right 1184534544 22:45077642-45077664 TCCCCAACCCCAGTTAGCTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1184534544 Original CRISPR TCCCCAACCCCAGTTAGCTT TGG Intergenic
No off target data available for this crispr